The accuracy of LiPA 2.0 for hepatitis C virus 1 (HCV-1) subtype classification was analyzed. LiPA 2.0 genotype results from 101 HCV-1-infected patients were compared to genotype findings determined by direct core sequencing. Eleven (11%) samples were misclassified. Given the influence of the HCV-1-subtype in the anti-HCV therapy response, an alternative classification method is warranted.Fil: Guelfo, Javier R.. Hospital Universitario de Valme. Unidad de Enfermedades Infecciosas y Microbiología; EspañaFil: Macias, Juan. Hospital Universitario de Valme. Unidad de Enfermedades Infecciosas y Microbiología; EspañaFil: Neukam, Karin. Hospital Universitario de Valme. Unidad de Enfermedades Infecciosas y Microbiología; EspañaFil: Di Lello, Federico Alejandro. Hospital Universitario de Valme. Unidad de Enfermedades Infecciosas y Microbiología; España. Universidad de Buenos Aires. Facultad de Farmacia y Bioquímica; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Mira José Antonio. Hospital Universitario de Valme. Unidad de Enfermedades Infecciosas y Microbiología; EspañaFil: Merchante, Nicolás. Hospital Universitario de Valme. Unidad de Enfermedades Infecciosas y Microbiología; EspañaFil: Mancebo, María. Hospital Universitario de Valme. Unidad de Enfermedades Infecciosas y Microbiología; EspañaFil: Nuñez Torres, Rocío. Hospital Universitario de Valme. Unidad de Enfermedades Infecciosas y Microbiología; EspañaFil: Pineda, Juan A.. Hospital Universitario de Valme. Unidad de Enfermedades Infecciosas y Microbiología; EspañaFil: Real. Luis M.. Hospital Universitario de Valme. Unidad de Enfermedades Infecciosas y Microbiología; Españ

Di Lello, Federico Alejandro

Guelfo, Javier R.

Macias, Juan

Mancebo, María

Merchante, Nicolás

Mira José Antonio

Neukam, Karin

Nuñez Torres, Rocío

Pineda, Juan A.

Real. Luis M.

Journal of Clinical Microbiology

PubMed

ABSTRACT
          The accuracy of LiPA 2.0 for hepatitis C virus 1 (HCV-1) subtype classification was analyzed. LiPA 2.0 genotype results from 101 HCV-1-infected patients were compared to genotype findings determined by direct core sequencing. Eleven (11%) samples were misclassified. Given the influence of the HCV-1-subtype in the anti-HCV therapy response, an alternative classification method is warranted.</jats:p

Javier R. Guelfo

Juan Macias

Karin Neukam

Federico A. Di Lello

Jose A. Mira

Nicolas Merchante

María Mancebo

Rocío Nuñez-Torres

Juan A. Pineda

Luis M. Real

Crossref

Reassessment of Genotype 1 Hepatitis C Virus Subtype Misclassification by LiPA 2.0: Implications for Direct-Acting Antiviral Treatment

CONICET Digital

Reassessment of Genotype 1 Hepatitis C Virus SubtypeMisclassification by LiPA 2.0: Implications for Direct-Acting AntiviralTreatmentJavier R. Guelfo,a,b Juan Macias,a,b Karin Neukam,a,b Federico A. Di Lello,a,c Jose A. Mira,a,b Nicolas Merchante,a,b María Mancebo,a,bRocío Nuñez-Torres,a,b Juan A. Pineda,a,b Luis M. Reala,bUnidad de Enfermedades Infecciosas y Microbiología, Hospital Universitario de Valme, Seville, Spaina; Instituto de Biomedicina de Seville (IBIS), Seville, Spainb; Cátedra deVirología, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Buenos Aires, ArgentinacThe accuracy of LiPA 2.0 for hepatitis C virus 1 (HCV-1) subtype classification was analyzed. LiPA 2.0 genotype results from 101HCV-1-infected patients were compared to genotype findings determined by direct core sequencing. Eleven (11%) samples weremisclassified. Given the influence of the HCV-1-subtype in the anti-HCV therapy response, an alternative classificationmethodis warranted.The effect of the hepatitis C virus (HCV) genotype 1 subtype onthe response to treatment can be dramatic for some directantiviral agent (DAA)-containing regimens (1–9). This is the casefor simeprevir, a DAA recently approved for clinical use, that incombination with pegylated interferon and ribavirin (peg-IFN/RBV) has a lower sustained virological response (SVR) rate forsubtype 1a than for 1b (2). Simeprevir plus peg-IFN/RBV treat-ment achieves rates of SVR similar to those for peg-IFN/RBVtreatment in HCV-1a-infected patients who present the viral vari-ation Q80K. This variation is frequent in the HCV-1a subtype, butit is not found in HCV-1b (2, 5). Similarly, daclatasvir plus peg-IFN/RBV treatment also achieves higher SVR rates among HCV-1b-infected patients than among HCV-1a-infected individuals(4). For interferon-free regimens, DAA combinations such as asu-naprevir plus daclatasvir may only be indicated for subtype 1b,because of high relapse rates observed among patients with sub-type 1a (3, 4). Because of these, accurate subtyping of HCV geno-type 1-infected patients is needed for those who are candidates forDAAs.Sequencing of specific HCV genome regions with subsequentphylogenetic analysis is considered the gold standard of HCVgenotyping (10). However, it includes several complex techniquesand is time consuming. For these reasons, LiPA 2.0 is currentlyone of the most widely used genotyping assays. However, severalstudies have reported HCV genotyping errors using this commer-cial method (11–13). Those studies were not designed to evaluatethe frequency of HCV-1 subtyping misclassifications, and theyincluded few HCV-1-infected patients. Therefore, due to the highprevalence of HCV-1 infections in western countries and the im-portance of correct subtyping in clinical decisions, the accuracy ofthis method for HCV-1 subtyping needs to be evaluated in largersamples. For these reasons, we aimed to evaluate the accuracy ofLiPA 2.0 for classifying HCV-1 by subtypes.This study was performed according to the ethical guidelines ofthe 1975 Declaration of Helsinki, and it was approved by the ethicscommittee of the Hospital Universitario de Valme (Seville, Spain).The first 110 consecutive patients starting from October 2001,who received a course of peg-IFN/RBV treatment in our hospitaland who were infected with HCV-1, according to the LiPA 2.0determination, were selected. All of them were Caucasian with amedian age (quartile 1 to quartile 3) of 42 years (range, 39 to 46years). Among the patients, 82 (81%) were male, and 48 (47.5%)were infected with HIV.To determine the HCV-1 subtype, we analyzed the entire coregenetic sequence. This region is more conserved than those tradi-tionally used for HCV genotyping (NS5B or core/E1) and allowshigher amplification rates (13, 14). The core region was amplifiedby nested PCRs. The first PCR was performed with 5 l of cDNAusing primers 1 and 2 (Table 1). For the second PCR, 4 l of thefirst PCR product and primers 3 and 4 (Table 1) were used. Forthose samples that were not amplified with this protocol, primers1 and 5 for the LiPA 2.0-identified subtype 1a or primers 1 and 4for subtype 1b were used to perform the external PCR and thenprimers 6 and 7 (1a) or 8 (1b) were used in the internal PCR (Table1). The nested PCR products were bidirectionally sequenced usingstandard capillary electrophoresis techniques. ClustalW2 software(www.ebi.ac.uk/Tools/msa/clustalw2/) was used for alignment ofthe forward and reverse sequenced strains to obtain consensussequences.As the genotyping method, we analyzed the evolutionary his-tory, which was inferred by using the maximum likelihoodmethod based on the general time reversible model. Evolutionaryanalyses were conducted in MEGA5 software (15). The initialtree(s) for the heuristic search was obtained by applying the neigh-bor-joining method to a matrix of pairwise distances estimatedusing the maximum composite likelihood (MCL) approach (15).A discrete gamma distribution was used to model the evolutionaryrate differences among sites (4 categories [G, parameter 0.3742]). The analysis involved 110 sequences, including the se-quences from patient samples and those selected as references. Inthe final data set, there were a total of 573 base pair positionscorresponding to the complete core region for each sample.Received 31 July 2014 Returned for modification 1 August 2014Accepted 13 August 2014Published ahead of print 20 August 2014Editor: Y.-W. TangAddress correspondence to Luis M. Real, lmreal67b@gmail.com.Copyright © 2014, American Society for Microbiology. All Rights Reserved.doi:10.1128/JCM.02209-14November 2014 Volume 52 Number 11 Journal of Clinical Microbiology p. 4027–4029 jcm.asm.org 4027 on April 26, 2017 by guesthttp://jcm.asm.org/Downloaded from Successful sequencing and genotyping were obtained in 101(91.8%) patients. The 9 (8.2%) samples that were not amplifiedhad a viral load of3 log IU/ml.According to LiPA 2.0, 58 (57.4%) samples were identified asHCV-1a, and the remaining 43 (42.6%) were identified as HCV-1b. By the sequence-based method, 67 (66.3%) samples were clas-sified as genotype 1a, 33 (32.7%) samples were classified as 1b, and1 (1%) was classified as 4d (Table 2). The overall Cohen kappaindex obtained was 0.773 (95% confidence interval, 0.647 to0.900). The proportion of patients with misclassified HCV-1 sub-types was 11%. All HCV-1 subtype misclassifications were ob-served among individuals identified by LiPA 2.0 as the HCV-1bsubtype. Thus, 10 (23%) patients classified as HCV-1b by LiPA 2.0were identified as HCV-1a by sequencing methods (Table 2). Thesensitivity, specificity, positive predictive value, and negative pre-dictive value for HCV-1b subtyping by LiPA 2.0 were 1, 0.85, 0.77,and 1, respectively. The corresponding numbers for HCV-1a sub-typing were 0.85, 0.97, 0.98, and 0.77, respectively.This is the largest study, to our knowledge, that has analyzedthe accuracy of HCV-1 subtype identification by LiPA 2.0. Thestudy of Avó et al. (11) included a total of 31 HCV-1 samples (ofthem, only 7 were 1b), whereas in the study of Bouchardeau et al.(12), there were a total of 62 HCV-1 samples and only 21 of themwere 1b. In a similar study, HCV-1a-infected patients were notincluded because of the HCV genotype distribution (13).In conclusion, our results show that the LiPA 2.0 assay is not anadequate tool for subtyping HCV genotype 1. This genotypingmethod has subtyping failures, and it is prone to errors with HCVsubtype 1b. Because the HCV subtype 1 misclassification mightlead to inadequate treatment associated with a high likelihood ofnonresponse, more accurate genotyping methods than LiPA 2.0should be used.Nucleotide sequence accession numbers. The sequences ob-tained in this study were submitted to GenBank under accessionnumbers KF060663 to KF060714 and KJ739737 to KJ739786.ACKNOWLEDGMENTSThis work was partially funded by the RD12/0017/0012 project as partof the Plan Nacional RDI and cofinanced by ISCIII-SubdirecciónGeneral de Evaluación y el Fondo Europeo de Desarrollo Regional(FEDER), the Ministerio de Sanidad y Servicios Sociales (EC11-304),and the Fundación para la Investigación y la Prevención del Sida enEspaña (121004/10). J.M. is the recipient of a grant from the ServicioAndaluz de Salud de la Junta de Andalucía (B-0037). J.A.P. is therecipient of an intensification grant from the Instituto de Salud CarlosIII (grant Programa-I3SNS). K.N. is the recipient of a Miguel Servetresearch grant (CP13-00187).These funding institutions did not have any role in the study design orcollection, analysis, or interpretation of the data. They did not participatein the writing of the report or in the decision to submit the paper forpublication.We declare no conflicts of interest.REFERENCES1. Forns X, Lawitz E, Zeuzem S, Gane E, Bronowicki JP, Andreone P,Horban A, Brown A, Peeters M, Lenz O, Ouwerkerk-Mahadevan S,Scott J, Kalmeijer R, De La Rosa G, Sinha R, Beumont-Mauviel M.2013. Simeprevir (TMC435) with peg-interferon -2a/ribavirin for treat-ment of chronic HCV genotype 1 infection in patients who relapsed afterprevious interferon-based therapy: efficacy and safety in patient subpopu-lations in the PROMISE phase III trial. Hepatology 58:737A–738A. http://dx.doi.org/10.1002/hep.26858.2. Jacobson I, Dore GJ, Foster GR, Fried MW, Radu M, Rafalskiy VV,Moroz L, Craxi A, Peeters M, Lenz O, Ouwerkerk-Mahadevan S,Kalmeijer R, Beumont-Mauviel M. 2013. Simeprevir (TMC435) withpeginterferon/ribavirin for chronic HCV genotype 1 infection in treat-ment-naive patients: results from QUEST-1, a phase III trial. J. Hepatol.58(Suppl 1):S574. http://dx.doi.org/10.1016/S0168-8278(13)61424-5.3. Lok AS, Gardiner DF, Hezode C, Lawitz EJ, Bourliere M, Everson GT,Marcellin P, Rodriguez-Torres M, Pol S, Serfaty L, Eley T, Huang SP,Li J, Wind-Rotolo M, Yu F, McPhee F, Grasela DM, Pasquinelli C.2014. Randomized trial of daclatasvir and asunaprevir with or withoutPegIFN/RBV for hepatitis C virus genotype 1 null responders. J. Hepatol.60:490 – 499. http://dx.doi.org/10.1016/j.jhep.2013.10.019.4. Lok AS, Gardiner DF, Lawitz E, Martorell C, Everson GT, Ghalib R,Reindollar R, Rustgi V, McPhee F, Wind-Rotolo M, Persson A, Zhu K,Dimitrova DI, Eley T, Guo T, Grasela DM, Pasquinelli C. 2012. Pre-liminary study of two antiviral agents for hepatitis C genotype 1. N. Engl.J. Med. 366:216 –224. http://dx.doi.org/10.1056/NEJMoa1104430.5. Poordad F, Manns MP, Marcellin P, de Araujo ES, Buti M, HorsmansY, Janczewska E, Villamil F, Peeters M, Lenz O, Ouwerkerk-MahadevanS, Kalmeijer R, Beumont-Mauviel M. 2013. Simeprevir (TMC435) withpeginterferon/ribavirin for treatment of chronic HCV genotype-1 infec-tion in treatment-naive patients: results from QUEST-2, a phase III trial.Gastroenterology 144:S151.6. Sarrazin C, Zeuzem S. 2010. Resistance to direct antiviral agents in pa-tients with hepatitis C virus infection. Gastroenterology 138:447– 462.http://dx.doi.org/10.1053/j.gastro.2009.11.055.7. Schneider MD, Sarrazin C. 2014. Antiviral therapy of hepatitis C in 2014:TABLE 1 Primers used for amplification of the HCV core genePrimer no. Designation Sequence (5= to 3=) Location in genomea1 FAD-ES-Fw CGAAAGGCCTTGTGGTACTG 272¡ 2912 FAD-EA-Rv CTCCCGAACGCAGGGCAC 1020¢ 1037b3 FAD-IS-Fw TTGTGGTACTGCCTGATAGGGT 281¡ 3024 FAD-IA-Rv ATGCTTGAGTTGGAGCAGTCG 956¢ 976b5 JLM-Ea-Rv CGCCTCGTACACAATACTCG 970¢ 989b6 JLM-Iab-Fw TGTGGTACTGCCTGATAGGG 282¡ 3017 JLM-Ia-Rv GGGCAATCATTGGTGACATGG 944¢ 964b8 JLM-Ib-Rv TTGGAGCAGTCGTTCGTGAC 948¢ 967ba Nucleotide position according to reference sequence H77 (GenBank accession number NC_004102).b Reverse complement sequence with respect to that specified in the reference sequence.TABLE 2 HCV genotyping results obtained with sequence-basedmethods and the LiPA 2.0HCV genotype byLiPA 2.0HCV genotype by coresequence:Total1a 1b 4d1a 57 1 581b 10 33 43Total 67 33 1 101Guelfo et al.4028 jcm.asm.org Journal of Clinical Microbiology on April 26, 2017 by guesthttp://jcm.asm.org/Downloaded from do we need resistance testing? Antiviral Res. 105:64 –71. http://dx.doi.org/10.1016/j.antiviral.2014.02.011.8. Sulkowski MS, Gardiner DF, Rodriguez-Torres M, Reddy KR, Hassa-nein T, Jacobson I, Lawitz E, Lok AS, Hinestrosa F, Thuluvath PJ,Schwartz H, Nelson DR, Everson GT, Eley T, Wind-Rotolo M, HuangSP, Gao M, Hernandez D, McPhee F, Sherman D, Hindes R, SymondsW, Pasquinelli C, Grasela DM. 2014. Daclatasvir plus sofosbuvir forpreviously treated or untreated chronic HCV infection. N. Engl. J. Med.370:211–221. http://dx.doi.org/10.1056/NEJMoa1306218.9. Zeuzem S, Soriano V, Asselah T, Bronowicki JP, Lohse AW, MullhauptB, Schuchmann M, Bourliere M, Buti M, Roberts SK, Gane EJ, SternJO, Vinisko R, Kukolj G, Gallivan JP, Bocher WO, Mensa FJ. 2013.Faldaprevir and deleobuvir for HCV genotype 1 infection. N. Engl. J. Med.369:630 – 639. http://dx.doi.org/10.1056/NEJMoa1213557.10. Robertson B, Myers G, Howard C, Brettin T, Bukh J, Gaschen B,Gojobori T, Maertens G, Mizokami M, Nainan O, Netesov S, NishiokaK, Shin I, Simmonds TP, Smith D, Stuyver L, Weiner A. 1998. Classi-fication, nomenclature, and database development for hepatitis C virus(HCV) and related viruses: proposals for standardization. InternationalCommittee on Virus Taxonomy. Arch. Virol. 143:2493–2503.11. Avó AP, Agua-Doce I, Andrade A, Padua E. 2013. Hepatitis C virussubtyping based on sequencing of the C/E1 and NS5B genomic regions incomparison to a commercially available line probe assay. J. Med. Virol.85:815– 822. http://dx.doi.org/10.1002/jmv.23545.12. Bouchardeau F, Cantaloube JF, Chevaliez S, Portal C, Razer A, LefrereJJ, Pawlotsky JM, De Micco P, Laperche S. 2007. Improvement ofhepatitis C virus (HCV) genotype determination with the new version ofthe INNO-LiPA HCV assay. J. Clin. Microbiol. 45:1140 –1145. http://dx.doi.org/10.1128/JCM.01982-06.13. Cai Q, Zhao Z, Liu Y, Shao X, Gao Z. 2013. Comparison of threedifferent HCV genotyping methods: core, NS5B sequence analysis andline probe assay. Int. J. Mol. Med. 31:347–352.14. Simmonds P, Smith DB, McOmish F, Yap PL, Kolberg J, Urdea MS,Holmes EC. 1994. Identification of genotypes of hepatitis C virus bysequence comparisons in the core, E1 and NS-5 regions. J. Gen. Virol.75(Part 5):1053–1061. http://dx.doi.org/10.1099/0022-1317-75-5-1053.15. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011.MEGA5: molecular evolutionary genetics analysis using maximum likeli-hood, evolutionary distance, and maximum parsimony methods. Mol.Biol. Evol. 28:2731–2739. http://dx.doi.org/10.1093/molbev/msr121.LiPA 2.0 and HCV-1 SubtypingNovember 2014 Volume 52 Number 11 jcm.asm.org 4029 on April 26, 2017 by guesthttp://jcm.asm.org/Downloaded from 

Reassessment of genotype 1 hepatitis c virus subtype misclassification by LiPA 2.0: implications for direct-acting antiviral treatment

LAReferencia - Red Federada de Repositorios Institucionales de Publicaciones Científicas Latinoamericanas

Reassessment of Genotype 1 Hepatitis C Virus SubtypeMisclassification by LiPA 2.0: Implications for Direct-Acting AntiviralTreatmentJavier R. Guelfo,a,b Juan Macias,a,b Karin Neukam,a,b Federico A. Di Lello,a,c Jose A. Mira,a,b Nicolas Merchante,a,b María Mancebo,a,bRocío Nuñez-Torres,a,b Juan A. Pineda,a,b Luis M. Reala,bUnidad de Enfermedades Infecciosas y Microbiología, Hospital Universitario de Valme, Seville, Spaina; Instituto de Biomedicina de Seville (IBIS), Seville, Spainb; Cátedra deVirología, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Buenos Aires, ArgentinacThe accuracy of LiPA 2.0 for hepatitis C virus 1 (HCV-1) subtype classification was analyzed. LiPA 2.0 genotype results from 101HCV-1-infected patients were compared to genotype findings determined by direct core sequencing. Eleven (11%) samples weremisclassified. Given the influence of the HCV-1-subtype in the anti-HCV therapy response, an alternative classification methodis warranted.The effect of the hepatitis C virus (HCV) genotype 1 subtype onthe response to treatment can be dramatic for some directantiviral agent (DAA)-containing regimens (1–9). This is the casefor simeprevir, a DAA recently approved for clinical use, that incombination with pegylated interferon and ribavirin (peg-IFN/RBV) has a lower sustained virological response (SVR) rate forsubtype 1a than for 1b (2). Simeprevir plus peg-IFN/RBV treat-ment achieves rates of SVR similar to those for peg-IFN/RBVtreatment in HCV-1a-infected patients who present the viral vari-ation Q80K. This variation is frequent in the HCV-1a subtype, butit is not found in HCV-1b (2, 5). Similarly, daclatasvir plus peg-IFN/RBV treatment also achieves higher SVR rates among HCV-1b-infected patients than among HCV-1a-infected individuals(4). For interferon-free regimens, DAA combinations such as asu-naprevir plus daclatasvir may only be indicated for subtype 1b,because of high relapse rates observed among patients with sub-type 1a (3, 4). Because of these, accurate subtyping of HCV geno-type 1-infected patients is needed for those who are candidates forDAAs.Sequencing of specific HCV genome regions with subsequentphylogenetic analysis is considered the gold standard of HCVgenotyping (10). However, it includes several complex techniquesand is time consuming. For these reasons, LiPA 2.0 is currentlyone of the most widely used genotyping assays. However, severalstudies have reported HCV genotyping errors using this commer-cial method (11–13). Those studies were not designed to evaluatethe frequency of HCV-1 subtyping misclassifications, and theyincluded few HCV-1-infected patients. Therefore, due to the highprevalence of HCV-1 infections in western countries and the im-portance of correct subtyping in clinical decisions, the accuracy ofthis method for HCV-1 subtyping needs to be evaluated in largersamples. For these reasons, we aimed to evaluate the accuracy ofLiPA 2.0 for classifying HCV-1 by subtypes.This study was performed according to the ethical guidelines ofthe 1975 Declaration of Helsinki, and it was approved by the ethicscommittee of the Hospital Universitario de Valme (Seville, Spain).The first 110 consecutive patients starting from October 2001,who received a course of peg-IFN/RBV treatment in our hospitaland who were infected with HCV-1, according to the LiPA 2.0determination, were selected. All of them were Caucasian with amedian age (quartile 1 to quartile 3) of 42 years (range, 39 to 46years). Among the patients, 82 (81%) were male, and 48 (47.5%)were infected with HIV.To determine the HCV-1 subtype, we analyzed the entire coregenetic sequence. This region is more conserved than those tradi-tionally used for HCV genotyping (NS5B or core/E1) and allowshigher amplification rates (13, 14). The core region was amplifiedby nested PCRs. The first PCR was performed with 5 l of cDNAusing primers 1 and 2 (Table 1). For the second PCR, 4 l of thefirst PCR product and primers 3 and 4 (Table 1) were used. Forthose samples that were not amplified with this protocol, primers1 and 5 for the LiPA 2.0-identified subtype 1a or primers 1 and 4for subtype 1b were used to perform the external PCR and thenprimers 6 and 7 (1a) or 8 (1b) were used in the internal PCR (Table1). The nested PCR products were bidirectionally sequenced usingstandard capillary electrophoresis techniques. ClustalW2 software(www.ebi.ac.uk/Tools/msa/clustalw2/) was used for alignment ofthe forward and reverse sequenced strains to obtain consensussequences.As the genotyping method, we analyzed the evolutionary his-tory, which was inferred by using the maximum likelihoodmethod based on the general time reversible model. Evolutionaryanalyses were conducted in MEGA5 software (15). The initialtree(s) for the heuristic search was obtained by applying the neigh-bor-joining method to a matrix of pairwise distances estimatedusing the maximum composite likelihood (MCL) approach (15).A discrete gamma distribution was used to model the evolutionaryrate differences among sites (4 categories [G, parameter 0.3742]). The analysis involved 110 sequences, including the se-quences from patient samples and those selected as references. Inthe final data set, there were a total of 573 base pair positionscorresponding to the complete core region for each sample.Received 31 July 2014 Returned for modification 1 August 2014Accepted 13 August 2014Published ahead of print 20 August 2014Editor: Y.-W. TangAddress correspondence to Luis M. Real, lmreal67b@gmail.com.Copyright © 2014, American Society for Microbiology. All Rights Reserved.doi:10.1128/JCM.02209-14November 2014 Volume 52 Number 11 Journal of Clinical Microbiology p. 4027– 4029 jcm.asm.org 4027 on April 26, 2017 by guesthttp://jcm.asm.org/Downloaded from Successful sequencing and genotyping were obtained in 101(91.8%) patients. The 9 (8.2%) samples that were not amplifiedhad a viral load of 3 log IU/ml.According to LiPA 2.0, 58 (57.4%) samples were identified asHCV-1a, and the remaining 43 (42.6%) were identified as HCV-1b. By the sequence-based method, 67 (66.3%) samples were clas-sified as genotype 1a, 33 (32.7%) samples were classified as 1b, and1 (1%) was classified as 4d (Table 2). The overall Cohen kappaindex obtained was 0.773 (95% confidence interval, 0.647 to0.900). The proportion of patients with misclassified HCV-1 sub-types was 11%. All HCV-1 subtype misclassifications were ob-served among individuals identified by LiPA 2.0 as the HCV-1bsubtype. Thus, 10 (23%) patients classified as HCV-1b by LiPA 2.0were identified as HCV-1a by sequencing methods (Table 2). Thesensitivity, specificity, positive predictive value, and negative pre-dictive value for HCV-1b subtyping by LiPA 2.0 were 1, 0.85, 0.77,and 1, respectively. The corresponding numbers for HCV-1a sub-typing were 0.85, 0.97, 0.98, and 0.77, respectively.This is the largest study, to our knowledge, that has analyzedthe accuracy of HCV-1 subtype identification by LiPA 2.0. Thestudy of Avó et al. (11) included a total of 31 HCV-1 samples (ofthem, only 7 were 1b), whereas in the study of Bouchardeau et al.(12), there were a total of 62 HCV-1 samples and only 21 of themwere 1b. In a similar study, HCV-1a-infected patients were notincluded because of the HCV genotype distribution (13).In conclusion, our results show that the LiPA 2.0 assay is not anadequate tool for subtyping HCV genotype 1. This genotypingmethod has subtyping failures, and it is prone to errors with HCVsubtype 1b. Because the HCV subtype 1 misclassification mightlead to inadequate treatment associated with a high likelihood ofnonresponse, more accurate genotyping methods than LiPA 2.0should be used.Nucleotide sequence accession numbers. The sequences ob-tained in this study were submitted to GenBank under accessionnumbers KF060663 to KF060714 and KJ739737 to KJ739786.ACKNOWLEDGMENTSThis work was partially funded by the RD12/0017/0012 project as partof the Plan Nacional RDI and cofinanced by ISCIII-SubdirecciónGeneral de Evaluación y el Fondo Europeo de Desarrollo Regional(FEDER), the Ministerio de Sanidad y Servicios Sociales (EC11-304),and the Fundación para la Investigación y la Prevención del Sida enEspaña (121004/10). J.M. is the recipient of a grant from the ServicioAndaluz de Salud de la Junta de Andalucía (B-0037). J.A.P. is therecipient of an intensification grant from the Instituto de Salud CarlosIII (grant Programa-I3SNS). K.N. is the recipient of a Miguel Servetresearch grant (CP13-00187).These funding institutions did not have any role in the study design orcollection, analysis, or interpretation of the data. They did not participatein the writing of the report or in the decision to submit the paper forpublication.We declare no conflicts of interest.REFERENCES1. Forns X, Lawitz E, Zeuzem S, Gane E, Bronowicki JP, Andreone P,Horban A, Brown A, Peeters M, Lenz O, Ouwerkerk-Mahadevan S,Scott J, Kalmeijer R, De La Rosa G, Sinha R, Beumont-Mauviel M.2013. Simeprevir (TMC435) with peg-interferon -2a/ribavirin for treat-ment of chronic HCV genotype 1 infection in patients who relapsed afterprevious interferon-based therapy: efficacy and safety in patient subpopu-lations in the PROMISE phase III trial. Hepatology 58:737A–738A. http://dx.doi.org/10.1002/hep.26858.2. Jacobson I, Dore GJ, Foster GR, Fried MW, Radu M, Rafalskiy VV,Moroz L, Craxi A, Peeters M, Lenz O, Ouwerkerk-Mahadevan S,Kalmeijer R, Beumont-Mauviel M. 2013. Simeprevir (TMC435) withpeginterferon/ribavirin for chronic HCV genotype 1 infection in treat-ment-naive patients: results from QUEST-1, a phase III trial. J. Hepatol.58(Suppl 1):S574. http://dx.doi.org/10.1016/S0168-8278(13)61424-5.3. Lok AS, Gardiner DF, Hezode C, Lawitz EJ, Bourliere M, Everson GT,Marcellin P, Rodriguez-Torres M, Pol S, Serfaty L, Eley T, Huang SP,Li J, Wind-Rotolo M, Yu F, McPhee F, Grasela DM, Pasquinelli C.2014. Randomized trial of daclatasvir and asunaprevir with or withoutPegIFN/RBV for hepatitis C virus genotype 1 null responders. J. Hepatol.60:490 – 499. http://dx.doi.org/10.1016/j.jhep.2013.10.019.4. Lok AS, Gardiner DF, Lawitz E, Martorell C, Everson GT, Ghalib R,Reindollar R, Rustgi V, McPhee F, Wind-Rotolo M, Persson A, Zhu K,Dimitrova DI, Eley T, Guo T, Grasela DM, Pasquinelli C. 2012. Pre-liminary study of two antiviral agents for hepatitis C genotype 1. N. Engl.J. Med. 366:216 –224. http://dx.doi.org/10.1056/NEJMoa1104430.5. Poordad F, Manns MP, Marcellin P, de Araujo ES, Buti M, HorsmansY, Janczewska E, Villamil F, Peeters M, Lenz O, Ouwerkerk-MahadevanS, Kalmeijer R, Beumont-Mauviel M. 2013. Simeprevir (TMC435) withpeginterferon/ribavirin for treatment of chronic HCV genotype-1 infec-tion in treatment-naive patients: results from QUEST-2, a phase III trial.Gastroenterology 144:S151.6. Sarrazin C, Zeuzem S. 2010. Resistance to direct antiviral agents in pa-tients with hepatitis C virus infection. Gastroenterology 138:447– 462.http://dx.doi.org/10.1053/j.gastro.2009.11.055.7. Schneider MD, Sarrazin C. 2014. Antiviral therapy of hepatitis C in 2014:TABLE 1 Primers used for amplification of the HCV core genePrimer no. Designation Sequence (5= to 3=) Location in genomea1 FAD-ES-Fw CGAAAGGCCTTGTGGTACTG 272 ¡ 2912 FAD-EA-Rv CTCCCGAACGCAGGGCAC 1020 ¢ 1037b3 FAD-IS-Fw TTGTGGTACTGCCTGATAGGGT 281 ¡ 3024 FAD-IA-Rv ATGCTTGAGTTGGAGCAGTCG 956 ¢ 976b5 JLM-Ea-Rv CGCCTCGTACACAATACTCG 970 ¢ 989b6 JLM-Iab-Fw TGTGGTACTGCCTGATAGGG 282 ¡ 3017 JLM-Ia-Rv GGGCAATCATTGGTGACATGG 944 ¢ 964b8 JLM-Ib-Rv TTGGAGCAGTCGTTCGTGAC 948 ¢ 967ba Nucleotide position according to reference sequence H77 (GenBank accession number NC_004102).b Reverse complement sequence with respect to that specified in the reference sequence.TABLE 2 HCV genotyping results obtained with sequence-basedmethods and the LiPA 2.0HCV genotype byLiPA 2.0HCV genotype by coresequence:Total1a 1b 4d1a 57 1 581b 10 33 43Total 67 33 1 101Guelfo et al.4028 jcm.asm.org Journal of Clinical Microbiology on April 26, 2017 by guesthttp://jcm.asm.org/Downloaded from do we need resistance testing? Antiviral Res. 105:64 –71. http://dx.doi.org/10.1016/j.antiviral.2014.02.011.8. Sulkowski MS, Gardiner DF, Rodriguez-Torres M, Reddy KR, Hassa-nein T, Jacobson I, Lawitz E, Lok AS, Hinestrosa F, Thuluvath PJ,Schwartz H, Nelson DR, Everson GT, Eley T, Wind-Rotolo M, HuangSP, Gao M, Hernandez D, McPhee F, Sherman D, Hindes R, SymondsW, Pasquinelli C, Grasela DM. 2014. Daclatasvir plus sofosbuvir forpreviously treated or untreated chronic HCV infection. N. Engl. J. Med.370:211–221. http://dx.doi.org/10.1056/NEJMoa1306218.9. Zeuzem S, Soriano V, Asselah T, Bronowicki JP, Lohse AW, MullhauptB, Schuchmann M, Bourliere M, Buti M, Roberts SK, Gane EJ, SternJO, Vinisko R, Kukolj G, Gallivan JP, Bocher WO, Mensa FJ. 2013.Faldaprevir and deleobuvir for HCV genotype 1 infection. N. Engl. J. Med.369:630 – 639. http://dx.doi.org/10.1056/NEJMoa1213557.10. Robertson B, Myers G, Howard C, Brettin T, Bukh J, Gaschen B,Gojobori T, Maertens G, Mizokami M, Nainan O, Netesov S, NishiokaK, Shin I, Simmonds TP, Smith D, Stuyver L, Weiner A. 1998. Classi-fication, nomenclature, and database development for hepatitis C virus(HCV) and related viruses: proposals for standardization. InternationalCommittee on Virus Taxonomy. Arch. Virol. 143:2493–2503.11. Avó AP, Agua-Doce I, Andrade A, Padua E. 2013. Hepatitis C virussubtyping based on sequencing of the C/E1 and NS5B genomic regions incomparison to a commercially available line probe assay. J. Med. Virol.85:815– 822. http://dx.doi.org/10.1002/jmv.23545.12. Bouchardeau F, Cantaloube JF, Chevaliez S, Portal C, Razer A, LefrereJJ, Pawlotsky JM, De Micco P, Laperche S. 2007. Improvement ofhepatitis C virus (HCV) genotype determination with the new version ofthe INNO-LiPA HCV assay. J. Clin. Microbiol. 45:1140 –1145. http://dx.doi.org/10.1128/JCM.01982-06.13. Cai Q, Zhao Z, Liu Y, Shao X, Gao Z. 2013. Comparison of threedifferent HCV genotyping methods: core, NS5B sequence analysis andline probe assay. Int. J. Mol. Med. 31:347–352.14. Simmonds P, Smith DB, McOmish F, Yap PL, Kolberg J, Urdea MS,Holmes EC. 1994. Identification of genotypes of hepatitis C virus bysequence comparisons in the core, E1 and NS-5 regions. J. Gen. Virol.75(Part 5):1053–1061. http://dx.doi.org/10.1099/0022-1317-75-5-1053.15. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011.MEGA5: molecular evolutionary genetics analysis using maximum likeli-hood, evolutionary distance, and maximum parsimony methods. Mol.Biol. Evol. 28:2731–2739. http://dx.doi.org/10.1093/molbev/msr121.LiPA 2.0 and HCV-1 SubtypingNovember 2014 Volume 52 Number 11 jcm.asm.org 4029 on April 26, 2017 by guesthttp://jcm.asm.org/Downloaded from 

English

http://ri.conicet.gov.ar/bitstream/11336/15782/1/CONICET_Digital_Nro.1.pdf

Reassessment of genotype 1 hepatitis c virus subtype misclassification by LiPA 2.0: implications for direct-acting antiviral treatment

Abstract

Similar works

Full text

Available Versions

Crossref

CONICET Digital

LAReferencia - Red Federada de Repositorios Institucionales de Publicaciones Científicas Latinoamericanas