Chakrabarti, Jayprakos

Mallick, Bibekanand

Sahoo, Satyabrata

IACS Institutional Repository

Indian J. Phys. 79(6), 559-562 (2005) ^ a p i d  C o m m u n ic a t io n%U P ?A lg o r ith m  fo r  p a t te r n  r e c o g n it io n  in  n a n o -s iz e d  a r c h a e aJayprokas Chakrabarti*, Satyabrata Sahoo, Bibekanand fidallick, Smarajit Das and Zhumur Ghosh C o m p u ta tio n a l B io lo g y  G ro u p  (C B G ), D c p a r in e n t  o f  T h e o re tic a l P h y sics,In d ian  A sscxriation fo r  th e  C u ltiv a tio n  o f  S c i ^ c e ,  K o lk a ia -7 0 0  0 3 2 , Ind iaE -m ail : tpjcCa^>iacs.r^.in R e c e i v e d  1 A p r i l  2 0 0 5 ,  a c c e p t e d  2 9  A p r i l  2 0 0 5A bstract : H id d e n  p a tte rn s  a b o u n d  in  g e n o m e  seq u en ces . S ophi.s tica ted  m adbem atical u ig o rith rn s  spo t them . A s o f  now , sev e ra l p o w e rfu l to o ls  ex ist fo r  id e n tif ic a tio n  o f  tra n s fe r-R N  A  g e n e s  fro m  g e n o m e s . T licse  so m etim es  fa ii to  id en tify  w h en  in tro n s  a re  a t iio n can o n ica l s ite s . W e d is c u s s  o u r  ap p ro ach  to  th is  p ro b le m  o f  id e n tif ic a tio n  an d  a p p ly  it to  the  g e n o m e  o f  N a n o a r c ^ t e u m  e q u i t a n s .  U sin g  o u r  a lg o rith m , w c id e n tify  the  fo u r tR N A  g en es  th a t w e re  m is se d  by  th e  p re s en t s tan d a rd  tR N A  sea rc h  p ro g ram s  in N .  e q u U u n s .  T h e  recen t sp lit- lR N A  h y p o th e s is  { N a t u r e  4 3 3 , 537  (2(K)5)1 id e n tifie d  th e  m is s in g  o n es . H o w ev e r, o u r  so lu tio n s  a re  d iffe ren t. W e a rg u e  the  case  in fa v o u r o f  o u r  so lu tio n s .K eyw ords ; tR N A , sp lit- tR N A  h y p o th e s is , iR N A  sea rch  p ro g ram , N a n n a n h a e u m  e q u i t a n s .P A C S  Nos. : 8 7 .1 4 .-g , 8 7 .1 5 .-v , 8 9 .2 0 .-a , 8 9 .7 5  -k1. IntroductionMany sophisticated, nonlinear algorithms [1] exist for pattern formation and recognition [2,31- For instance, there are several computational approaches to detect transfer-RNA (tRNA) genes from a genome [4], These iRNA genes have characteristic pattern over the genomes. To identify these on the sequences, there arc algorithms. Notable amongst these are tRNAScan-SE 15] and ARAGORN [6]. Most of these tRNA search programs key on primary sequence patterns and/or secondary structures sp>ecific to tRNAs, Quite a few loopholes exist. These have to do with the inability of existing routines to identify tRNA genes with noncanonical introns in them. These are unusually located introns in tRNA genes (tDNAs). The standard (canonical) introns are located between bases 37 and 38 in tDNA. The noncanonical introns are the ones located elsewhere [7]. Identification of tDNAs harbouring these noncanonical introns is the subject of this paper. Some of the tRNA genes are either misidentified or missed by existing search algorithms. In this work, we discuss some of these misidentified and non-identified tRNA genes in the nano-sizedNanoarchaeum equitans Kin4-M {N. equitans for short) by our in-house algorithm.N ,equitans  (NC_005213) belonging to the novel archaeal phylum ‘Nanoarchaeota’18], so far seem to have the smallest genome of all known cellular life forms, N, equitans is a hyperthermophile. This is the most compact, with 95% of the DNA predicted to encode proteins or stable RNAs. It is the smallest genome resembling an intermediate between smallest living organism like M ycoplasm a genitalium  and big viruses like pox virus. Many symbiotic or parasitic bacteria have small cells and reduced genomes but within archaea N. equitans is the first reported archaea to have such characteristics. Again, its extreme living conditions correlate to early environmental conditions suggesting that ‘Nanoarchacota’ are a primitive form of microbial life.The primary tRNA sequence changes to secondary clovcrleaf structure [9], The secondary structure of tRNA has : (i) Acceptor or A-arm. In this, 5' and 3' ends of tRNA are base pairedi into a stem of 7 bps (ii) DHU or D-Arm. Structurally a stem-loop, D-Arm frequentlyCoirespoading Author© 2005 lACS560 Jayprokas Chakrabarti et alcontains the modified base dihydrouracil, (iii) Anticodon or AC-arm, made of a stem and a loop containing the anticodon. The canonical structure of AC-loop is essential for interactions with ribosomal A and P sites during protein synthesis flO). At 5' end of this loop is a pyrimidine base at 32, followed by an invariant U at 33. The anticodon triplet, at 34, 35, 36 is in the exposed loop region, (iv) An Extra Arm, or V-Arm. This arm is not always present. It is of variable length and is largely responsible for the variation in length of tRNAs. The classification of tRNAs into types J and II, depends on length of V-arm 111], (v) Arm or T-arm : Thisarm has conserved sequence of three ribonucleotides : ribothymidine, pseudouridine and cytosine. T-arm has stem-loop secondary structure and (vi) tRNA terminates with CCA at 3' end. In case CCA is absent in tDNA, it is added during maturation to tRNA.The attachment of amino acid to their corresponding tRNA is catalyzed by aminoacyl-tRNA synthetase (AARS) [12,13]. Accurate acylation of tRNA depends on two factors : a set of nucleotides in iRNA molecule (identity elements) responsible for proper identification by AARS [14] and competition between different synthetases for tRNAs [15]. Tertiary L-shape of tRNA facilitates its identification by AARS for aminoacylation. L-shape comes about through the interaction between D-arm and T-arm. There are a few key features that maintain the L-shape of tRNA [16]. These interactions include Watson-Crick base pairing, Hoogsteen base pairing, and triple-helical base pairing. It is generally accepted that the major interactions maintaining the L-shape occur at the comer of the molecule where D- and T-loops meet. This region, called DT [17], contains .several elements, including the reverse-Hoogsteen bp U54:A58 and C55-mediated U-turn in T-loop, the inter-loop bps G18:C55 and G19:C56 and stack of four mutually intercalated purine bases A58-G18—R57-G19. This intra-loop U54:A58 is stacked on G53.C61 at the end of T stem and forces the two bases at positions 59 and 60 to loop out, forming a characteristic T-loop of 5 bases instead of 7. This characteristic T loop conformation is important for recognition by elongation factors.The genome of N . eq u item s  consists of a single, circular chromosome of 490, 885 base pairs (bp). It has an average G+C content of 31.6% [18]. Presumably because of this small genome, this archaea has an unusually high gene density, and stable RNA sequences, together covering 95% of the genome. 38 tRNA genes are reported and cross-checked using standard routines(tRNAScan-SE and ARAGORN) include an unusual second copy of tRNA®®*^ (CGA). However, four tRNA genes (for glutamate, histidine, tryptophan and initiator methionine) remained unidentified in the genome. This is due to their unusual sequence or structure. We identify them now using our in-house-devcloped software. Recently, these missing tRNAs were identified using a new split-tRNA hypothesis. However, our solutions are different. We argue the case in favour of our solutions.2. MethodologyThe entire genome is obtained from NCBI (http;// www.ncbi.nlm.nih.gov), accession no. NC_005213. Raw tDNA sequences are found by searching the different motifs present in the consensus sequence of different tDNAs of archaea. At first, we adopted the standard cloverleaf model for studying the secondary structure of predicted tDNAs of M e q u ita n s . In doing so, we got some false positives and a few tDNAs were missed out. We then imposed constraints, unique to archaeal tDNA. A regular cloverleaf structure was searched in tRNA genes of the genome of /V. e q u ita n s  by adopting archaeal tDNA features. The constraints of lengths of stems of regular tDNA, acceptor arm, D-arm, anticodon arm and T-arm are 7, 4, 5 and 5bp respectively. That aside parameters and constraints used in the search for cloverleaf tDNAs are : (a) T8 (except Y8 in M , kandleri)^  G18, R19, R53, Y55, and A58 are considered as conserved bases for archaea. (b) the lengths of introns and V-arm are allowed from 6 to 121 and up to 21 respectively; (c) positions optionally occupied in D-loop are 17, 17a, 20a and 20b; (d) canonical and noncanonical introns may or may not be present. Keeping the.se constraints, we were able to extract 38 tDNAs. After getting the tDNAs, we ran the standard routines to check for the secondary structure. We developed consensus tRNA sequences for archaea and measured homology with tRNA of N , equitans as a further check.3. R esu lts and d iscu ssionThe recent algorithm [19] for five split tDNAs in N, e q u ita n s  is new. It locates missing tRNA**^ , tRNA‘*^®S tRNA°‘“ and tRNA”*®. But the split tRNA** (^CCA) solution is anomalous; the tRNA*^ ®* solution [19] lacks cognition elements for aminoacylation. In view therefore, we present here alternate non-split composite solutions for cRNA**^ * tRNA tRNAO*» and tRNA»‘®.Earlier [8], tRNA genes in N . e q u i ta n s  were exhaustively explored. The remarkable a lg o r i th m sAlgorithm for pattern recognition in nano-sized archaea 561tRNAScan-SE [5] and ARAGORN [6J located all tRNAs except tRNA'^ 'P, tRNA»*^ «‘, tRNA i^u and tRNA»«. The pcw algorithm of Randau e t  a l  [19] locates these missing ones.However, the tRNA'r*p(CCA) reported [19] is anomalous : (i) There is GG preceding the anticodon.We studied all archaeal tRNA'*'n»(CCA) and found this to be an exception. U33 is known [20] to contribute to tRNA-ribosomal binding. Its absence is puzzling, (ii) Further, archaeal tRNA’*h>(CCA) always have discriminator base A73. This discriminator A73 is of modest preference for aminoacylation [21]. Randau e t  a l [19] have C73. Again, the 73rd discriminator base of archaeal jRNAiMet(CAU) is always A73. But, tRNA‘*^«(CAU) solution [19] is anomalous, it has U73.In the absence of conclusive aminoacylation experiment and the anomalies listed above, we reanalyzed the missing tRNAs for Nanoarchaea. In the split-tRNA hypothesis[19], the structures (5-primed end split at 37 followed by invert-repeat element, 3-primed end preceeded by invert- repeat element e tc .)  of tDNA-Glu/His are similar to tDNA-Trp/iMet. If tRNA-Trp/iMet are anomalous, how functional are tRNA-Glu/His? Are there other solutions? From the classic work [22] (and the references therein) on tRNA, it is known that archaeal tRNA harbour noncanonical introns. Canonical introns are located between bases 37 and 38 of tRNA; noncanonical introns occur elsewhere. We looked for the possibility that tDNA- Trp/iMet/Glu/His have noncanonical introns. We found composite solutions that do not suffer from the anomalies above. These solutions are :kRNA.'Ar 161902-1620785'TAGAAAAATTTTT AAATATCTATCTATTGC AATCTC G O G  GCCX?TAXK71X7AOCGAGGaAOj\aaGGaaaKVT<Z G A A G  CCG AA GCTO€:AaACX7CXm^CfGTCtXJGGGTTaaAATaCXXXrCX?GCXXr 04-3#6#-TCGTTAATTCTTACAGTAACATTTATAAATGGTTTTGTTAT AACTTAC ^ i^ca cxsa a a T O O O G C A a cx:rroG A G T G cxx7 G a G a csGCCGaaATTCGAACCCaGGaCCTCCGCCTTGCGAGGGCGGCGTCCTACCaCTGGA42n4£7(f3C«3CCC<7<71T7roATTTTAGATACAAAATAAATACATTTTT T G JA A r^  tRNA«KCTO 0«i«-1619O2-162O785' AATTTTT AAATATCTATCTATTGCAATCTC CSGGGCXXtTAO  cT C A ocxzA O G czA a A a cxsa ca a A riK Z G esi^oG G P i^  cT itx n M  A ccx x ti^ a T tx io a o cm K x x A A rcx 7 cx x :cG c tccx x :A rZ *kKNA»<iVXO) 8«n«'327ae2>aZ76266^  ATAArrrTTAAATCGTTTCTTTTATTCTATTG OCXyOCXXSTAaCT C^acaCtIC:AeUUXXXXX:€XX7TCA.TAa CATOGGC IM reMGCTCTGAC CCQAAAOGOaATGATCTCGGOOOCTCTTATGCCCCCTCGTGAGAAAATATAAACCTAA«78^Here, we have marked tRNAs in bold italics^  introns in normal font within the gene sequence, the conserved archaea] Box A promoter-elements [23] in larger font present ahead of the gene. We found the right secondary structures for all these tRNAs, and the bulge-helix-bulgc (BHB) motifs. Note, for instance, the following important features of this tRNATrp(CCA) : U8, A14, A21, U33, G18:U55, G19:C56, U54:A58 and G30:C40, the anticodon CCA at 34, 35, 36, and finally A73. These bases/base- pairs arc conserved in all tRNA'*'*T*(CCA) in archaea. tRNAScan-SE identifies bases 151992 to 152081 as tRNA®"(CGA). Note there is another tRNA’^ '^fCGA) betvs/0en 486337 and 486426. The one between 151992 and * 5^2081 is unlikely to be tRNA *^ (^CGA) : none of the Conserved bases/base pairs of archaeal tRNA***^  v iz . Gi:^p72, G18:U55, G19:C56, U54:A58. G26;U44, G53|U61, U33, G73 appear. Again, the Variable-arm is abs^t. It is known [24] that G73 and Variable-arm contain identity elements for Ser-RS.I?rom our study of 22 fully sequenced archaea, the 73rd discriminator base of tRNA’'^ ®*(CAU) is A73. Our tRNA*’^®‘(CAU) has A73. It shares all features of archaeal tRNA'*^ ‘=*(CAU).Remarkably, our tRNA<^ ‘“(CUC) and tRNA^CCA) overlap with one another. Note that the tDNA°*“(CUC) has a noncanonical intron at 33. tDNA’^ 'T»(CCA) has a noncanonical intron at 30. N . e q u ita n s  has the smallest genome known. Noncanonical introns here compactify two tDNAs. Interestingly, this compactirication is at work for tRNA”‘* as well.Codon usage study of histidine in 22 archaea reveals the ratio of the number of CAU-codon to CAC-codon to be anomalously high in N .eq u ita n s . Amongst archaea N. e q u ita n s  is special in this respect. For tRNA““ ATG is the likely anticodon. This is precisely what we found : tONA^ '^ C^ATG) lying between 327362 and 327520. It has two noncanonical introns located between 32/33 and 71/ 72 of 13 and 25 bases respectively. In addition to these, there is the canonical intron of 53 bases. Remarkably again, this tDNA*^ '*(ATG) overlaps with tDNA^^^fCAU), located between 327362 and 327500. tDNA^ '^ ^^ fCAT) has a canonical intron of 66 bases.Randau e t a/*s split-tRNA solutions are new. Splitting decompactifies the genome. Further, some of the split solutions are anomalous. Our solutions have overlapping composite tRNA genes [25]. tRNA genes are woven together by introns. They appear just suited for N. eq u ita n s  that has the smallest genome.562 Jayprokas Chakrabarti et alReferencesf l]  J  D  M urray M a th e m a tic a l  B io lo g y  : A n  In tr o d u c tio n  (3rd edn.)(Berlin : Springer Verlag) (2002)[2] M C Cross and P  Hohcnbcig R ev. M o d . P h ys . 65 8 5 1 (1993)[3J A J Koch and H M cinhardt R ev. M o d . P h y s . 66 1481 (1994)(4J N el-Mabn>uk and F  Lisacek J . M o l. B io l. 264 46 (1996)[5] T  M Lowe and S R Eddy N u c le ic  A c id s  R e se a r c h  2 5  955 (1997)[6] D Laslett and B Canback N u c le ic  A c id s  R e se a r c h  32 11(2(X)4)[7] M Sugita, L Luo. M Ohta and H Itadani D N A  R e se a r c h  2 1 1 (1995)[8] E Waters. M J Hohn. I Ahcl. D E Graham. M D Adams. M Bamstead. K Y Beeson, L Bibbs, R Bolanos. M Keller. K Kretz. X Lin, £  Mathur. J Ni, M Podar, T  Richardson G G Sutton. M Simon, D Soli, K O Stetter, J M Short and M  Noordewier P roc . N a tl. A ca d . S c i. 100 12984 (2003)[9] N Kanjo and H Inokuchi D N A  R e se a r c h  6 71 (1999)[lOJ D Thirumalail. V Ashwin and J K Bhattacharjee P h ys. R ev. L e tt. 1 1  5385 (1996)(111 R Giege, M  S isslcr and C Florentz N u c le ic  A c id s  R e se a r c h  26 5017(1998)[12] M  Ibba and D  Soil A n n a . R ev. B io c h e m . 69 617 (2000)[13] M Ibba and D Soil E M B O  R e p o r ts  2 382 (2001)[14] R Giege. J D Puglisi and C Florentz N u c le ic  A c id  R e se a rc h  4S 129 (1993)[ 15J J M Sherman. M J Rogers and D Soil N u c le ic  A c id s  Re.search. 20 2847 (1992)[161 S V Steinberg, F Lcclerc and R Cedeigren J. M o l. B io l. 266 269(1997)[17J E l  Zagryadskaya, N Kotlova and S V Steinberg J . M o l. B io l, (in press)118] S Chattopadhyay. S Sahoo, W A Kanner and J  Chakrabarti J. Comp  F u n d .  G en o m . 4  56 (2003)1191 L Randau. R Munch. M J Hohn. D Jahn and D SOU N a tu r e  433 537(2005)[20] S S Ashraf, G Ansari, R Guenther, E Sochacka, A Malkicwicz and P F Agris R N A  5(4) 503(1999)(21 ] Q Guo. Q  Gong. Ka^Lok Tong, B Vesterguard, A Costa. J Desgres, M Wong. H Grosjean. G  Zhu, J T  Wong and H Xue J . B io l. Chem. 2 1 1  14343 (2002)[22] C  M arck and H Grosjean R N A  9 1516 (2003)[23] J R Palmer and C J  Daniels J . B a c t. 177 1844 (1995)[24] R Giege. M  Sissler and C Florentz N u c le ic  A c id s  R e se a r c h  26 5017(1998)[25] A Reichert, U Rothbauer and M MOrl J . B io l. C h e m  273 31977 (1998)

Algorithm for Pattern Recognition in Nano-Sized Archaea

http://arxiv.iacs.res.in:8080/jspui/bitstream/10821/6590/1/Algorithm%20for%20Pattern%20Recognition_By%20Jayprokas%20Chakrabarti.pdf

Algorithm for Pattern Recognition in Nano-Sized Archaea

Abstract

Similar works

Full text

Available Versions

IACS Institutional Repository