Background: Campylobacter jejuni and Campylobacter coli are identified as the major causes of acute gastroenteritis in humans.
Because of the fastidious nature of Campylobacters, many clinical laboratories fail to routinely culture them. The detection of
Campylobacter spp. using molecular-based techniques can be useful for diagnostic and epidemiological applications. This study aimed to
develop a multiplex PCR assay for the simultaneous detection of C. jejuni and C. coli strains from clinical specimens.
Materials and Methods: During a 19-month period, stool samples were collected from 980 children admitted to a hospital in Tehran,
Iran and then examined. The samples were cultured on both Brucella agar and Modified Charcoal-Cefoperazone-Deoxycholate
agar (mCCDA) media at 42\ub0C for 48 h. To confirm suspected bacteria, Gram staining and other biochemical tests were carried out.
Finally, after extracting DNA from pure cultures using the boiling method, the multiplex PCR assay was performed.
Results: The multiplex PCR assay showed that Campylobacter spp. can be detected using 400 bp target product of cadF. It can also
accurately distinguish between C. jejuni and C. coli species with different bands of 735 bp and 500 bp using hipO and asp genes,
respectively.
Conclusions: Results showed that the multiplex PCR assay can replace the biochemical assays for differentiating between C. jejuni and
C. coli strains in a single-step PCR test

Ghorbanalizadgan, Mehdi

Haj Mahmmodi, Somayeh

Piccirillo, Alessandra

Shams, Saeed

English

Background: Campylobacter jejuni and Campylobacter coli are identified as the major causes of acute gastroenteritis in humans.
Because of the fastidious nature of Campylobacters, many clinical laboratories fail to routinely culture them. The detection of
Campylobacter spp. using molecular-based techniques can be useful for diagnostic and epidemiological applications. This study aimed to
develop a multiplex PCR assay for the simultaneous detection of C. jejuni and C. coli strains from clinical specimens.
Materials and Methods: During a 19-month period, stool samples were collected from 980 children admitted to a hospital in Tehran,
Iran and then examined. The samples were cultured on both Brucella agar and Modified Charcoal-Cefoperazone-Deoxycholate
agar (mCCDA) media at 42°C for 48 h. To confirm suspected bacteria, Gram staining and other biochemical tests were carried out.
Finally, after extracting DNA from pure cultures using the boiling method, the multiplex PCR assay was performed.
Results: The multiplex PCR assay showed that Campylobacter spp. can be detected using 400 bp target product of cadF. It can also
accurately distinguish between C. jejuni and C. coli species with different bands of 735 bp and 500 bp using hipO and asp genes,
respectively.
Conclusions: Results showed that the multiplex PCR assay can replace the biochemical assays for differentiating between C. jejuni and
C. coli strains in a single-step PCR test

Archivio istituzionale della ricerca - Università di Padova

Infect Epidemiol Med. 2017 Winter; Volume 3, Issue 1: 6-8 DOI:10.18869/acadpub.iem.3.1.6 Original Article  Copyright © 2017, Infection, Epidemiology and Medicine; Tarbiat Modares University. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License, which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.    Evaluation  of  a  Multiplex  PCR  Assay  for  the  Identification  of Campylobacter jejuni and Campylobacter coli  Saeed Shams1, 2, Mehdi Ghorbanalizadgan3*, Somayeh Haj Mahmmodi4, Alessandra Piccirillo5  1Cellular and Molecular Research Center, Qom University of Medical Sciences, Qom, IR Iran  2Department of Medical Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, IR Iran 3Department of Bacteriology, Faculty of Medical Sciences, Baqiyatallah University, Tehran, IR Iran 4Laboratory of Children's Medical Center. Tehran, Iran  5Department of Comparative Biomedicine and Food Science, University of Padua, Padova, Italy  *Corresponding author: Mehdi Ghorbanalizadgan, Department of Bacteriology, Faculty of Medical Sciences, Baqiyatallah University, Tehran, Iran, Tel: +989124242951, E-mail: Gh_mahdi52@yahoo.com  Submitted: October 08, 2016; Revised: December 05, 2016; Accepted: December 09, 2016  Background: Campylobacter jejuni and Campylobacter coli are identified as the major causes of acute gastroenteritis in humans. Because of the fastidious nature of Campylobacters, many clinical laboratories fail to routinely culture them. The detection of Campylobacter spp. using molecular-based techniques can be useful for diagnostic and epidemiological applications. This study aimed to develop a multiplex PCR assay for the simultaneous detection of C. jejuni and C. coli strains from clinical specimens. Materials and Methods: During a 19-month period, stool samples were collected from 980 children admitted to a hospital in Tehran, Iran and then examined. The samples were cultured on both Brucella agar and Modified Charcoal-Cefoperazone-Deoxycholate agar (mCCDA) media at 42°C for 48 h. To confirm suspected bacteria, Gram staining and other biochemical tests were carried out. Finally, after extracting DNA from pure cultures using the boiling method, the multiplex PCR assay was performed. Results: The multiplex PCR assay showed that Campylobacter spp. can be detected using 400 bp target product of cadF. It can also accurately distinguish between C. jejuni and C. coli species with different bands of 735 bp and 500 bp using hipO and asp genes, respectively. Conclusions: Results showed that the multiplex PCR assay can replace the biochemical assays for differentiating between C. jejuni and C. coli strains in a single-step PCR test.  Keywords: Campylobacter jejuni, Campylobacter coli, Multiplex PCR  1. Background Campylobacter spp. is a common cause of acute gastroenteritis worldwide (1). Among various pathogenic Campylobacter species in humans, the thermophilic Campylobacter jejuni and Campylobacter coli are recognized as the major cause of human campylobacteriosis (2). The major reservoir and source of Campylobacters for humans are poultry and poultry products. Undercooked poultry meat, unpasteurized milk, and water can be considered as the sources of human infection with C. jejuni and C. coli (3). The gastrointestinal manifestations of campylobacteriosis disease include cramps, fever, myalgia, weight loss, acute watery or bloody diarrhea; however, the infection may result in severe extra-intestinal sequelae, especially acute immune-mediated neurologic complications such as Guillain-Barre and Miller Fisher syndromes, due to cross-reactivity between the bacterial lipooligosaccharides and nervous system gangl-iosides (4).  Isolation of Campylobacters using the culture method is considered the gold standard for campylobacteriosis disease diagnosis; however, it has several limitations because of the fastidious nature of Campylobacters (5). Furthermore, due to the phylogenetic relatedness of C. jejuni and C. coli species, the identification of Campylobacter at species level using biochemical assays is difficult (6). Therefore, other techniques such as PCR and real-time PCR are used as the methods for Campylobacter identification, showing a very high sensitivity (7-8).   Differentiation of Campylobacter spp. using molecular-based assays can be useful for rapid and specific detection and  epidemiological applications. For this purpose, various genes including fliY, cdt, asp, hipO , glyA, ceuE, cadF  are used (9).  The asp gene encodes aspartokinase enzyme and is highly specific for C. coli. Hippuricase is produced by the hipO gene   in C. jejuni (a species-specific hippurate hydrolase enzyme), which is absent in C. coli. The cadF gene also encodes a fibronectin-binding protein that can promote the attachment of the microorganism to eukaryote cells. It has been described as a conserved and genus-specific gene (10-12).   2. Objectives The aim of this study was to differentiate between C. jejuni and C. coli species  using  a  set  of  specific  primers  for  asp, hipO, and cadF genes in a multiplex PCR assay.  3. Materials and Methods  3.1. Sampling and growth conditions During a 19-month period (June 2012-January 2014), 980 children with intestinal signs were admitted to one of the major hospitals in Tehran, Iran. 750 suspected cases to campylobacteriosis were included in this study. After collecting the samples, the stool specimens using Carry-Blair Transport media (Micro Media, Hungary) were transferred to the microbiological laboratory and then cultured immediately on Brucella agar (Merck, Germany) with 5% sheep blood and Modified Charcoal–Cefoperazone-Deoxycholate agar (mCCDA) (Merck, Germany). The plates were incubated at 42°C for 48 h under microaerobic conditions in a sealed jar using gas packs (Merck, Germany). Both of the media were supplemented with vancomycin, polymyxin B, and trimethoprim (pH 7.2±0.2). Suspected colonies to Campylobacter spp. were confirmed using Gram staining and spiral morphology, catalase and oxidase positive, nitrate reduction positive, and indoxyl acetate hydrolysis positive. For differenting between them at species level, hippurate hydrolysis test positive (C. jejuni) and negative (C. coli) as well as susceptiblity to nalidixic acid (C. coli) were used. Shams S et al.    Infect Epidemiol Med. 2017; Volume 3, Issue 1: 6-8 7 3.2. DNA extraction and multiplex PCR assay  DNA extraction from pure cultures of Campylobacter isolates was performed by the boiling method in 200 μL sterile distilled water and boiled for 15 min at 100°C. Suspension was then centrifuged at 13,000 g at room temperature for 10 min, and the supernatant was used as template DNA in multiple PCR assay. The multiplex PCR was carried out within a thermal cycler (Eppendorf, Germany) in a 25-μL reaction mixture containing 10 mg of DNA template, 2.5 μL PCR buffer 10X, 200 μM dNTP, 5 mM MgCl2, 0.1 μM of specific primers (Table 1), 1 unit of Taq DNA polymerase and sterile deionized water.  Amplification conditions for the three genes (asp, hipO, and cadF)  were  as  follow:  95°C  for  5  min,  followed  by  30  amplification cycles; denaturation at 95°C for 45 seconds, annealing at 48°C for 30 seconds, and extension at 72°C for 30 seconds. Finally, an additional extension step (5 min, 72°C) was performed. Finally, amplicons were electrophoresed on 1% agarose gel. C. coli ATCC 43478 and C. jejuni subsp. jejuni ATCC 29428 were used as reference strains.  4. Results Among studied population, 750 children had bacterial systemic and gastrointestinal symptoms including fever, abdominal pain, vomiting, diarrhea with high WBC and RBC count. From a total of 750 cases, 48.5 and 51.5% were male and female, respectively, with an average age of ~6 years. According to the culture results, the number of Campylobacter positive cases was 35, in which 33 cases (94 %) were infected by C. jejuni, and 2 cases (6 %) were infected by C. coli. About 50% of the bacteria were isolated by each of the media (Brucella agar and mCCDA). Most of the positive cases occurred during the summer season from July to September.     The multiplex PCR assay showed that Campylobacter spp. can be detected using 400 bp target product of cadF. It can also accurately distinguish between C. jejuni and C. coli species with different bands of 735 bp and 500 bp using hipO and asp genes, respectively (Fig.1).   5. Discussion Campylobacter species have currently been reported as the most common causes of acute bacterial gastroenteritis worldwide both in developing and developed countries. Some studies showed that gastrointestinal infection caused by C. jejuni leads to the high levels of morbidity and mortality. About 2 million cases are annually reported to be infected by C. jejuni  with a mortality rate greater than 2,000 people (13). Although biochemical tests such as hippurate hydrolysis are useful for the differentiation of Campylobacters at the species level, they could also be used for the identification of hippurate hydrolysis-negative strains of C. jejuni and false-positive isolates (14). Another disadvantage of conventional tests is that they are extremely time consuming. In this study, the time required for the identification of Campylobacter at the species level from a sample was approximately 4 days.  In addition, the accurate differentiation between two Campylobacter species is important for the following treatment of the disease in human. For example erythromycin is used for treating C. jejuni infection, while C. coli strains are resistant to this antibiotic (6). Therefore, an accurate molecular method can be easily used for clinical diagnosis and appropriate treatment of the disease.  In some previous studies, only one gene was used for differentiating between C. jejuni and C. coli strains. Klena et al. (2004) used divergent and conserved regions of lpxA gene of the lipid A, encoding a UDP-N- acetyl glucosamine acyl transferase, to differentiate between C. coli, C. jejuni, C. lari, and C. upsaliensis strains using a multiplex PCR. In another study conducted by Shams et al. (2016), conserved regions of the cadF gene were used for the detection and differentiation between C. jejuni and C. coli species. In another study, Gonzalez et al. (1997) also discriminated between both C. jejuni and C.  coli species using the ceuE gene (7, 15-16). Our study is similar to Al Amri et al. (2007) who used a combination of the genus-specific virulence gene (cadF) together with the hippuricase gene (C. jejuni) and the aspartokinase gene (C. coli), respectively. The same PCR assay was developed to detect isolated strains from Iranian patients (10). Other genes have also been used for distinguishing Campylobacter spp. by multiplex PCR method. For example, Cloak et al. (2002) developed a multiplex PCR method using the cadF gene of pathogenic Campylobacter spp and a specific but undefined gene of C. jejuni and the ceuE gene of C. coli. The lpxA, hipO, and glyA genes were used by Adzitey et al. (2011) to differentiate between C. jejuni and C. coli species. In another study, ceuE, cadF, and oxidoreductase subunit genes were used for the differentiation purpose (6, 17-18).  In all mentioned studies the multiplex PCRs were able to amplify products with different sizes which can be concurrently visualized on the agarose gel without extra reaction and electrophoresis. Thus, it could be considered as a significant advantage over single-species identification systems for the evaluation of the disease in a large number of clinical specimens.  6. Conclusion The designed multiplex PCR assay in this study is a sensitive and specific tool which can be useful for the rapid and simultaneous detection and differentiation of C. jejuni and C. coli species in clinical settings.  Conflict of Interest The authors declare they have no conflict of interest.   Acknowledgments The authors acknowledge with grateful appreciation the kind assistance provided by the Vice Chancellor for Research at the Tarbiat Modares University. We also thank hospital personnel, especially Mrs. Kashi, for her helps.       Authors’ Contributions  All of authors contribute to this study.  Funding/Support This work was supported by a grant from Research council of Tarbiat Modares University.  Table 1. Nucleotide sequences of the primers used in the multiplex PCR assay. Primer Sequence ( 5' to 3' ) Size of product (bp) Targets Annealing temperature (°C) Gene Bacteria cadF -F cadF -R TTGAAGGTAATTTAGATATG CTAATACCTAAAGTTGAAAC 400 cadF C. jejuni & C. coli 43 asp-F asp-R GGTATGATTTCTACAAAGCGAG ATAAAAGACTATCGTCGCGTG 500 asp C. coli 43 hipO -F hipO -R GAAGAGGGTTTGGGTGGTG AGCTAGCTTCGCATAATAACTTG 735 hipO C. jejuni 43 A multiplex PCR assay for the detection of Campylobacter spp    Infect Epidemiol Med. 2017; Volume 3, Issue 1: 6-8 8    Fig. 1: Gel electrophoresis of the multiplex PCR.  Lane 1, 400 bp fragment of the cadF gene of Campylobacter spp.  and 735 bp target of hipO ; lane 2, 400-bp fragment of the cadF  gene of Campylobacter spp. and 500 bp fragment of asp gene; lane NC, Negative Control, lane M, 1 kb molecular weight marker.  References   1. Randall L, Lemma F, Rodgers J, Vidal A, Clifton-Hadley F. Development and evaluation of internal amplification controls for use in a real-time duplex PCR assay for detection of Campylobacter coli and Campylobacter jejuni. J Med Microbiol. 2010;59(Pt 2): 172-8. 2. Golz G, Rosner B, Hofreuter D, Josenhans C, Kreienbrock L, Lowenstein A, et al. Relevance of Campylobacter to public health--the need for a One Health approach. Int J Med Microbiol. 2014;304(7):817-23. 3. Kaakoush NO, Castano-Rodriguez N, Mitchell HM, Man SM. Global epidemiology of Campylobacter infection. Clin Microbiol Rev. 2015;28(3):687-720. 4. Man SM. The clinical importance of emerging Campylobacter species. Nat Rev Gastroenterol Hepatol. 2011;8(12):669-85. 5. Li L, Mendis N, Trigui H, Oliver JD, Faucher SP. The importance of the viable but non-culturable state in human bacterial pathogens. Front Microbiol. 2014;5:258. 6. Nayak R, Stewart TM, Nawaz MS. PCR identification of Campylobacter coli and Campylobacter jejuni by partial sequencing of virulence genes. Mol Cell Probes. 2005;19(3):187-93. 7. Shams S, Bakhshi B, Tohidi Moghadam T. In silico analysis of the cadF  gene and development of a duplex polymerase chain reaction for species-specific identification of Campylobacter jejuni and Campylobacter coli. Jundishapur J Microbiol. 2016;9(2):e29645. 8. Toplak N, Kovac M, Piskernik S, Mozina SS, Jersek B. Detection and quantification of Campylobacter jejuni and Campylobacter coli using real-time multiplex PCR . J Appl Microbiol. 2012;112(4):752-64. 9. Persson S, Olsen KE. Multiplex PCR for identification of Campylobacter coli and Campylobacter jejuni from pure cultures and directly on stool samples. J Med Microbiol. 2005;54(Pt 11):1043-7. 10. Al Amri A, Senok AC, Ismaeel AY, Al-Mahmeed AE, Botta GA. Multiplex PCR for direct identification of Campylobacter spp. in human and chicken stools. J Med Microbiol. 2007;56(Pt 10):1350-5. 11. Park S. The use of hipO , encoding benzoylglycine amidohydrolase (hippuricase) ,as a reporter of gene expression in Campylobacter coli. Lett Appl Microbiol. 1999;28(4):285-90. 12. Konkel ME, Gray SA, Kim BJ, Garvis SG, Yoon J. Identification of the enteropathogens Campylobacter jejuni and Campylobacter coli based on the cadF  virulence gene and its product. J Clin Microbiol. 1999;37(3):510-7. 13. Sails AD, Fox AJ, Bolton FJ, Wareing DR, Greenway DL. A real-time PCR assay for the detection of Campylobacter jejuni in foods after enrichment culture. Appl Environ Microbiol. 2003;69(3):1383-9٠٫ 14. Totten PA, Patton CM, Tenover FC, Barrett TJ, Stamm WE, Steigerwalt AG, et al. Prevalence and characterization of hippurate-negative Campylobacter jejuni in King County, Washington. J Clin Microbiol. 1987;25(9):1747-52. 15. Klena JD, Parker CT, Knibb K, Ibbitt JC, Devane PM, Horn ST, et al. Differentiation of Campylobacter coli, Campylobacter jejuni, Campylobacter lari, and Campylobacter upsaliensis by a multiplex PCR developed from the nucleotide sequence of the lipid A gene lpxA. J Clin Microbiol. 2004; 42(12):5549-57. 16. Gonzalez I, Grant KA, Richardson PT, Park SF, Collins MD. Specific identification of the enteropathogens Campylobacter jejuni and Campylobacter coli by using a PCR test based on the ceuE gene encoding a putative virulence determinant . J Clin Microbiol. 1997;35(3):759-63. 17. Cloak OM, Fratamico PM. A multiplex polymerase chain reaction for the differentiation of Campylobacter jejuni and Campylobacter coli from  a  swine processing facility and characterization of isolates by pulsed-field gel electrophoresis and antibiotic resistance profiles. J Food Prot. 2002;65(2):266-73. 18. Adzitey F, Corry J. A Comparison between hippurate hydrolysis and multiplex PCR for differentiating Campylobacter coli and Campylobacter jejuni. Trop Life Sci Res. 2011;22(1):91-8.       750 bp  1000bp  500bp  250bp  500 bp  735 bp  400 bp  400 bp How to cite this article: Shams S, Ghorbanalizadgan M, Haj Mahmmodi S, Piccirillo A. Evaluation of a multiplex PCR assay for the identification of Campylobacter jejuni and Campylobacter coli. Infection, Epidemiology and Medicine. 2017; 3(1): 6-8. 

Evaluation of a Multiplex PCR Assay for the Identification of Campylobacter jejuni and Campylobacter coli

Padua Research Archive

https://www.research.unipd.it/bitstream/11577/3248539/1/Evaluation%20of%20a%20Multiplex%20PCR%20Assay%20for%20the%20Identification%20of%20Campylobacter.pdf

Evaluation of a Multiplex PCR Assay for the Identification of Campylobacter jejuni and Campylobacter coli

Abstract

Similar works

Full text

Available Versions

Archivio istituzionale della ricerca - Università di Padova

Padua Research Archive