Fil: Chaves, Camila Lucas. Universidade Estadual de Londrina; BrasilFil: Ruas, Claudete Fátima. Universidade Estadual de Londrina; BrasilFil: Ruas, Paulo Maurício. Universidade Estadual de Londrina; BrasilFil: Schneider, Angelo Alberto. Centro Anacreonte Ávila de Araújo. Fundação Estadual de Pesquisa Agropecuária; BrasilFil: Rocha, Kátia Real. Universidade Estadual de Londrina; BrasilFil: Urtubey, Estrella. Consejo Nacional de Investigaciones Científicas y Técnicas. Instituto de Botánica Darwinion. Academia Nacional de Ciencias Exactas, Físicas y Naturales. Instituto de Botánica Darwinion; ArgentinaFil: Ruas, Eduardo Augusto. Universidade Estadual de Londrina; Brasi

Chaves, Camila Lucas

Rocha, Kátia Real

Ruas, Claudete Fátima

Ruas, Eduardo Augusto

Ruas, Paulo Maurício

Schneider, Angelo Alberto

Urtubey, Estrella

Journal of Genetics

LAReferencia - Red Federada de Repositorios Institucionales de Publicaciones Científicas Latinoamericanas

c© Indian Academy of SciencesONLINE RESOURCESIsolation and characterization of twelve polymorphic microsatellite locifor Hypochaeris catharinensis (Asteraceae) and cross-amplification inrelated speciesCAMILA LUCAS CHAVES1, CLAUDETE DE FÁTIMA RUAS2, PAULO MAURÍCIO RUAS1,2∗,ANGELO ALBERTO SCHNEIDER3, KÁTIA REAL ROCHA2, ESTRELLA URTUBEY4and EDUARDO AUGUSTO RUAS21Departamento de Agronomia, and 2Departamento de Biologia Geral, Centro de Ciências Biológicas, UniversidadeEstadual de Londrina, 86051-990 Londrina, Paraná, Brazil3Fundação Estadual de Pesquisa Agropecuária, Centro Anacreonte Ávila de Araújo, São Gabriel, Br 290, km 412,Rio Grande do Sul, Brazil4Instituto de Botánica Darwinion, Labardén 200, CC 22, San Isidro, Argentina[Chaves C. L., Ruas C. F., Ruas P. M., Schneider A. A., Rocha K. R., Urtubey E. and Ruas E. A. 2015 Isolation and characterization of twelvepolymorphic microsatellite loci for Hypochaeris catharinensis (Asteraceae) and cross-amplification in related species. J. Genet. 94, e39–e42.Online only: http://www.ias.ac.in/jgenet/OnlineResources/94/e39.pdf]IntroductionIn this study, we describe the development and screen-ing of an enriched genomic DNA library aiming to iden-tify microsatellite loci in Hypochaeris catharinensis, anendemic species from southern Brazil. Twelve polymorphicmicrosatellite loci tested in a sample of 60 individuals fromthree different populations of H. catharinensis, identified98 alleles with an average of 8.17 alleles per locus. Theaverage polymorphic information content (PIC) varied from0.098 to 0.757, with five loci exhibiting significant devi-ation from Hardy–Weinberg equilibrium (HWE). Transfer-ability test for cross-amplification was done in 10 relatedHypochaeris species with a rate of success ranging from12 loci, for H. petiolaris and H. varigata, to six loci forH. patagonica. These microsatellite loci will provide valu-able information for studying genetic diversity, populationgenetic structure, conservation biology and for understand-ing the past demographic events of H. catharinensis andother related species of Hypochaeris.Hypochaeris is considered as a biological model to under-stand evolutionary processes in the vascular flora of SouthAmerica, particularly from the temperate portion of the con-tinent. As suggested by molecular clock dating, the SouthAmerican species of Hypochaeris was derived from a com-mon ancestor from northwest Africa that arrived in the con-tinent between 3.5 and 0.25 mya by long-distance dispersal∗For correspondence. E-mail: pmruas@uel.br.(Tremetsberger et al. 2005). Following rapid events of adap-tive radiation in the continent, the genus dispersed (between0.25 and 1.00 mya) into new habitats, developing great dealof morphological variation (Stuessy et al. 2003; Tremets-berger et al. 2006). Evidence of adaptive radiation, produc-ing ecologically restricted and morphologically distinct taxa,has been documented in plants (Sang et al. 1994; Kim et al.2008). For instance, molecular data based on plastid DNA(ITS, matK, trnL-F) revealed that the genus Hypochaeris ismonophyletic in South America, although amplified frag-ment length polymorphism (AFLP) analyses resolved sixdifferent independent lineages within the continent (Stuessyet al. 2003; Tremetsberger et al. 2006).In Brazil, Hypochaeris is represented by eight to tenspecies, mostly endemic to the southern region where H.catharinensis Cabrera can be cited as an example of a specieswith unique morphological and ecological characteristics.The distribution of H. catharinensis comprises the north ofRio Grande do Sul and south of Santa Catarina states, occur-ring exclusively at altitudes up to 1400 m, in areas wherethe temperature in winter is below −1◦C, with incidence ofdry, rocky and shallow soils, characterizing a nutrient-poorenvironment (Azevêdo-Gonçalves and Matzenbacher 2007).Adaptation to this environment is facilitated by horizon-tal rhizomes, a feature of taxonomic importance (Azevêdo-Gonçalves and Matzenbacher 2007) that also influencesthe vegetative spread of the species. Morphologically, H.catharinensis has rose-like leaves, forming a rosette thatfavours the total light incidence, a solitary stem, capitulaKeywords. enriched genomic libraries; genetic diversity; Hypochaeris; simple sequence repeats.Journal of Genetics Vol. 94, Online Resources e39Camila Lucas Chaves et al.enclosing florets with yellow corolles and beaked achenes(Azevêdo-Gonçalves and Matzenbacher 2007).Until recently, H. catharinensis was only known byits ecology and morphological characters. However, recentreports based on cytogenetic studies included H. cathari-nensis within a chromosomal group described for the SouthAmerican species of Hypochaeris, while AFLP data pro-vided evidence that H. catharinensis constitutes a new phy-logenetic lineage with the sister-species H. lutea (Recket al. 2011). Studies at population level are important tounderstand the potential for broad and rapid speciation ofHypochaeris in South America, but information at popula-tion level is still lacking for the species H. catharinensis.Since microsatellite markers (SSR) have become thepreferred tool for genetic studies in a variety of organisms,especially as a result of the high level of polymorphism,codominant nature, multiallelism and reproducibility, thispaper describes the development and screening of amicrosatellite-enriched library for H. catharinensis, to studygenetic diversity, population genetic structure, conservationbiology and to understand past demographic events of H.catharinensis and closely-related species. Such studies couldtest the assumption of a recent evolution and biogeographicemergence of the genus Hypochaeris in the South Americancontinent.Materials and methodsGenomic DNA of H. catharinensis and related specieswas extracted from fresh leaves using the cetyltrimethyl-ammonium bromide (CTAB) method (Doyle and Doyle1987). An enriched microsatellite library was constructedusing DNA of one individual of H. catharinensis bythe hybridization based capture method with biotin-labelled (CT)8 and (GT)8 oligonucleotides (Billotte et al.1999). DNA (5 μg) was digested with RsaI (Promega,Madison, USA) and blunt-ended fragments were linkedto adapters (Rsa-21 and Rsa-25). Fragments containingrepeats were selected by hybridization with the biotiny-lated oligonucleotides and recovered by streptavidin-coatedmagnetic beads (Invitrogen-Dynal, Lillestrøm, Norway).Microsatellite-rich fragments were amplified by PCR withthe Rsa 21 adapter and cloned into the pGEM-T Easyvector II (Promega). Recombinant clones (98) were ran-domly selected and double-sequenced with M13 forwardand reverse primers using an ABI 3500xl Genetic Analyzer(Applied Biosystems, New York, USA). A total of 36 cloneswere found possessing motifs with perfect compound andinterrupted microsatellite and 20 of them showed flankingregions adequate for primers design (Primer3Plussoftware;Untergasser et al. 2007).Annealing temperature and amplification consistency foreach primer pair were tested in a sample of five individu-als of H. catharinensis. Twelve of the 20 primer pairs pro-vided clear and consistent amplification pattern and theywere applied for genotyping a sample of 60 individuals of H.catharinensis, representing three native populations (20 indi-viduals of each) from southern Brazil (two populations fromSanta Catarina state: Rancho Queimado —27◦38′S, 48◦59′Wand Caçador-BR153—26◦34′S, 51◦44′W; one populationfrom Rio Grande do Sul state, Cambará do Sul—29◦10′W).Vouchers were deposited at the Herbarium FUEL, Universi-dade Estadual de Londrina under the identification numbers:FUEL 40696 (Rancho Queimado), FUEL 50926 (Caçador-Br153) and FUEL 42237 (Cambará do Sul). For genotyp-ing, we used indirect fluorescent labelling of fragments witha three-primer system (Schuelke 2000), with the forwardprimers tagged with M13 sequences (TGTAAAACGACGGCCAGT) at the 5′end. The standard PCR reactions were ina 10 μL volume containing 4.5 μL GoTaq Green Master Mix(Promega), 0.08 μL of M13-tailed forward primer, 0.32 μLof reverse primers (table 1) and 0.32 μL of M13-labelled(6-FAM, HEX or NED) primers, 2 μL (30 ng) of genomicDNA and 2.78 μL of nuclease free water. PCR amplificationprofiles consisted of an initial denaturation of 4 min at 94◦C,followed by 16 touchdown cycles at 94◦C for 30 s, 65−50◦C(−1◦C per cycle) for 30 s, 72◦C for 1 min, followed by 30additional cycles at 94◦C for 30 s, 50◦C for 30 s and 72◦C for1 min, with a final extension at 72◦C for 7 min. The PCRproducts were run in the ABI 3500-xl Genetic Analyzer(Applied Biosystems).For characterization of the polymorphic loci, we appliedstandard population genetic statistics, calculated usingCervus ver 2.0 software (Marshall et al. 1998) andGENEPOP ver. 1.2 (Raymond and Rousset 1995). Linkagedisequilibrium was tested by sequential Bonferroni correc-tion for multiple comparisons at 5% significance. Presenceof null alleles was verified using the software Micro-Checker2.2.3 (Van-Oosterhout et al. 2004).Results and discussionThe genotyping of 60 individuals of H. catharinensis iden-tified a total of 98 alleles, ranging from 152 (Hcat2) to264 bp (Hcat3), and a moderate level of polymorphism. Thenumber of alleles per locus ranged from three (Hcat3) to 14(Hcat21), with an average of 8.17 alleles per locus (table 1).PIC ranged from 0.064 (Hcat6) to 0.757 (Hcat14), whereaslevels of observed (Ho) and expected (He) heterozygosityvaried from 0.000 (Hcat3) to 0.804 (Hcat24) and from 0.066(Hcat6) to 0.792 (Hcat14) with mean values of 0.325 and0.498, respectively (table 1).Five loci showed allelic frequencies that significantlydeviated from expected HWE proportions, with loci Hcat3,Hcat14, Hcat17 been significant at P ≤ 0.001 and lociHcat21 and Hcat24a were significant at P ≤ 0.05. Pairwisecomparisons for multiple tests among the polymorphic locishowed significant linkage disequilibrium only between lociHcat24a/Hcat24b and Hcat14/Hcat17, while six loci showedsignificant evidence for the presence of null alleles accordingJournal of Genetics Vol. 94, Online Resources e40Microsatellites in H. catharinensisTable 1. Characterization of 12 polymorphic microsatellite loci genotyped in 60 individuals from three populations of H. catharinensis.Locus/GenBank Primer sequence (5′– 3′) Repeat motif TA Allele K Ho He PICaccession no. sizeHcat1 KF157558 F: ATTGCAACCCTTTGCAACTT CA4 59 213–249 5 0.086 0.101 0.098R: CATATTTGTGGGATAAAGGTCAHcat2 KF157559 F: CACTTGAAATCGTCCCTCTCA (GT)6GA(GT)3 59 154–249 11 0.458 0.416 0.392R: AATGTCAAGCCAAGCCAGTCHcat3 KF157560 F: TTCTGCTGCTTTGCTTCTGA GA5 60 260–264 3 0.000** 0.643 0.564R: AAACCCCTACTGCCAGACCTHcat6 KF157561 F: AATTCGGGAGGTTCCCTTTA (TTC)4TTA(TTC) 60 222–225 4 0.017 0.066 0.064R: ACATGAAGGGACGAGTCAGGHcat7 KF157562 F: TCAAGGGTTCTCCCAACAAC (CT)2CCAA(CT)5 60 164–246 6 0.183 0.230 0.218R: GATCAACGTAGCCAGGTGGTHcat8 KF157563 F: GAATGTAGCGGGATCGTT (CA)AA(CA)4 60 164–216 6 0.621 0.495 0.407R: ATGTCGGGGACGGATCTACTHcat14 JX418274 F: ATAACCGTCTGATGCCAAGC (CTT)3n(CTA)3 60 164–226 12 0.217** 0.792 0.757R: CCCAATCTTGAAGCTGGAAAHcat17 JX418277 F: ACACATGAGAAGGGCGATTT (TG)4n(TG)3 59 162–226 9 0.217** 0.747 0.707R: GGTTCCCTATTGCGTTGAAAHcat19 JX418273 F: AACAAGCAAAACCCAGGATG (TCTG)6n(GT)5(TG)4 59 213–225 6 0.133 0.218 0.211R: CATCACCACCCCCTCTTCTAHcat21 JX418272 F: TGCGTGGTTGAATTCTTTGT (CT)3TT(CT)19 59 183–227 14 0.424* 0.787 0.752R: CAAACCAGCACCCTGAAAATHcat24a JX418275 F: TGGCTGCCCTTTATACTTGC (GA)7n(AGG)5 60 185–227 11 0.741* 0.749 0.715R: CGGGAGTATGTATGCGTGTGHcat24b JX418276 F: GCCATGCTTTCTCCCTTTCT (CT)3n(AC)11 60 183–227 11 0.804 0.741 0.702R: GCTTACGCGTGGACTAGCATTA, anneling temperature (◦C); allele size indicates the range of observed alleles in bp; K, number of alleles; Ho and He, observed andexpected heterozygosities, respectively; PIC, polymorphic information content; *significant deviation from with P ≤ 0.05 and **withP ≤ 0.001.Table 2. Cross-amplification test of 12 microsatellite loci throughout 10 species of genus Hypochaeris.Species Hcat1 Hcat2 Hcat3 Hcat6 Hcat7 Hcat8 Hcat14 Hcat17 Hcat19 Hcat21 Hcat24a Hcat24bH. albiflora (Kuntze) Azevêdo-Gonç. + + − + + + + + − − + +& MatzenbH. angustifolia (Litard. & Maire) Maire + + + + + + − − + + + +H. argentina Cabrera + + + + + + + + − + − −H. chillensis (Kunth) + + + + + + + + + − + +H. lutea (Vell.) Britton + + − + + + + + + + + +H. megapotamica Cabrera + + + + + + + + + − + +H. pampasica Cabrera + + − + + + + + + − + +H. patagonica Cabrera − + − + + + − − − − + +H. petiolaris (Hook. & Arn.) Griseb. + + + + + + + + + + + +H. variegata (Lam.) Baker + + + + + + + + + + + ++, Clear amplification; −, no amplification.to Bonferroni correction (P ≤ 0.05), caused probably tohomozygosis excess.The 12 isolated microsatellite loci were tested for cross-amplification in 10 South American representatives ofHypochaeris including H. angustifolia, the presumed ances-tor of this group. Four primer pairs (Hcat2, Hcat6, Hcat7 andHcat8) showed amplifications in all species tested and in H.angustifolia, while the transferability rate of the other locivaried from five to nine species (table 2).The levels of variation detected for the 12 microsatelliteloci revealed the high potential of these markers for appli-cations in genetic diversity, population genetic structure andstudies of past demographic events of H. catharinensis. Highlevels of cross-species transferability of microsatellite loci isonly expected in closely-related species (Selkoe and Toonen2006; Souza et al. 2009; Rai et al. 2013). Therefore, the cross-amplification success of the H. catharinensis microsatellitesalso suggests that these markers can be efficiently applied forJournal of Genetics Vol. 94, Online Resources e41Camila Lucas Chaves et al.genetic studies of other Hypochaeris species, thus providingvaluable information to understand the potential for broadand rapid speciation of the genus in South America.AcknowledgementsThis work was supported by the Brazilian agencies: CNPQConselho Nacional de Desenvolvimento Científico e Tecnológico(nos. 201254/2003-4 and 201332/2003-5), Fundação Araucária-Fundação de Amparo à Pesquisa do Estado do Paraná (no.024/2007, protocol no. 9791) and CAPES—Coordenação de Aper-feiçoamento de Pessoal de Nível Superior for scholarships toPh.D. students and grants (PNPD no. 2238/2009) to postdoctoralassociates.ReferencesAzevêdo-Gonçalves C. F. and Matzenbacher N. I. 2007 O gêneroHypochaeris L. (Asteraceae) no Rio Grande do Sul, Brasil.Iheringia Sér. Bot. 62, 55–87.Billotte N., Lagoda P. J. R., Risterucci A. M. and Baurens F. C.1999 Microsatellite-enriched libraries: applied methodology forthe development of SSR markers in tropical crops. Fruits 54,277–288.Doyle J. J. and Doyle J. L. 1987 A rapid isolation procedure forsmall quantities of fresh leaf tissue. Phytochem. Bull. 19, 11–15.Kim S. C., McGowen M. R., Lubinsky P., Barber J. C., Mort M.E. and Santos-Guerra A. 2008 Timing and tempo of early andsuccessive radiations in Macaronesia. PLoS One 3, 2139.Marshall T. C., Slate J., Kruuk L. and Pemberton J. M. 1998 Statisti-cal confidence for likelihood-based paternity inference in naturalpopulations. Mol. Ecol. 7, 639–655.Qin Y., Xu T., Wang R. and Shi G. 2012 Isolation and characteriza-tion of polymorphic microsatellites for silver pomfret. J. Genet.91, 79–81.Rai M. K., Phulwaria M. and Shekhawat N. S. 2013 Transferabil-ity of simple sequence repeat (SSR) markers developed in guava(Psidium guajava L.) to four Myrtaceae species. Mol. Biol. Rep.40, 5067–5071.Raymond M. and Rousset F. 1995 GENEPOP (version 1.2):population genetics software for exact tests and ecumenicism.J. Heredity 86, 248–249.Reck M., Benício L. M., Ruas E. A., Rodrigues L. A., Ruas P.M., Ortiz M. A. et al. 2011 Karyotype and AFLP data revealthe phylogenetic position of the Brazilian endemic Hypochaeriscatharinensis (Asteraceae). Plant Syst. Evol. 296, 231–243.Ruas E. A., Damasceno J. O., Conson A. R. O., Costa B. F.,Rodrigues L. A., Reck M. et al. 2011 Isolation and characteriza-tion of eleven polymorphic microsatellite loci in Aegiphila andtheir transferability. Biol. Plant 55, 296–299.Sang T., Crawford D. J., Kim S. C. and Stuessy T. F. 1994 Radia-tion of the endemic genus Dendroseris (Asteraceae) on the JuanFernandez Islands: evidence from sequences of the ITS regionsof nuclear ribosomal DNA. Am. J. Bot. 81, 1494–1501.Schuelke M. 2000 An economic method for the fluorescentlabelling of PCR fragments. Nat. Biotechnol. 18, 233–234.Selkoe K. A. and Toonen R. J. 2006 Microsatellites for ecologists:a practical guide to using and evaluating microsatellite markers.Ecol. Lett. 9, 615–629.Souza L. M., Mantello C. C., Santos M. O., Souza Gonçalves P.and Souza A. P. 2009 Microsatellites from rubber tree (Heveabrasiliensis) for genetic diversity analysis and cross-amplificationin six Hevea wild species. Conserv. Genet. Resour. 1, 75–79.Stuessy T. F., Tremetsberger K., Müllner A. N., Jankowicz J., GuoY. P., Baeza C. M. and Samuel R. M. 2003 The melding of sys-tematics and biogeography through investigations at the popula-tional level: examples from the genus Hypochaeris (Asteraceae).Basic Appl. Ecol. 4, 287–296.Tremetsberger K., Weiss-Schneeweiss H., Stuessy T. F., SamuelR., Kadlec G., Ortiz M. A. and Talavera S. 2005 Nuclear ribo-somal DNA and karyotypes indicate a NW African origin ofSouth American Hypochaeris (Asteraceae, Cichorieae). Mol.Phylogenet. Evol. 36, 102–116.Tremetsberger K., Stuessy T. F., Kadlec G., Urtubey E., BaezaC. M., Beck S. G. et al. 2006 AFLP phylogeny of South Ameri-can species of Hypochaeris (Asteraceae, Lactuceae). Syst. Bot. 3,610–626.Untergasser A., Nijveen H., Rao X., Bisseling T., Geurts R. andLeunissen J. A. M. 2007 Primer3Plus, an enhanced web interfaceto Primer3. Nucleic Acids Res. 35, 71–74.Van-Oosterhout C., Hutchinson W. F., Wills D. P. M. and Shipley P.2004 MICRO-CHECKER: software for identifying and correct-ing genotyping errors in microsatellite data. Mol. Ecol. Notes 4,535–538.Received 10 September 2014, in revised form 22 December 2014; accepted 12 February 2015Unedited version published online: 16 February 2015Final version published online: 11 August 2015Journal of Genetics Vol. 94, Online Resources e42

English

Isolation and characterization of twelve polymorphic microsatellite loci for Hypochaeris catharinensis (Asteraceae) and cross-amplification in related species

CONICET Digital

c© Indian Academy of SciencesONLINE RESOURCESIsolation and characterization of twelve polymorphic microsatellite locifor Hypochaeris catharinensis (Asteraceae) and cross-ampliﬁcation inrelated speciesCAMILA LUCAS CHAVES1, CLAUDETE DE FÁTIMA RUAS2, PAULO MAURÍCIO RUAS1,2∗,ANGELO ALBERTO SCHNEIDER3, KÁTIA REAL ROCHA2, ESTRELLA URTUBEY4and EDUARDO AUGUSTO RUAS21Departamento de Agronomia, and 2Departamento de Biologia Geral, Centro de Ciências Biológicas, UniversidadeEstadual de Londrina, 86051-990 Londrina, Paraná, Brazil3Fundação Estadual de Pesquisa Agropecuária, Centro Anacreonte Ávila de Araújo, São Gabriel, Br 290, km 412,Rio Grande do Sul, Brazil4Instituto de Botánica Darwinion, Labardén 200, CC 22, San Isidro, Argentina[Chaves C. L., Ruas C. F., Ruas P. M., Schneider A. A., Rocha K. R., Urtubey E. and Ruas E. A. 2015 Isolation and characterization of twelvepolymorphic microsatellite loci for Hypochaeris catharinensis (Asteraceae) and cross-ampliﬁcation in related species. J. Genet. 94, e39–e42.Online only: http://www.ias.ac.in/jgenet/OnlineResources/94/e39.pdf]IntroductionIn this study, we describe the development and screen-ing of an enriched genomic DNA library aiming to iden-tify microsatellite loci in Hypochaeris catharinensis, anendemic species from southern Brazil. Twelve polymorphicmicrosatellite loci tested in a sample of 60 individuals fromthree different populations of H. catharinensis, identiﬁed98 alleles with an average of 8.17 alleles per locus. Theaverage polymorphic information content (PIC) varied from0.098 to 0.757, with ﬁve loci exhibiting signiﬁcant devi-ation from Hardy–Weinberg equilibrium (HWE). Transfer-ability test for cross-ampliﬁcation was done in 10 relatedHypochaeris species with a rate of success ranging from12 loci, for H. petiolaris and H. varigata, to six loci forH. patagonica. These microsatellite loci will provide valu-able information for studying genetic diversity, populationgenetic structure, conservation biology and for understand-ing the past demographic events of H. catharinensis andother related species of Hypochaeris.Hypochaeris is considered as a biological model to under-stand evolutionary processes in the vascular ﬂora of SouthAmerica, particularly from the temperate portion of the con-tinent. As suggested by molecular clock dating, the SouthAmerican species of Hypochaeris was derived from a com-mon ancestor from northwest Africa that arrived in the con-tinent between 3.5 and 0.25 mya by long-distance dispersal∗For correspondence. E-mail: pmruas@uel.br.(Tremetsberger et al. 2005). Following rapid events of adap-tive radiation in the continent, the genus dispersed (between0.25 and 1.00 mya) into new habitats, developing great dealof morphological variation (Stuessy et al. 2003; Tremets-berger et al. 2006). Evidence of adaptive radiation, produc-ing ecologically restricted and morphologically distinct taxa,has been documented in plants (Sang et al. 1994; Kim et al.2008). For instance, molecular data based on plastid DNA(ITS, matK, trnL-F) revealed that the genus Hypochaeris ismonophyletic in South America, although ampliﬁed frag-ment length polymorphism (AFLP) analyses resolved sixdifferent independent lineages within the continent (Stuessyet al. 2003; Tremetsberger et al. 2006).In Brazil, Hypochaeris is represented by eight to tenspecies, mostly endemic to the southern region where H.catharinensis Cabrera can be cited as an example of a specieswith unique morphological and ecological characteristics.The distribution of H. catharinensis comprises the north ofRio Grande do Sul and south of Santa Catarina states, occur-ring exclusively at altitudes up to 1400 m, in areas wherethe temperature in winter is below −1◦C, with incidence ofdry, rocky and shallow soils, characterizing a nutrient-poorenvironment (Azevêdo-Gonçalves and Matzenbacher 2007).Adaptation to this environment is facilitated by horizon-tal rhizomes, a feature of taxonomic importance (Azevêdo-Gonçalves and Matzenbacher 2007) that also inﬂuencesthe vegetative spread of the species. Morphologically, H.catharinensis has rose-like leaves, forming a rosette thatfavours the total light incidence, a solitary stem, capitulaKeywords. enriched genomic libraries; genetic diversity; Hypochaeris; simple sequence repeats.Journal of Genetics Vol. 94, Online Resources e39Camila Lucas Chaves et al.enclosing ﬂorets with yellow corolles and beaked achenes(Azevêdo-Gonçalves and Matzenbacher 2007).Until recently, H. catharinensis was only known byits ecology and morphological characters. However, recentreports based on cytogenetic studies included H. cathari-nensis within a chromosomal group described for the SouthAmerican species of Hypochaeris, while AFLP data pro-vided evidence that H. catharinensis constitutes a new phy-logenetic lineage with the sister-species H. lutea (Recket al. 2011). Studies at population level are important tounderstand the potential for broad and rapid speciation ofHypochaeris in South America, but information at popula-tion level is still lacking for the species H. catharinensis.Since microsatellite markers (SSR) have become thepreferred tool for genetic studies in a variety of organisms,especially as a result of the high level of polymorphism,codominant nature, multiallelism and reproducibility, thispaper describes the development and screening of amicrosatellite-enriched library for H. catharinensis, to studygenetic diversity, population genetic structure, conservationbiology and to understand past demographic events of H.catharinensis and closely-related species. Such studies couldtest the assumption of a recent evolution and biogeographicemergence of the genus Hypochaeris in the South Americancontinent.Materials and methodsGenomic DNA of H. catharinensis and related specieswas extracted from fresh leaves using the cetyltrimethyl-ammonium bromide (CTAB) method (Doyle and Doyle1987). An enriched microsatellite library was constructedusing DNA of one individual of H. catharinensis bythe hybridization based capture method with biotin-labelled (CT)8 and (GT)8 oligonucleotides (Billotte et al.1999). DNA (5 μg) was digested with RsaI (Promega,Madison, USA) and blunt-ended fragments were linkedto adapters (Rsa-21 and Rsa-25). Fragments containingrepeats were selected by hybridization with the biotiny-lated oligonucleotides and recovered by streptavidin-coatedmagnetic beads (Invitrogen-Dynal, Lillestrøm, Norway).Microsatellite-rich fragments were ampliﬁed by PCR withthe Rsa 21 adapter and cloned into the pGEM-T Easyvector II (Promega). Recombinant clones (98) were ran-domly selected and double-sequenced with M13 forwardand reverse primers using an ABI 3500xl Genetic Analyzer(Applied Biosystems, New York, USA). A total of 36 cloneswere found possessing motifs with perfect compound andinterrupted microsatellite and 20 of them showed ﬂankingregions adequate for primers design (Primer3Plussoftware;Untergasser et al. 2007).Annealing temperature and ampliﬁcation consistency foreach primer pair were tested in a sample of ﬁve individu-als of H. catharinensis. Twelve of the 20 primer pairs pro-vided clear and consistent ampliﬁcation pattern and theywere applied for genotyping a sample of 60 individuals of H.catharinensis, representing three native populations (20 indi-viduals of each) from southern Brazil (two populations fromSanta Catarina state: Rancho Queimado —27◦38′S, 48◦59′Wand Caçador-BR153—26◦34′S, 51◦44′W; one populationfrom Rio Grande do Sul state, Cambará do Sul—29◦10′W).Vouchers were deposited at the Herbarium FUEL, Universi-dade Estadual de Londrina under the identiﬁcation numbers:FUEL 40696 (Rancho Queimado), FUEL 50926 (Caçador-Br153) and FUEL 42237 (Cambará do Sul). For genotyp-ing, we used indirect ﬂuorescent labelling of fragments witha three-primer system (Schuelke 2000), with the forwardprimers tagged with M13 sequences (TGTAAAACGACGGCCAGT) at the 5′end. The standard PCR reactions were ina 10 μL volume containing 4.5 μL GoTaq Green Master Mix(Promega), 0.08 μL of M13-tailed forward primer, 0.32 μLof reverse primers (table 1) and 0.32 μL of M13-labelled(6-FAM, HEX or NED) primers, 2 μL (30 ng) of genomicDNA and 2.78 μL of nuclease free water. PCR ampliﬁcationproﬁles consisted of an initial denaturation of 4 min at 94◦C,followed by 16 touchdown cycles at 94◦C for 30 s, 65−50◦C(−1◦C per cycle) for 30 s, 72◦C for 1 min, followed by 30additional cycles at 94◦C for 30 s, 50◦C for 30 s and 72◦C for1 min, with a ﬁnal extension at 72◦C for 7 min. The PCRproducts were run in the ABI 3500-xl Genetic Analyzer(Applied Biosystems).For characterization of the polymorphic loci, we appliedstandard population genetic statistics, calculated usingCervus ver 2.0 software (Marshall et al. 1998) andGENEPOP ver. 1.2 (Raymond and Rousset 1995). Linkagedisequilibrium was tested by sequential Bonferroni correc-tion for multiple comparisons at 5% signiﬁcance. Presenceof null alleles was veriﬁed using the software Micro-Checker2.2.3 (Van-Oosterhout et al. 2004).Results and discussionThe genotyping of 60 individuals of H. catharinensis iden-tiﬁed a total of 98 alleles, ranging from 152 (Hcat2) to264 bp (Hcat3), and a moderate level of polymorphism. Thenumber of alleles per locus ranged from three (Hcat3) to 14(Hcat21), with an average of 8.17 alleles per locus (table 1).PIC ranged from 0.064 (Hcat6) to 0.757 (Hcat14), whereaslevels of observed (Ho) and expected (He) heterozygosityvaried from 0.000 (Hcat3) to 0.804 (Hcat24) and from 0.066(Hcat6) to 0.792 (Hcat14) with mean values of 0.325 and0.498, respectively (table 1).Five loci showed allelic frequencies that signiﬁcantlydeviated from expected HWE proportions, with loci Hcat3,Hcat14, Hcat17 been signiﬁcant at P ≤ 0.001 and lociHcat21 and Hcat24a were signiﬁcant at P ≤ 0.05. Pairwisecomparisons for multiple tests among the polymorphic locishowed signiﬁcant linkage disequilibrium only between lociHcat24a/Hcat24b and Hcat14/Hcat17, while six loci showedsignificant evidence for the presence of null alleles accordingJournal of Genetics Vol. 94, Online Resources e40Microsatellites in H. catharinensisTable 1. Characterization of 12 polymorphic microsatellite loci genotyped in 60 individuals from three populations of H. catharinensis.Locus/GenBank Primer sequence (5′– 3′) Repeat motif TA Allele K Ho He PICaccession no. sizeHcat1 KF157558 F: ATTGCAACCCTTTGCAACTT CA4 59 213–249 5 0.086 0.101 0.098R: CATATTTGTGGGATAAAGGTCAHcat2 KF157559 F: CACTTGAAATCGTCCCTCTCA (GT)6GA(GT)3 59 154–249 11 0.458 0.416 0.392R: AATGTCAAGCCAAGCCAGTCHcat3 KF157560 F: TTCTGCTGCTTTGCTTCTGA GA5 60 260–264 3 0.000** 0.643 0.564R: AAACCCCTACTGCCAGACCTHcat6 KF157561 F: AATTCGGGAGGTTCCCTTTA (TTC)4TTA(TTC) 60 222–225 4 0.017 0.066 0.064R: ACATGAAGGGACGAGTCAGGHcat7 KF157562 F: TCAAGGGTTCTCCCAACAAC (CT)2CCAA(CT)5 60 164–246 6 0.183 0.230 0.218R: GATCAACGTAGCCAGGTGGTHcat8 KF157563 F: GAATGTAGCGGGATCGTT (CA)AA(CA)4 60 164–216 6 0.621 0.495 0.407R: ATGTCGGGGACGGATCTACTHcat14 JX418274 F: ATAACCGTCTGATGCCAAGC (CTT)3n(CTA)3 60 164–226 12 0.217** 0.792 0.757R: CCCAATCTTGAAGCTGGAAAHcat17 JX418277 F: ACACATGAGAAGGGCGATTT (TG)4n(TG)3 59 162–226 9 0.217** 0.747 0.707R: GGTTCCCTATTGCGTTGAAAHcat19 JX418273 F: AACAAGCAAAACCCAGGATG (TCTG)6n(GT)5(TG)4 59 213–225 6 0.133 0.218 0.211R: CATCACCACCCCCTCTTCTAHcat21 JX418272 F: TGCGTGGTTGAATTCTTTGT (CT)3TT(CT)19 59 183–227 14 0.424* 0.787 0.752R: CAAACCAGCACCCTGAAAATHcat24a JX418275 F: TGGCTGCCCTTTATACTTGC (GA)7n(AGG)5 60 185–227 11 0.741* 0.749 0.715R: CGGGAGTATGTATGCGTGTGHcat24b JX418276 F: GCCATGCTTTCTCCCTTTCT (CT)3n(AC)11 60 183–227 11 0.804 0.741 0.702R: GCTTACGCGTGGACTAGCATTA, anneling temperature (◦C); allele size indicates the range of observed alleles in bp; K, number of alleles; Ho and He, observed andexpected heterozygosities, respectively; PIC, polymorphic information content; *signiﬁcant deviation from with P ≤ 0.05 and **withP ≤ 0.001.Table 2. Cross-ampliﬁcation test of 12 microsatellite loci throughout 10 species of genus Hypochaeris.Species Hcat1 Hcat2 Hcat3 Hcat6 Hcat7 Hcat8 Hcat14 Hcat17 Hcat19 Hcat21 Hcat24a Hcat24bH. albiﬂora (Kuntze) Azevêdo-Gonç. + + − + + + + + − − + +& MatzenbH. angustifolia (Litard. & Maire) Maire + + + + + + − − + + + +H. argentina Cabrera + + + + + + + + − + − −H. chillensis (Kunth) + + + + + + + + + − + +H. lutea (Vell.) Britton + + − + + + + + + + + +H. megapotamica Cabrera + + + + + + + + + − + +H. pampasica Cabrera + + − + + + + + + − + +H. patagonica Cabrera − + − + + + − − − − + +H. petiolaris (Hook. & Arn.) Griseb. + + + + + + + + + + + +H. variegata (Lam.) Baker + + + + + + + + + + + ++, Clear ampliﬁcation; −, no ampliﬁcation.to Bonferroni correction (P ≤ 0.05), caused probably tohomozygosis excess.The 12 isolated microsatellite loci were tested for cross-ampliﬁcation in 10 South American representatives ofHypochaeris including H. angustifolia, the presumed ances-tor of this group. Four primer pairs (Hcat2, Hcat6, Hcat7 andHcat8) showed ampliﬁcations in all species tested and in H.angustifolia, while the transferability rate of the other locivaried from ﬁve to nine species (table 2).The levels of variation detected for the 12 microsatelliteloci revealed the high potential of these markers for appli-cations in genetic diversity, population genetic structure andstudies of past demographic events of H. catharinensis. Highlevels of cross-species transferability of microsatellite loci isonly expected in closely-related species (Selkoe and Toonen2006; Souza et al. 2009; Rai et al. 2013). Therefore, the cross-ampliﬁcation success of the H. catharinensis microsatellitesalso suggests that these markers can be efﬁciently applied forJournal of Genetics Vol. 94, Online Resources e41Camila Lucas Chaves et al.genetic studies of other Hypochaeris species, thus providingvaluable information to understand the potential for broadand rapid speciation of the genus in South America.AcknowledgementsThis work was supported by the Brazilian agencies: CNPQConselho Nacional de Desenvolvimento Cientíﬁco e Tecnológico(nos. 201254/2003-4 and 201332/2003-5), Fundação Araucária-Fundação de Amparo à Pesquisa do Estado do Paraná (no.024/2007, protocol no. 9791) and CAPES—Coordenação de Aper-feiçoamento de Pessoal de Nível Superior for scholarships toPh.D. students and grants (PNPD no. 2238/2009) to postdoctoralassociates.ReferencesAzevêdo-Gonçalves C. F. and Matzenbacher N. I. 2007 O gêneroHypochaeris L. (Asteraceae) no Rio Grande do Sul, Brasil.Iheringia Sér. Bot. 62, 55–87.Billotte N., Lagoda P. J. R., Risterucci A. M. and Baurens F. C.1999 Microsatellite-enriched libraries: applied methodology forthe development of SSR markers in tropical crops. Fruits 54,277–288.Doyle J. J. and Doyle J. L. 1987 A rapid isolation procedure forsmall quantities of fresh leaf tissue. Phytochem. Bull. 19, 11–15.Kim S. C., McGowen M. R., Lubinsky P., Barber J. C., Mort M.E. and Santos-Guerra A. 2008 Timing and tempo of early andsuccessive radiations in Macaronesia. PLoS One 3, 2139.Marshall T. C., Slate J., Kruuk L. and Pemberton J. M. 1998 Statisti-cal conﬁdence for likelihood-based paternity inference in naturalpopulations. Mol. Ecol. 7, 639–655.Qin Y., Xu T., Wang R. and Shi G. 2012 Isolation and characteriza-tion of polymorphic microsatellites for silver pomfret. J. Genet.91, 79–81.Rai M. K., Phulwaria M. and Shekhawat N. S. 2013 Transferabil-ity of simple sequence repeat (SSR) markers developed in guava(Psidium guajava L.) to four Myrtaceae species. Mol. Biol. Rep.40, 5067–5071.Raymond M. and Rousset F. 1995 GENEPOP (version 1.2):population genetics software for exact tests and ecumenicism.J. Heredity 86, 248–249.Reck M., Benício L. M., Ruas E. A., Rodrigues L. A., Ruas P.M., Ortiz M. A. et al. 2011 Karyotype and AFLP data revealthe phylogenetic position of the Brazilian endemic Hypochaeriscatharinensis (Asteraceae). Plant Syst. Evol. 296, 231–243.Ruas E. A., Damasceno J. O., Conson A. R. O., Costa B. F.,Rodrigues L. A., Reck M. et al. 2011 Isolation and characteriza-tion of eleven polymorphic microsatellite loci in Aegiphila andtheir transferability. Biol. Plant 55, 296–299.Sang T., Crawford D. J., Kim S. C. and Stuessy T. F. 1994 Radia-tion of the endemic genus Dendroseris (Asteraceae) on the JuanFernandez Islands: evidence from sequences of the ITS regionsof nuclear ribosomal DNA. Am. J. Bot. 81, 1494–1501.Schuelke M. 2000 An economic method for the ﬂuorescentlabelling of PCR fragments. Nat. Biotechnol. 18, 233–234.Selkoe K. A. and Toonen R. J. 2006 Microsatellites for ecologists:a practical guide to using and evaluating microsatellite markers.Ecol. Lett. 9, 615–629.Souza L. M., Mantello C. C., Santos M. O., Souza Gonçalves P.and Souza A. P. 2009 Microsatellites from rubber tree (Heveabrasiliensis) for genetic diversity analysis and cross-ampliﬁcationin six Hevea wild species. Conserv. Genet. Resour. 1, 75–79.Stuessy T. F., Tremetsberger K., Müllner A. N., Jankowicz J., GuoY. P., Baeza C. M. and Samuel R. M. 2003 The melding of sys-tematics and biogeography through investigations at the popula-tional level: examples from the genus Hypochaeris (Asteraceae).Basic Appl. Ecol. 4, 287–296.Tremetsberger K., Weiss-Schneeweiss H., Stuessy T. F., SamuelR., Kadlec G., Ortiz M. A. and Talavera S. 2005 Nuclear ribo-somal DNA and karyotypes indicate a NW African origin ofSouth American Hypochaeris (Asteraceae, Cichorieae). Mol.Phylogenet. Evol. 36, 102–116.Tremetsberger K., Stuessy T. F., Kadlec G., Urtubey E., BaezaC. M., Beck S. G. et al. 2006 AFLP phylogeny of South Ameri-can species of Hypochaeris (Asteraceae, Lactuceae). Syst. Bot. 3,610–626.Untergasser A., Nijveen H., Rao X., Bisseling T., Geurts R. andLeunissen J. A. M. 2007 Primer3Plus, an enhanced web interfaceto Primer3. Nucleic Acids Res. 35, 71–74.Van-Oosterhout C., Hutchinson W. F., Wills D. P. M. and Shipley P.2004 MICRO-CHECKER: software for identifying and correct-ing genotyping errors in microsatellite data. Mol. Ecol. Notes 4,535–538.Received 10 September 2014, in revised form 22 December 2014; accepted 12 February 2015Unedited version published online: 16 February 2015Final version published online: 11 August 2015Journal of Genetics Vol. 94, Online Resources e42

http://ri.conicet.gov.ar/bitstream/11336/19087/1/CONICET_Digital_Nro.22903.pdf

Isolation and characterization of twelve polymorphic microsatellite loci for Hypochaeris catharinensis (Asteraceae) and cross-amplification in related species

Abstract

Similar works

Full text

Available Versions

LAReferencia - Red Federada de Repositorios Institucionales de Publicaciones Científicas Latinoamericanas

CONICET Digital