From a migrating golden jackal (Canis aureus), we retrieved 21 live male Dermacentor reticulatus ticks, a species not previously reported from wildlife in Denmark. We identified Rickettsia raoultii from 18 (86%) of the ticks. This bacterium is associated with scalp eschar and neck lymphadenopathy after tick bite syndrome among humans

Bødker, Rene

Chriél, Mariann

Isbrand, Anastasia

Jensen, Tim Kåre

Schou, Kirstine Klitgaard

Emerging Infectious Diseases

Online Research Database In Technology

                       General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.  • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal   If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.     Downloaded from orbit.dtu.dk on: Dec 20, 2017Identification of Dermacentor reticulatus Ticks Carrying Rickettsia raoultii on MigratingJackal, DenmarkSchou, Kirstine Klitgaard; Chriél, Mariann; Isbrand, Anastasia; Jensen, Tim Kåre; Bødker, RenePublished in:Emerging Infectious Diseases (Print Edition)Link to article, DOI:10.3201/eid2312.170919Publication date:2017Document VersionPublisher's PDF, also known as Version of recordLink back to DTU OrbitCitation (APA):Schou, K. K., Chriél, M., Isbrand, A., Jensen, T. K., & Bødker, R. (2017). Identification of Dermacentorreticulatus Ticks Carrying Rickettsia raoultii on Migrating Jackal, Denmark. Emerging Infectious Diseases (PrintEdition), 23(12), 2072-2074. DOI: 10.3201/eid2312.1709192072 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 23, No. 12, December 2017DISPATCHESKirstine Klitgaard, Mariann Chriél,  Anastasia Isbrand, Tim K. Jensen, René BødkerFrom a migrating golden jackal (Canis aureus), we retrieved 21 live male Dermacentor reticulatus ticks, a species not previously reported from wildlife in Denmark. We identified Rickettsia raoultii from 18 (86%) of the ticks. This bacterium is associated with scalp eschar and neck lymphadenopathy after tick bite syndrome among humans.Since 2012, Denmark has received a sudden and poorly understood wave of gray wolves (Canis lupus) and golden jackals (C. aureus) migrating long distances from their birthplaces in eastern and central Europe (1). These long-distance dispersals create a risk for introducing tick vectors and pathogens to new geographic areas. We report discovery of Dermacentor reticulatus ticks infected with Rickettsia raoultii from a wild golden jackal in Thors-minde, in the western region of Denmark.The StudyIn February 2017, the wildlife service delivered the body of a golden jackal from Western Jutland, >200 km north of the Denmark–Germany border, to the National Veterinary In-stitute (Lyngby, Denmark). During necropsy, we collected 21 male Dermacentor reticulatus ticks, a species that had not previously been reported among wildlife in Denmark. We screened the ticks and a blood sample from the jackal for tickborne pathogens by using a high-throughput real-time PCR (2). This assay enables simultaneous detection of 37 European tickborne pathogens, including the spotted fe-ver group (SFG) Rickettsia, and specifically the species R. conorii, R. slovaca, R. massiliae, and R. helvetica, as well as confirmation of 4 tick species, including D. reticulatus (2). Tick DNA was extracted as previously described (3).PCR confirmed the morphologic characterization: all the ticks collected from the jackal were D. reticulatus. One tick contained Anaplasma phagocytophilum, and 18 ticks contained SFG Rickettsia spp.; however, the specific Rickettsia species was not among the 4 species included in the PCR. To identify the species, we PCR amplified the ompA, ompB, and gltA genes for a subset of 4 samples and sequenced them as previously described (4,5). For the re-maining 14 samples, we sequenced the ompA gene. A BLAST search (http://www.ncbi.nlm.nih.gov/BLAST/) identified the ompB gene as 100% and the ompA and gltA genes as 99% identical to the genome sequence of the type strain of Rickettsia raoultii sp. nov. strain KhabarovskT (CSUR R3T, ATCC VR-1596T) (6). The specific primers used for gene amplification and sequencing of bacteria identified from D. reticulatus ticks by real-time PCR are provided in the Table. We deposited the sequences we obtained into GenBank (ac-cession nos. MF166729–36 and MF166741–44).The surge of large carnivores, reaching countries in northern Europe from breeding areas in central Europe, is a recent development that appears to be caused by reduced hunting resulting from effective wildlife protection (1,7). This migration may facilitate the spread of vectors and zoo-notic pathogens into new regions. Even if these migrations do not result in the establishment of a new carnivore popula-tion, Denmark has high fox and deer densities in the forests, as well as farm animals grazing on pastures, that can support tick species such as D. reticulatus or D. marginatus.D. reticulatus ticks are spreading rapidly through Eu-rope, and changes in the environment, climate, or both seem to be favorable to the establishment of this tick in areas not previously supporting populations of the species (8). D. re-ticulatus ticks are established in the southern United King-dom, and recently, also in the Netherlands. Both countries lack wolf and jackal populations (9). Therefore, it is the actual process of migration and not the establishment of the carnivores in Denmark that constitutes a risk.However, for these migrations to result in the in-troduction of ticks, the migrations must first originate in Dermacentor tick–endemic areas, which are located several hundred kilometers south of the Danish border. Second, the migrations must be rapid enough for the ticks to remain attached to the migrating carnivores during the entire migration. Individual gray wolves are indeed ca-pable of migrating distances of 800–1,200 km within a short period; the first wolf known to arrive in northern Jutland has been genetically traced to the border area be-tween Germany, the Czech Republic, and Poland, >800 km away from Denmark (1).The finding of 21 adult male D. reticulatus ticks on a jackal hunted in western Denmark strongly indicates that jackal migrations are also long enough to originate from Identification of Dermacentor reticulatus  Ticks Carrying Rickettsia raoultii on  Migrating Jackal, DenmarkAuthor affiliations: National Veterinary Institute, Lyngby, DenmarkDOI: https://doi.org/10.3201/eid2312.170919 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 23, No. 12, December 2017 2073Dermacentor tick–endemic areas and fast enough to allow the ticks to complete the migration to Denmark. The origin of the jackal received at the National Veterinary Institute is unknown, but the nearest known breeding populations of golden jackals are in Austria and Hungary (7). Female ticks were absent on the jackal because they drop off after feed-ing, but each female D. reticulatus tick can lay up to 7,200 eggs (8), which would have been deposited somewhere be-tween the endemic tick region and Denmark. Some of those eggs may have landed in a favorable environment.The SFG Rickettsia R. slovaca and R. raoultii, which are exotic to Denmark, are the most consequential zoo-notic pathogens carried by D. reticulatus ticks. These bacteria are a public health concern because they cause scalp eschar and neck lymphadenopathy after tick bite (SENLAT) syndrome (10,11). SENLAT is an emerging tickborne infection and among the most common tick-borne rickettsiosis in Europe (8). The disease is defined as the association of a tick bite, an inoculation eschar on the scalp, and cervical adenopathies (10,11). The main signs and symptoms are a crustaceous lesion (early) or eschar (late) at the site of the tick’s attachment and regional pain-ful lymph nodes (10,11).R. raoultii was only recently characterized and named from bacteria isolated from Dermacentor tick species col-lected in Russia and France (6). In 2016, R. raoultii was reported for the first time in Austria and the Czech Repub-lic (12,13). A relatively high prevalence of R. raoultii has been reported in ticks from various regions of Europe, from 14.9% in Austria (12) to 58% in Hungary (14). In the case we report, the high prevalence (85.7%) of R. raoultii–in-fected ticks from the jackal may have been accentuated by co-feeding transmission between ticks on the same host (8).We did not identify any rickettsiae from the blood of the jackal by PCR. However, because ticks are able to sus-tain rickettsial transmission cycles transovarially and trans-stadially, it is possible that there is, in fact, no host reser-voir of R. raoultii (8). If the ticks serve as a reservoir of R. raoultii, the distribution of this bacterium will be identical to that of the tick’s area of dispersal (15). D. reticulatus males remain on the host for 2–3 months and have an inter-mittent feeding behavior (8). This trait makes them vectors of pathogenic agents, and recent studies have also shown that male D. reticulatus ticks play a strategic role in the transmission of R. slovaca and R. raoultii to humans (8).Although SENLAT is a milder rickettsiosis, physi-cians should be aware of the potential diagnosis of this emerging tickborne disease. A reason for concern is that the intracellular Rickettsia infections require treatment with different antimicrobial drugs than, for example, Bor-relia infections.ConclusionsThe simultaneous finding of a new carnivore, a new tick vector, and a new zoonotic pathogen in Denmark dem-onstrates that the unexpected recent wave of large carni-vores migrating over long distances into Denmark is more than a theoretical risk to human and animal health. Ixodes ricinus ticks are abundant in most forests in Denmark. However, forests cover only 14% of Denmark’s area, and the preference of D. reticulatus ticks for more open areas could dramatically increase the area of Denmark and northern Europe with a risk for tick bites and tick-borne infections.AcknowledgmentsSpecial thanks go to Hans Erik Swart and Jens Henrik Jakobsen for handling the jackal. Necropsy was funded by the Danish Nature Agency project no. 2013/S080-135070. The tick and pathogen analysis was supported by the Danish Veterinary and Food Administration, Ministry of Environment and Food Denmark, and by the  Scandtick Innovation project, EU Regional Development  Programme InterReg OKS.Dr. Klitgaard is a molecular biologist and senior researcher at the National Veterinary Institute, Technical University of Denmark. Her primary research interests are microbial ecology and the etiology of bacterial diseases.References  1. Andersen LW, Harms V, Caniglia R, Czarnomska SD, Fabbri E, Jędrzejewska B, et al. Long-distance dispersal of a wolf,  Canis lupus, in northwestern Europe. Mammal Res. 2015;60:163–8. http://dx.doi.org/10.1007/s13364-015-0220-6  2. Michelet L, Delannoy S, Devillers E, Umhang G, Aspan A,  Juremalm M, et al. High-throughput screening of tick-borne  pathogens in Europe. Front Cell Infect Microbiol. 2014;4:103. http://dx.doi.org/10.3389/fcimb.2014.00103  3. Jensen PM, Christoffersen CS, Moutailler S, Michelet L,  Klitgaard K, Bødker R. Transmission differentials for multiple  Table. Primers used for gene amplification and sequencing of Rickettsia spp. obtained from Dermacentor reticulatus ticks from a migrating jackal, Denmark Primer name Primer sequence, 5  3 Target gene Length, bp Reference 120–2,788 AAACAATAATCAAGGTACTGT ompB 765 (5) 120–3,599 TACTTCCGGTTACAGCAAAGT    Rr 190.70p ATGGCGAATATTTCTCCAAAA ompA 631 (4) Rr190–701n GTTCCGTTAATGGCAGCATCT    RpCS877p GGGGACCTGCTCACGGCGG gltA 380 (4) RpCS1258n ATTGCAAAAAGTACAGTGAACA     Ticks Carrying R. raoultii, DenmarkDISPATCHES2074 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 23, No. 12, December 2017pathogens as inferred from their prevalence in larva, nymph and adult of Ixodes ricinus (Acari: Ixodidae). Exp Appl Acarol. 2017;71:171–82. http://dx.doi.org/10.1007/s10493-017-0110-5  4. Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol. 1991;173:1576–89. http://dx.doi.org/10.1128/jb.173.5.1576-1589.1991  5. Roux V, Fournier PE, Raoult D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol. 1996;34:2058–65.  6. Mediannikov O, Matsumoto K, Samoylenko I, Drancourt M,  Roux V, Rydkina E, et al. Rickettsia raoultii sp. nov., a spotted fever group rickettsia associated with Dermacentor ticks in  Europe and Russia. Int J Syst Evol Microbiol. 2008;58:1635–9. http://dx.doi.org/10.1099/ijs.0.64952-0  7. Trouwborst A, Krofel M, Linnell JDC. Legal implications of range expansions in a terrestrial carnivore: the case of the golden jackal (Canis aureus) in Europe. Biodivers Conserv. 2015;24:2593–610. http://dx.doi.org/10.1007/s10531-015-0948-y  8. Földvári G, Široký P, Szekeres S, Majoros G, Sprong H.  Dermacentor reticulatus: a vector on the rise. Parasit Vectors. 2016;9:314. http://dx.doi.org/10.1186/s13071-016-1599-x  9. Jongejan F, Ringenier M, Putting M, Berger L, Burgers S, Kortekaas R, et al. Novel foci of Dermacentor reticulatus  ticks infected with Babesia canis and Babesia caballi in the  Netherlands and in Belgium. Parasit Vectors. 2015;8:232.  http://dx.doi.org/10.1186/s13071-015-0841-210. Angelakis E, Waton J, Imbert P, Socolovschi C, Edouard S,  Dellamonica P. Scalp eschar and neck lymphadenopathy caused by Bartonella henselae after tick bite. 2010;50:549–51.11. Dubourg G, Socolovschi C, Del Giudice P, Fournier PE, Raoult D. Scalp eschar and neck lymphadenopathy after tick bite: an emerging syndrome with multiple causes. Eur J Clin Microbiol Infect Dis. 2014;33:1449–56. http://dx.doi.org/10.1007/s10096-014-2090-212. Duscher GG, Hodžić A, Weiler M, Vaux AGC, Rudolf I, Sixl W,  et al. First report of Rickettsia raoultii in field collected  Dermacentor reticulatus ticks from Austria. Ticks Tick Borne Dis. 2016;7:720–2. http://dx.doi.org/10.1016/j.ttbdis.2016.02.02213. Rudolf I, Venclíková K, Blažejová H, Betášová L, Mendel J, Hubálek Z, et al. First report of Rickettsia raoultii and Rickettsia  helvetica in Dermacentor reticulatus ticks from the Czech  Republic. Ticks Tick Borne Dis. 2016;7:1222–4. http://dx.doi.org/ 10.1016/j.ttbdis.2016.07.01114. Szekeres S, Docters van Leeuwen A, Rigó K, Jablonszky M, Majoros G, Sprong H, et al. Prevalence and diversity of human pathogenic rickettsiae in urban versus rural habitats, Hungary.  Exp Appl Acarol. 2016;68:223–6. http://dx.doi.org/10.1007/s10493-015-9989-x15. Socolovschi C, Mediannikov O, Raoult D, Parola P. Update on tick-borne bacterial diseases in Europe. Parasite. 2009;259–73. PubMed http://dx.doi.org/10.1051/parasite/2009164259 Address for correspondence: René Bødker, National Veterinary Institute (DTU), Kemitorvet, Building 202, 2800 Kgs. Lyngby, Denmark; email: rebo@vet.dtu.dkOriginally published September 2005https://wwwnc.cdc.gov/eid/article/11/9/et-1109_articleetymologia revisitedRickettsia [rĭ-ket′se-ə]  Genus of gram-negative, rod-shaped or  coccoid bacteria that are transmitted by lice, fleas, ticks, and mites. Named after American pathologist Howard Taylor Ricketts; despite the similar name, Rickettsia spp. do not cause  rickets (from the Greek rhakhis, “spine”),  a disorder of bone development caused by  vitamin deficiency. Source: Dorland’s illustrated medical dictionary. 30th ed. Philadelphia: Saunders; 2003.

Identification of Dermacentor reticulatus Ticks Carrying Rickettsia raoultii on Migrating Jackal, Denmark

Kirstine Klitgaard

Mariann Chriél

Anastasia Isbrand

Tim K. Jensen

René Bødker

Crossref

Identification ofDermacentorreticulatusTicks CarryingRickettsiaraoultiion Migrating Jackal, Denmark

Directory of Open Access Journals

https://wwwnc.cdc.gov/eid/article/23/12/pdfs/17-0919.pdf

Identification of Dermacentor reticulatus Ticks Carrying Rickettsia raoultii on Migrating Jackal, Denmark

Abstract

Similar works

Full text

Available Versions

Online Research Database In Technology

Crossref

Directory of Open Access Journals