The ichneumonid wasp Venturia canescens (Hymenoptera) has been studied extensively for foraging behaviour and population dynamics of sexually (arrhenotokous) and parthenogenetically (thelytokous) reproducing individuals. Here we report the development of a set of microsatellite markers for V.canescens and use them to show that arrhenotokous individuals have more genetic variability than thelytokous ones, which are even homozygous for all tested loci. Crosses between arrhenotokous individuals suggested one marker, Vcan071, to be linked with the Complementary Sex Determiner (CSD) locus and one, Vcan109, with the Virus Like Protein (vlp-p40) locus. The genome size of V. canescens was estimated to be 274–279 Mb. We discuss how both reproductive modes can give rise to the observed genetic variability and how the new markers can be used for future genetic studies of V. canescens

Beukeboom, Leo W.

Ferber, Steven

Mateo Leach, Irene

van de Zande, Louis

English

PubMed

Irene Mateo Leach

Steven Ferber

Louis van de Zande

Leo W. Beukeboom

Springer - Publisher Connector

Genetic variability of arrhenotokous and thelytokous Venturia canescens (Hymenoptera)

The ichneumonid wasp Venturia canescens (Hymenoptera) has been studied extensively for foraging behaviour and population dynamics of sexually (arrhenotokous) and parthenogenetically (thelytokous) reproducing individuals. Here we report the development of a set of microsatellite markers for V.canescens and use them to show that arrhenotokous individuals have more genetic variability than thelytokous ones, which are even homozygous for all tested loci. Crosses between arrhenotokous individuals suggested one marker, Vcan071, to be linked with the Complementary Sex Determiner (CSD) locus and one, Vcan109, with the Virus Like Protein (vlp-p40) locus. The genome size of V. canescens was estimated to be 274-279 Mb. We discuss how both reproductive modes can give rise to the observed genetic variability and how the new markers can be used for future genetic studies of V. canescens

NARCIS 

The ichneumonid wasp Venturia canescens (Hymenoptera) has been studied extensively for foraging behaviour and population dynamics of sexually (arrhenotokous) and parthenogenetically (thelytokous) reproducing individuals. Here we report the development of a set of microsatellite markers for V.canescens and use them to show that arrhenotokous individuals have more genetic variability than thelytokous ones, which are even homozygous for all tested loci. Crosses between arrhenotokous individuals suggested one marker, Vcan071, to be linked with the Complementary Sex Determiner (CSD) locus and one, Vcan109, with the Virus Like Protein (vlp-p40) locus. The genome size of V. canescens was estimated to be 274-279 Mb. We discuss how both reproductive modes can give rise to the observed genetic variability and how the new markers can be used for future genetic studies of V. canescens.</p

Proceedings - University of Groningen

   University of GroningenGenetic variability of arrhenotokous and thelytokous Venturia canescens (Hymenoptera)Mateo Leach, Irene; Ferber, Steven; van de Zande, Louis; Beukeboom, Leo W.Published in:GeneticaDOI:10.1007/s10709-012-9657-6IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.Document VersionPublisher's PDF, also known as Version of recordPublication date:2012Link to publication in University of Groningen/UMCG research databaseCitation for published version (APA):Mateo Leach, I., Ferber, S., van de Zande, L., & Beukeboom, L. W. (2012). Genetic variability ofarrhenotokous and thelytokous Venturia canescens (Hymenoptera). Genetica, 140(1-3), 53-63.https://doi.org/10.1007/s10709-012-9657-6CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.Download date: 09-09-2023SOM Table 1. Summary of samples used in this study. Indicated is the transect location number from SOM Figure 1, location name, collection year, reproductive mode, sample name and in which analysis the sample was used. A = arrhenotokous, T = thelytokous. Transect location  Location Collection Year Mode Sample Microsatellite data Mitochondrial data Côte d’Azur (France)       2 Belvre l'Èze 1997 A Bl'E A 97 + + 4 Cagnes sur Mer 1997 A CsM A 97 + + 3 Cap d'Antibes INRA 1997 A Cd'AI A 97 + + 6 Eze 1997 A Eze A 98 + + 5 Gothéron INRA 1997 A Got A 97 + + 12 Mont Boron 1997 A MtB A 97 + + 14 Panoramèr 1997 A Pmer A 97 + +   1997 A PdC A 97 + + 15 Saint Jan 1997 A StJ A 97 + + 13 Saint Laurent 1997 A StL A 97 + +   1997 A SV A 97 + + 18 Vallauris 1997 A Vala A 98 + + 26 Villefranche 1997 A VF A 98 + + 1 Anthéor 1998 A Anth A 98 + + 7 La Brague 1998 A LB A 98 + + 23 La Vallée Verte 1998 A VV A 98 - + 27 Mont Gros 1998 A MtG A 98 + - 28 Mont Vinagrier 1998 A MtV A 98 + - 14 Panoramèr 1998 A Pm A 98 + + 19 Saint Guitte 1998 A StG A 98 + + 3 Antibes Botanique 2003 A Ant Bot A 03 + + 12 Mont Boron 2003 A MtB A 03 + + 1 Anthéor 1997 T Anth T 97 + + 14 Panoramèr 1997 T Pmer T 97 + + 18 Vallauris 1997 T Val T 97 + + 3 Antibes Botanique 2003 T Ant Bot T 03 + + 12 Mont Boron 2003 T MtB T 03 + + 24 Valbonne 2003 T Valb T 03 + + Costa Blanca (Spain)        San Juan de Alicante 2003 T SJ T 03 + + SOM Table 2. Overview of microsatellite markers of Venturia canescens. Size: expected size of the sequenced allele (bp); Repeat motif: repeat comprised between the primers; Tm: annealing temperature (ºC); Primer sequences: forward and reverse 5’-3’ primer sequence. Alleles: allele sizes observed; NA: the number of alleles per locus. na: not amplified Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  NA Thelytokous  Alleles  NA            Vcan060 GU053668 244 (GA)9 58 F: GGAGTTACTGAAGGCAAACAAGG 253 247 2 247 249 2      R: AATGACTGAACGGGACTCGAT     Vcan061 GU053669 186 (CT)13 55 F: TACGGTACTGAGAGATGTGTGGA 178 184 188 190 192 194 200 7 188 190 2      R: TCGGTTAGAAGTGAGACCTGAAC     Vcan062 GU053670 254 (CT)8 55 F: TGACTCCCTATGCACTTCTTCTC 250 254 260 266 4 250 256 2      R: GAAGGTGTCGAGATATGGTGAAC     Vca GU05 17(AG) 5 F CGTATACTCACGCA 174 178 182 184 186 5 168 182 2 n063 3671 9 39 5 : CACACAAAG      R: CTTGACGATATGGGTTGATGG     Vcan064 GU053672 288 Complex* 55 F: GTTGCTAACTTCGAGGACAGACT 277 280 283 286 289 295 6 289 1      R: AGTAGTAACGTTCGATGGCAGAG     Vcan065 GU053673 218 (TGC)15 55 F: TCATTGTCACTGGTCGGTGT 200 209 212 215 218 221 224 227 230 233 236  11 215 221 227 3      R: GATCATAGGCAACAGCAGCA     Vcan066 GU053674 245 (CTTT)11 55 F: GATACCAGACTCGAGATCTATTCAA 238 240 242 244 248 250 252 260 8 244 248 2      R: CGACCGACAATCAAGGTTTT     Vcan067 GU053675 155 (CAA)26 55 F: ATGGTTCAGCAGCAACATCA 139 142 151 154 157 160 6 148 151 154 157  4      R: GTTCCCTTGTAAAGCGGATG     Vcan068 GU053676 155 (TTCG)21 58 F: TCCCGACTTTCTCACTCCTC 141 161 165 169 177 5 na Na      R: AGGAAGGAAGGAACGAAGGA     Vcan069 GU053677 228 (AAC)45 55 F: GAATGAGGATCAGCAAAATCG 199 218 220 223 226 229 6 229 1      R: GATGGCAGAGCAACTCGTTT     Vcan070 GU053678 228 (GCT)10 55 F: TGCTCGCCCTTTTCTTTATT 212 215 221 224 227 5 227 230 2      R: CATCTGCCACGACTCTCAAG     Vcan071 GU053679 232 (CAA)11 55 F: CTCCTACGCACTCCCTTCAC 228 231 234 237 240 243 246 252 8 222 225 231 243 4      R: TTGTACGTTGGCACTTGAGC     * (CAA) CAG (CAA)8 CAG (CAA) CAG (CAA)4 CAG CAT (CAA)4 CCA (CAA)2 (CAG)4 (CAA) CAG (CAA)2 CAC (CAG)2 CAA CAG (CAA)3 CCA SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan072 GU053680 196 (GAC)14 55 F: TGAATTTGTCGTTGCTGCTC 200 203 2 na Na      R: CGAGGAAGTTCAGGCTCAAG     Vcan073 GU053681 244 (TGT)15 60 F: GGTCCAACGGTACTTCCTGA 206 224 245 248 254 260  6 242 245 248 3      R: ACTTCCGTCAGCCCTACCTT     Vcan074 GU053682 198 (AGA)8 61 F: CCGAAGCTGAAGAAATCGAA 200 1 Na na      R: CTACAGAGAGGGGCAAATCG     Vcan075 GU053683 193 (CAA)10 60 F: TCGTCGGATCAACACAATTT 193 1 190 193 2      R: TCAAGAATTCGGGAACATCC     Vcan076 GU053684 154 (TGA)16 60 F: TTGACGCCGTCGAACTAATA 156 1 na Na      R: GTGAAACTGGAGCCTTTGGA     Vcan0 GU053 19 (GAC) 62 F GGTGGATTGACGTGC 196 1 193 196 2 77 685 5 3 : CTTAT      R: CCCTCCCCACTTCTCTCTTT     Vcan078 GU053686 170 (ATT)5 61 F: AGGTGATGTTAGGCGGTTTG 168 171 2 168 1      R: TTTTCGCGGGTTTTGTTTAC     Vcan079 GU053687 157 (GA)15 61 F: AGGAACGCAAAATGAAATGG 146 156 158 3 154 160 2      R: TCGTTCGAACTTTTCCCCTA     Vcan080 GU053688 181 (AGG)6 63 F: TCCATCTTCGCTCTTTTTCC 181 1 181 1      R: CTTTCTCTTCGCGCTCACTT     Vcan081 GU053689 249 (TGC)6 60 F: GCTAGACTCCACGGCTACCA 251 1 Na na      R: CAATAAGGGGCAATTCGTGA     Vcan082 GU053690 169 (CAA)8 63 F: GCAACTCCTGCAACAACAGA 169 1 169 172 1      R: GTGATGAGGGTAGCCGATGT     Vcan083 GU053691 250 (TGA)11 60 F: ATAGCTCATCGCTCCTCTGC 241 244 247  3 241 247 250 3      R: CGCCCATCTTGTGCTTATGT     Vcan084 GU053692 250 (AGA)7 60 F: ACTCGATTTGCGTGGAAAAA 250 1 na Na      R: TTTCGCTTGTTGCTGAGTTC     Vcan085 GU053693 199 (TTC)8 53 F: AGGTTCAATGGCTTTGCTGT 146 161 197 200 4 197 200 21      R: GCTTTCCGAGCTTTTCCTCT     Vcan086 GU053694 244 (AC)24 60 F: AGCAAACGGGACTTGAATTG 245 1 na na      R: GGGACTCCAAACCCTCTTGT     SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan087 GU053695 165 (GT)23 55 F: CTTCTAGCTCCGTCGGTGTC 165 1 165 1      R: CGGTGGTTGTTGTCGAGTTA     Vcan088 GU053696 198 (CA)44 60 F: AGTAACCGGTCAGCCTTTGG 132 136 142 144 4 132 134 136 142  4      R: CACGTTCCAATTTCCACACA     Vcan089 GU053697 234 (TC)33 50 F: GGCCATGTTTCCTACTTCCA 190 1 na na      R: GGCGGAAAGATTTTTCGATAG     Vcan090 GU053698 243 (CT)37 55 F: ATGCGGATGCGTAAGGATAG 251 1 na na      R: GCTGCTTAACGTTTCGGTCT     Vcan091 GU053699 184 (GA)32 60 F: GTAGGCACGTACCGAGGAAA 158 170 174 186 4 154 158 2      R: TCCACGCTCGTGTGTGTACT     Vcan092 GU053700 210 (TTCC)6 60 F: CGTTCGTTCTTTCGTTCGTT 208 212 216 220 4 212 216 220 3      R: CGGCATTGTCCTTCTTGTTT     Vcan0 GU053 20 (TC)2 50 F CTACCAGCACGAGAA 201 1 na na 93 701 1 1 : GCTGA      R: TTTCTCGGTGCTTCTCCACT     Vcan094 GU053702 152 (CT)26 60 F: ACGATCGCTCAATCGAAGTT 156 158 2 154 156 2      R: CTCCCATAAACTCGGAGCAA     Vcan095 GU053703 100 (CA)24 50 F: GTAATCATTTTCGCTCCGTGA 080 092 096 3 na na      R: TCGTTTCTCTTTTCGTTCGAG     Vcan096 GU053704 175 (AG)39 55 F: CTCACGCACACACAAAGTCC 172 176 178 3 176 1      R: TGCTTGACGATATGGGTTGA     Vcan097 GU053705 140 (GA)15 55 F: AATGGAGACAACGAGGCAAC 140 142 144 3 140 142 152 3      R: ATCAGAGTCGACCCAGCAAC     Vcan098 GU053706 233 (GT)15 50 F: CAATTCGGAAACACTGCAAA 233 1 na na      R: CCGCTCGATCTTTTCATTTC     Vcan099 GU053707 123 (AG)12 55 F: TGGCCATAACAGGGAGAAAG 126 128 130 138 4 126 1      R: GTCACTGGGGAAGAGTGGTG     Vcan100 GU053708 224 (GA)12 60 F: ACGGTCAAGTTACCCAAGCA 215 1 na na      R: GACCAAGCTCCGGATAAACA     Vcan101 GU053709 200 (CT)15 45 F: ATCTGGACTAAGCGCGAGAG 190 1 na na      R: CAACGAGAGGGAAAGAGACG     SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan102 GU053710 174 (TC)14 60 F: TTCCAATTCACGAATCAACG 161 165 169 175 4 161 169 172 175 177 5      R: CCTCTGAGTCACCGAAAAGC     Vcan103 GU053711 206 (TC)10 48 F: CTCAAGCTATGCATCCAACG 154 1 na na      R: TCTCGGAGTCAATCCCACTC     Vcan104 GU053712 164 (GA)14 55 F: CAAAAGGGAGGGAAAGGAAG 164 1 na na      R: CCCACGTTTTCGGTGTACTT     Vcan105 GU053713 188 (TC)15 48 F: TGGGCAATTACCCCACTAAA 156 1 na na      R: GCACGTGCAATTCTGATGAC     Vcan106 GU053714 197 (TC)24 60 F: CCTCATCTCGAGGGAGGATT 190 196 206 208 210 214 224 7 186 188 190 194 210 5      R: ATCGCGAGTTGCGTAGTTTC     Vcan107 GU053715 282 (AC)13 60 F: GTCGCCGGCTCATATTTTTA 283 1 na na      R: AGCAAGTCTGCGATCTTTCC     Vcan108 GU053716 188 (TC)24 50 F: GGATACACGAACCTGGCATT 190 1 na na      R: AGACCGAGAGAGGAGGAAGG     Vcan109 GU053717 192 (AG)10 60 F: TTAATTGAACGGGGAAAACG 189 191 193 3 193 1      R: GCAGTCGGTGTAGCGTGTTA     Vcan110 GU053718 172 (AC)25 55 F: CCATTCATTCGGATCTCACC 172 174 2 172 1      R: CCGACGTTTGTATCTTCGTTC     Vcan111 GU053719 264 (ACC)12 55 F: CCACACGAACAATGTCAAT 264 1 na na      R: CCGTTTTTATGAGCGTAGAG     Vcan112 GU053720 159 (TC)15 55 F: GCAGAGATTTTTGCCACAGG 143 147 149 151 161 172 176 178 8 143 149 161 3      R: TGGCTGGATGAAGGGATATT     Vcan113 GU053721 199 (GA)11 55 F: TTCAGGGAGGATAGAACGTA 199 1 199 1      R: TCTCTCTCCTTCCCTTTCTC     Vcan114 GU053722 241 (AG)10 55 F: AAAAATGAACGACAGAAGGA 237 241 245 247 251 5  243 1      R: GTTGCGCTCTTTGTGAATA     Vcan115 GU053723 106 (CT)11 55 F: TTTTTCACTCTTCGTTCCTC 096 104 106 124 4 104 110 2      R: TGCTACCCTCTTGATCTCC     SOM Table 3. Recombination between the csd locus and microsatellite marker Vcan071 from a cross between a heterozygous female and a hemizygous male with a matched allele for the marker. Diploid males are significantly more often homozygous for Vcan071. genotype Heterozygous Vcan071 Homozygous Vcan071 P 2n females 6 8  2n males 3 14 0.01<P<0.025 SOM Table 4. Linkage between the vlp-p40 locus (alleles + and -) and microsatellite marker Vcan109 (alleles m=maternal and p=paternal)  vlp Vcan109 + - total m 38 2 40 p 1 23 24 total 39 25 64 X2=48,246, df=1, p<0.0001, N=64 SOM Table 5 Genotyping raw data for 15 polymorphic microsatellites of the 29 field collected strains used in this study. Indv Location Year Vcan061 Vcan062 Vcan063 Vcan064 Vcan065 Vcan066 Vcan067 Vcan069 Vcan070 Vcan071 Vcan097 Vcan109 Vcan110 Vcan112 Vcan114   Arrhenotokous 1 Bl'E 1997 188190 254 182184 286 230233 240252 0 223226 224 0 142 0 0 143149 0 2 StJ 1997 190192 254266 182 286 209218 248 142154 226 220223 0 140 189 0 143 241251 3 Cd'Al 1997 188190 250 182184 280286 227236 240244 0 220226 224 228234 140 0 172 143149 247251 4 StL 1997 188190 250266 182 286295 233 240244 157 0 224 228234 140 189191 172 143 247 5 CsM 1997 184 250266 0 286 224233 244 157 226 215 0 140142 189191 172 143149 247 6 SV 1997 190200 260266 174184 286 215230 252260 151 226 224 0 140142 189 0 149 241 7 Got 1997 190200 260266 0 280286 212230 240244 151 0 224 231 142 191 172 149161 237241 8 Mt.B 1997 188190 250260 182 283289 218221 240 154160 223229 0 234 140 191193 0 143149 241 9 PdC 1997 188190 250254 182184 286289 209233 240 142 226229 0 234 140 189191 174 143 247 10 Pmer 1997 188190 250254 182 286 212227 240244 0 226 220223 0 140144 189193 172 143149 241247 11 Eze 1998 188200 250266 182184 277286 218 240244 142160 217226 223226 237 140142 191 172 143 247 12 LB 1998 178 250266 182 283286 221227 240244 157 223226 224 0 140144 191 172 143 241247 13 MtG 1998 188 266 182 286 209212 240244 157 226 0 237243 0 189191 172 143 241247 14 MtV 1998 188190 250266 182 280286 209218 240252 139 220226 223 0 140142 191193 174 147161 247251 15 Anth 1998 188 266 182186 286 230 244 142 226 212220 234 140142 189191 172 143 241 16 Pm 1998 190 260266 182186 286 218230 240244 142154 226 212220 0 140 189191 172 143 241247 17 StG 1998 188190 266 182 286 212227 240244 0 0 220223 234 140 191 172 143 241 18 Vala 1998 190 250266 182186 283286 215224 240260 0 223226 222 246 140142 191 172 143 247 19 VF 1998 190194 250 182186 286 209227 240244 154157 226 220223 246 140 189193 172 143 0 20 VV 1998 0 0 0 0 0 0 0 0 222 0 0 0 0 0 0 21 Ant Bot 2003 188 250260 182184 286 212227 240 139154 226 222 240 140 191193 172 143 241 22 MtB 2003 188190 266 182 283286 200227 244 154160 223226 224 0 140 189191 172 143 241247   Thelytokous 23 Anth 1997 188 256 182 289 221 248 157 229 0 231 142 193 172 161 243 24 Pmer 1997 188 256 182 289 221 248 157 229 227 231 142 193 0 161 243 25 Val 1997 188 256 182 286 221 248 157 229 230 0 142 193 172 0 243 26 Ant Bot 2003 188 256 182 289 221 248 157 229 230 231 142 193 172 161 243 2 Valb 2003 188 256 182 289 221 248 157 0 230 231 142 193 172 161 243 7 28 MtB 2003 188 256 182 289 221 248 157 229 230 231 142 193 172 161 243 29 SJ 2003 190 250 182 0 215 244 151 229 227 243 152 193 172 161 0 SOM Table 6. Observed allele frequencies in arrhenotokous and thelytokous females for 15 microsatellites. N designates de number of individuals tested of each reproductive mode. Locus Alleles Arrhenotokous Thelytokous  Locus Alleles Arrhenotokous Thelytokous Vcan61 N 21 7  Vcan69  18 6  178 0.048 0   217 0.028 0  184 0.048 0   220 0.056 0  188 0.381 0.857   223 0.139 0  190 0.405 0.143   226 0.722 0  192 0.024 0   229 0.056 1  194 0.024 0  Vcan70  19 6  200 0.071 0   212 0.053 0 Vcan62  21 7   215 0.053 0  250 0.333 0.143   221 0.316 0  254 0.119 0   224 0.553 0  256 0 0.857   227 0.026 0.333  260 0.119 0   230 0 0.667  266 0.429 0  Vcan71  12 6 Vcan63  19 7   228 0.083 0  174 0.026 0   231 0.083 0.833  182 0.711 1   234 0.417 0  184 0.158 0   237 0.125 0  186 0.105 0   240 0.083 0 Vcan64  21 6   243 0.042 0.167  277 0.024 0   246 0.167 0  280 0.071 0  Vcan97  20 7  283 0.095 0   140 0.700 0  286 0.738 0.167   142 0.250 0.857  289 0.048 0.833   144 0.050 0  295 0.024 0   152 0 0.143 Vcan65  21 7  Vcan109  19 7  200 0.024 0   189 0.342 0  209 0.119 0   191 0.526 0  212 0.119 0   193 0.132 1  215 0.048 0.143  Vcan110  17 6  218 0.143 0   172 0.882 1  221 0.048 0.857   174 0.118 0  224 0.048 0  Vcan112  21 6  227 0.167 0   143 0.738 0  230 0.143 0   147 0.024 0  233 0.119 0   149 0.190 0  236 0.024 0   161 0.048 1 Vcan66  21 7  Vcan114  19 6  240 0.452 0   237 0.026 0  244 0.381 0.143   241 0.447 0  248 0.048 0.857   243 0 1  252 0.071 0   247 0.447 0  260 0.048 0   251 0.079 0 Vcan67  16 7       139 0.094 0       142 0.219 0       151 0.125 0.143       154 0.188 0       157 0.281 0.857       160 0.094 0       

Genetic variability of arrhenotokous and thelytokous <i>Venturia canescens</i> (Hymenoptera)

ARTS repository - University of Groningen

   University of GroningenGenetic variability of arrhenotokous and thelytokous Venturia canescens (Hymenoptera)Mateo Leach, Irene; Ferber, Steven; van de Zande, Louis; Beukeboom, Leo W.Published in:GeneticaDOI:10.1007/s10709-012-9657-6IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.Document VersionPublisher's PDF, also known as Version of recordPublication date:2012Link to publication in University of Groningen/UMCG research databaseCitation for published version (APA):Mateo Leach, I., Ferber, S., van de Zande, L., & Beukeboom, L. W. (2012). Genetic variability ofarrhenotokous and thelytokous Venturia canescens (Hymenoptera). Genetica, 140(1-3), 53-63.https://doi.org/10.1007/s10709-012-9657-6CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.Download date: 07-06-2022SOM Table 1. Summary of samples used in this study. Indicated is the transect location number from SOM Figure 1, location name, collection year, reproductive mode, sample name and in which analysis the sample was used. A = arrhenotokous, T = thelytokous. Transect location  Location Collection Year Mode Sample Microsatellite data Mitochondrial data Côte d’Azur (France)       2 Belvre l'Èze 1997 A Bl'E A 97 + + 4 Cagnes sur Mer 1997 A CsM A 97 + + 3 Cap d'Antibes INRA 1997 A Cd'AI A 97 + + 6 Eze 1997 A Eze A 98 + + 5 Gothéron INRA 1997 A Got A 97 + + 12 Mont Boron 1997 A MtB A 97 + + 14 Panoramèr 1997 A Pmer A 97 + +   1997 A PdC A 97 + + 15 Saint Jan 1997 A StJ A 97 + + 13 Saint Laurent 1997 A StL A 97 + +   1997 A SV A 97 + + 18 Vallauris 1997 A Vala A 98 + + 26 Villefranche 1997 A VF A 98 + + 1 Anthéor 1998 A Anth A 98 + + 7 La Brague 1998 A LB A 98 + + 23 La Vallée Verte 1998 A VV A 98 - + 27 Mont Gros 1998 A MtG A 98 + - 28 Mont Vinagrier 1998 A MtV A 98 + - 14 Panoramèr 1998 A Pm A 98 + + 19 Saint Guitte 1998 A StG A 98 + + 3 Antibes Botanique 2003 A Ant Bot A 03 + + 12 Mont Boron 2003 A MtB A 03 + + 1 Anthéor 1997 T Anth T 97 + + 14 Panoramèr 1997 T Pmer T 97 + + 18 Vallauris 1997 T Val T 97 + + 3 Antibes Botanique 2003 T Ant Bot T 03 + + 12 Mont Boron 2003 T MtB T 03 + + 24 Valbonne 2003 T Valb T 03 + + Costa Blanca (Spain)        San Juan de Alicante 2003 T SJ T 03 + + SOM Table 2. Overview of microsatellite markers of Venturia canescens. Size: expected size of the sequenced allele (bp); Repeat motif: repeat comprised between the primers; Tm: annealing temperature (ºC); Primer sequences: forward and reverse 5’-3’ primer sequence. Alleles: allele sizes observed; NA: the number of alleles per locus. na: not amplified Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  NA Thelytokous  Alleles  NA            Vcan060 GU053668 244 (GA)9 58 F: GGAGTTACTGAAGGCAAACAAGG 253 247 2 247 249 2      R: AATGACTGAACGGGACTCGAT     Vcan061 GU053669 186 (CT)13 55 F: TACGGTACTGAGAGATGTGTGGA 178 184 188 190 192 194 200 7 188 190 2      R: TCGGTTAGAAGTGAGACCTGAAC     Vcan062 GU053670 254 (CT)8 55 F: TGACTCCCTATGCACTTCTTCTC 250 254 260 266 4 250 256 2      R: GAAGGTGTCGAGATATGGTGAAC     Vca GU05 17(AG) 5 F CGTATACTCACGCA 174 178 182 184 186 5 168 182 2 n063 3671 9 39 5 : CACACAAAG      R: CTTGACGATATGGGTTGATGG     Vcan064 GU053672 288 Complex* 55 F: GTTGCTAACTTCGAGGACAGACT 277 280 283 286 289 295 6 289 1      R: AGTAGTAACGTTCGATGGCAGAG     Vcan065 GU053673 218 (TGC)15 55 F: TCATTGTCACTGGTCGGTGT 200 209 212 215 218 221 224 227 230 233 236  11 215 221 227 3      R: GATCATAGGCAACAGCAGCA     Vcan066 GU053674 245 (CTTT)11 55 F: GATACCAGACTCGAGATCTATTCAA 238 240 242 244 248 250 252 260 8 244 248 2      R: CGACCGACAATCAAGGTTTT     Vcan067 GU053675 155 (CAA)26 55 F: ATGGTTCAGCAGCAACATCA 139 142 151 154 157 160 6 148 151 154 157  4      R: GTTCCCTTGTAAAGCGGATG     Vcan068 GU053676 155 (TTCG)21 58 F: TCCCGACTTTCTCACTCCTC 141 161 165 169 177 5 na Na      R: AGGAAGGAAGGAACGAAGGA     Vcan069 GU053677 228 (AAC)45 55 F: GAATGAGGATCAGCAAAATCG 199 218 220 223 226 229 6 229 1      R: GATGGCAGAGCAACTCGTTT     Vcan070 GU053678 228 (GCT)10 55 F: TGCTCGCCCTTTTCTTTATT 212 215 221 224 227 5 227 230 2      R: CATCTGCCACGACTCTCAAG     Vcan071 GU053679 232 (CAA)11 55 F: CTCCTACGCACTCCCTTCAC 228 231 234 237 240 243 246 252 8 222 225 231 243 4      R: TTGTACGTTGGCACTTGAGC     * (CAA) CAG (CAA)8 CAG (CAA) CAG (CAA)4 CAG CAT (CAA)4 CCA (CAA)2 (CAG)4 (CAA) CAG (CAA)2 CAC (CAG)2 CAA CAG (CAA)3 CCA SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan072 GU053680 196 (GAC)14 55 F: TGAATTTGTCGTTGCTGCTC 200 203 2 na Na      R: CGAGGAAGTTCAGGCTCAAG     Vcan073 GU053681 244 (TGT)15 60 F: GGTCCAACGGTACTTCCTGA 206 224 245 248 254 260  6 242 245 248 3      R: ACTTCCGTCAGCCCTACCTT     Vcan074 GU053682 198 (AGA)8 61 F: CCGAAGCTGAAGAAATCGAA 200 1 Na na      R: CTACAGAGAGGGGCAAATCG     Vcan075 GU053683 193 (CAA)10 60 F: TCGTCGGATCAACACAATTT 193 1 190 193 2      R: TCAAGAATTCGGGAACATCC     Vcan076 GU053684 154 (TGA)16 60 F: TTGACGCCGTCGAACTAATA 156 1 na Na      R: GTGAAACTGGAGCCTTTGGA     Vcan0 GU053 19 (GAC) 62 F GGTGGATTGACGTGC 196 1 193 196 2 77 685 5 3 : CTTAT      R: CCCTCCCCACTTCTCTCTTT     Vcan078 GU053686 170 (ATT)5 61 F: AGGTGATGTTAGGCGGTTTG 168 171 2 168 1      R: TTTTCGCGGGTTTTGTTTAC     Vcan079 GU053687 157 (GA)15 61 F: AGGAACGCAAAATGAAATGG 146 156 158 3 154 160 2      R: TCGTTCGAACTTTTCCCCTA     Vcan080 GU053688 181 (AGG)6 63 F: TCCATCTTCGCTCTTTTTCC 181 1 181 1      R: CTTTCTCTTCGCGCTCACTT     Vcan081 GU053689 249 (TGC)6 60 F: GCTAGACTCCACGGCTACCA 251 1 Na na      R: CAATAAGGGGCAATTCGTGA     Vcan082 GU053690 169 (CAA)8 63 F: GCAACTCCTGCAACAACAGA 169 1 169 172 1      R: GTGATGAGGGTAGCCGATGT     Vcan083 GU053691 250 (TGA)11 60 F: ATAGCTCATCGCTCCTCTGC 241 244 247  3 241 247 250 3      R: CGCCCATCTTGTGCTTATGT     Vcan084 GU053692 250 (AGA)7 60 F: ACTCGATTTGCGTGGAAAAA 250 1 na Na      R: TTTCGCTTGTTGCTGAGTTC     Vcan085 GU053693 199 (TTC)8 53 F: AGGTTCAATGGCTTTGCTGT 146 161 197 200 4 197 200 21      R: GCTTTCCGAGCTTTTCCTCT     Vcan086 GU053694 244 (AC)24 60 F: AGCAAACGGGACTTGAATTG 245 1 na na      R: GGGACTCCAAACCCTCTTGT     SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan087 GU053695 165 (GT)23 55 F: CTTCTAGCTCCGTCGGTGTC 165 1 165 1      R: CGGTGGTTGTTGTCGAGTTA     Vcan088 GU053696 198 (CA)44 60 F: AGTAACCGGTCAGCCTTTGG 132 136 142 144 4 132 134 136 142  4      R: CACGTTCCAATTTCCACACA     Vcan089 GU053697 234 (TC)33 50 F: GGCCATGTTTCCTACTTCCA 190 1 na na      R: GGCGGAAAGATTTTTCGATAG     Vcan090 GU053698 243 (CT)37 55 F: ATGCGGATGCGTAAGGATAG 251 1 na na      R: GCTGCTTAACGTTTCGGTCT     Vcan091 GU053699 184 (GA)32 60 F: GTAGGCACGTACCGAGGAAA 158 170 174 186 4 154 158 2      R: TCCACGCTCGTGTGTGTACT     Vcan092 GU053700 210 (TTCC)6 60 F: CGTTCGTTCTTTCGTTCGTT 208 212 216 220 4 212 216 220 3      R: CGGCATTGTCCTTCTTGTTT     Vcan0 GU053 20 (TC)2 50 F CTACCAGCACGAGAA 201 1 na na 93 701 1 1 : GCTGA      R: TTTCTCGGTGCTTCTCCACT     Vcan094 GU053702 152 (CT)26 60 F: ACGATCGCTCAATCGAAGTT 156 158 2 154 156 2      R: CTCCCATAAACTCGGAGCAA     Vcan095 GU053703 100 (CA)24 50 F: GTAATCATTTTCGCTCCGTGA 080 092 096 3 na na      R: TCGTTTCTCTTTTCGTTCGAG     Vcan096 GU053704 175 (AG)39 55 F: CTCACGCACACACAAAGTCC 172 176 178 3 176 1      R: TGCTTGACGATATGGGTTGA     Vcan097 GU053705 140 (GA)15 55 F: AATGGAGACAACGAGGCAAC 140 142 144 3 140 142 152 3      R: ATCAGAGTCGACCCAGCAAC     Vcan098 GU053706 233 (GT)15 50 F: CAATTCGGAAACACTGCAAA 233 1 na na      R: CCGCTCGATCTTTTCATTTC     Vcan099 GU053707 123 (AG)12 55 F: TGGCCATAACAGGGAGAAAG 126 128 130 138 4 126 1      R: GTCACTGGGGAAGAGTGGTG     Vcan100 GU053708 224 (GA)12 60 F: ACGGTCAAGTTACCCAAGCA 215 1 na na      R: GACCAAGCTCCGGATAAACA     Vcan101 GU053709 200 (CT)15 45 F: ATCTGGACTAAGCGCGAGAG 190 1 na na      R: CAACGAGAGGGAAAGAGACG     SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan102 GU053710 174 (TC)14 60 F: TTCCAATTCACGAATCAACG 161 165 169 175 4 161 169 172 175 177 5      R: CCTCTGAGTCACCGAAAAGC     Vcan103 GU053711 206 (TC)10 48 F: CTCAAGCTATGCATCCAACG 154 1 na na      R: TCTCGGAGTCAATCCCACTC     Vcan104 GU053712 164 (GA)14 55 F: CAAAAGGGAGGGAAAGGAAG 164 1 na na      R: CCCACGTTTTCGGTGTACTT     Vcan105 GU053713 188 (TC)15 48 F: TGGGCAATTACCCCACTAAA 156 1 na na      R: GCACGTGCAATTCTGATGAC     Vcan106 GU053714 197 (TC)24 60 F: CCTCATCTCGAGGGAGGATT 190 196 206 208 210 214 224 7 186 188 190 194 210 5      R: ATCGCGAGTTGCGTAGTTTC     Vcan107 GU053715 282 (AC)13 60 F: GTCGCCGGCTCATATTTTTA 283 1 na na      R: AGCAAGTCTGCGATCTTTCC     Vcan108 GU053716 188 (TC)24 50 F: GGATACACGAACCTGGCATT 190 1 na na      R: AGACCGAGAGAGGAGGAAGG     Vcan109 GU053717 192 (AG)10 60 F: TTAATTGAACGGGGAAAACG 189 191 193 3 193 1      R: GCAGTCGGTGTAGCGTGTTA     Vcan110 GU053718 172 (AC)25 55 F: CCATTCATTCGGATCTCACC 172 174 2 172 1      R: CCGACGTTTGTATCTTCGTTC     Vcan111 GU053719 264 (ACC)12 55 F: CCACACGAACAATGTCAAT 264 1 na na      R: CCGTTTTTATGAGCGTAGAG     Vcan112 GU053720 159 (TC)15 55 F: GCAGAGATTTTTGCCACAGG 143 147 149 151 161 172 176 178 8 143 149 161 3      R: TGGCTGGATGAAGGGATATT     Vcan113 GU053721 199 (GA)11 55 F: TTCAGGGAGGATAGAACGTA 199 1 199 1      R: TCTCTCTCCTTCCCTTTCTC     Vcan114 GU053722 241 (AG)10 55 F: AAAAATGAACGACAGAAGGA 237 241 245 247 251 5  243 1      R: GTTGCGCTCTTTGTGAATA     Vcan115 GU053723 106 (CT)11 55 F: TTTTTCACTCTTCGTTCCTC 096 104 106 124 4 104 110 2      R: TGCTACCCTCTTGATCTCC     SOM Table 3. Recombination between the csd locus and microsatellite marker Vcan071 from a cross between a heterozygous female and a hemizygous male with a matched allele for the marker. Diploid males are significantly more often homozygous for Vcan071. genotype Heterozygous Vcan071 Homozygous Vcan071 P 2n females 6 8  2n males 3 14 0.01<P<0.025 SOM Table 4. Linkage between the vlp-p40 locus (alleles + and -) and microsatellite marker Vcan109 (alleles m=maternal and p=paternal)  vlp Vcan109 + - total m 38 2 40 p 1 23 24 total 39 25 64 X2=48,246, df=1, p<0.0001, N=64 SOM Table 5 Genotyping raw data for 15 polymorphic microsatellites of the 29 field collected strains used in this study. Indv Location Year Vcan061 Vcan062 Vcan063 Vcan064 Vcan065 Vcan066 Vcan067 Vcan069 Vcan070 Vcan071 Vcan097 Vcan109 Vcan110 Vcan112 Vcan114   Arrhenotokous 1 Bl'E 1997 188190 254 182184 286 230233 240252 0 223226 224 0 142 0 0 143149 0 2 StJ 1997 190192 254266 182 286 209218 248 142154 226 220223 0 140 189 0 143 241251 3 Cd'Al 1997 188190 250 182184 280286 227236 240244 0 220226 224 228234 140 0 172 143149 247251 4 StL 1997 188190 250266 182 286295 233 240244 157 0 224 228234 140 189191 172 143 247 5 CsM 1997 184 250266 0 286 224233 244 157 226 215 0 140142 189191 172 143149 247 6 SV 1997 190200 260266 174184 286 215230 252260 151 226 224 0 140142 189 0 149 241 7 Got 1997 190200 260266 0 280286 212230 240244 151 0 224 231 142 191 172 149161 237241 8 Mt.B 1997 188190 250260 182 283289 218221 240 154160 223229 0 234 140 191193 0 143149 241 9 PdC 1997 188190 250254 182184 286289 209233 240 142 226229 0 234 140 189191 174 143 247 10 Pmer 1997 188190 250254 182 286 212227 240244 0 226 220223 0 140144 189193 172 143149 241247 11 Eze 1998 188200 250266 182184 277286 218 240244 142160 217226 223226 237 140142 191 172 143 247 12 LB 1998 178 250266 182 283286 221227 240244 157 223226 224 0 140144 191 172 143 241247 13 MtG 1998 188 266 182 286 209212 240244 157 226 0 237243 0 189191 172 143 241247 14 MtV 1998 188190 250266 182 280286 209218 240252 139 220226 223 0 140142 191193 174 147161 247251 15 Anth 1998 188 266 182186 286 230 244 142 226 212220 234 140142 189191 172 143 241 16 Pm 1998 190 260266 182186 286 218230 240244 142154 226 212220 0 140 189191 172 143 241247 17 StG 1998 188190 266 182 286 212227 240244 0 0 220223 234 140 191 172 143 241 18 Vala 1998 190 250266 182186 283286 215224 240260 0 223226 222 246 140142 191 172 143 247 19 VF 1998 190194 250 182186 286 209227 240244 154157 226 220223 246 140 189193 172 143 0 20 VV 1998 0 0 0 0 0 0 0 0 222 0 0 0 0 0 0 21 Ant Bot 2003 188 250260 182184 286 212227 240 139154 226 222 240 140 191193 172 143 241 22 MtB 2003 188190 266 182 283286 200227 244 154160 223226 224 0 140 189191 172 143 241247   Thelytokous 23 Anth 1997 188 256 182 289 221 248 157 229 0 231 142 193 172 161 243 24 Pmer 1997 188 256 182 289 221 248 157 229 227 231 142 193 0 161 243 25 Val 1997 188 256 182 286 221 248 157 229 230 0 142 193 172 0 243 26 Ant Bot 2003 188 256 182 289 221 248 157 229 230 231 142 193 172 161 243 2 Valb 2003 188 256 182 289 221 248 157 0 230 231 142 193 172 161 243 7 28 MtB 2003 188 256 182 289 221 248 157 229 230 231 142 193 172 161 243 29 SJ 2003 190 250 182 0 215 244 151 229 227 243 152 193 172 161 0 SOM Table 6. Observed allele frequencies in arrhenotokous and thelytokous females for 15 microsatellites. N designates de number of individuals tested of each reproductive mode. Locus Alleles Arrhenotokous Thelytokous  Locus Alleles Arrhenotokous Thelytokous Vcan61 N 21 7  Vcan69  18 6  178 0.048 0   217 0.028 0  184 0.048 0   220 0.056 0  188 0.381 0.857   223 0.139 0  190 0.405 0.143   226 0.722 0  192 0.024 0   229 0.056 1  194 0.024 0  Vcan70  19 6  200 0.071 0   212 0.053 0 Vcan62  21 7   215 0.053 0  250 0.333 0.143   221 0.316 0  254 0.119 0   224 0.553 0  256 0 0.857   227 0.026 0.333  260 0.119 0   230 0 0.667  266 0.429 0  Vcan71  12 6 Vcan63  19 7   228 0.083 0  174 0.026 0   231 0.083 0.833  182 0.711 1   234 0.417 0  184 0.158 0   237 0.125 0  186 0.105 0   240 0.083 0 Vcan64  21 6   243 0.042 0.167  277 0.024 0   246 0.167 0  280 0.071 0  Vcan97  20 7  283 0.095 0   140 0.700 0  286 0.738 0.167   142 0.250 0.857  289 0.048 0.833   144 0.050 0  295 0.024 0   152 0 0.143 Vcan65  21 7  Vcan109  19 7  200 0.024 0   189 0.342 0  209 0.119 0   191 0.526 0  212 0.119 0   193 0.132 1  215 0.048 0.143  Vcan110  17 6  218 0.143 0   172 0.882 1  221 0.048 0.857   174 0.118 0  224 0.048 0  Vcan112  21 6  227 0.167 0   143 0.738 0  230 0.143 0   147 0.024 0  233 0.119 0   149 0.190 0  236 0.024 0   161 0.048 1 Vcan66  21 7  Vcan114  19 6  240 0.452 0   237 0.026 0  244 0.381 0.143   241 0.447 0  248 0.048 0.857   243 0 1  252 0.071 0   247 0.447 0  260 0.048 0   251 0.079 0 Vcan67  16 7       139 0.094 0       142 0.219 0       151 0.125 0.143       154 0.188 0       157 0.281 0.857       160 0.094 0       

University of Groningen

   University of GroningenGenetic variability of arrhenotokous and thelytokous Venturia canescens (Hymenoptera)Mateo Leach, Irene; Ferber, Steven; van de Zande, Louis; Beukeboom, Leo W.Published in:GeneticaDOI:10.1007/s10709-012-9657-6IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.Document VersionPublisher's PDF, also known as Version of recordPublication date:2012Link to publication in University of Groningen/UMCG research databaseCitation for published version (APA):Mateo Leach, I., Ferber, S., van de Zande, L., & Beukeboom, L. W. (2012). Genetic variability ofarrhenotokous and thelytokous Venturia canescens (Hymenoptera). Genetica, 140(1-3), 53-63.https://doi.org/10.1007/s10709-012-9657-6CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.Download date: 26-04-2023SOM Table 1. Summary of samples used in this study. Indicated is the transect location number from SOM Figure 1, location name, collection year, reproductive mode, sample name and in which analysis the sample was used. A = arrhenotokous, T = thelytokous. Transect location  Location Collection Year Mode Sample Microsatellite data Mitochondrial data Côte d’Azur (France)       2 Belvre l'Èze 1997 A Bl'E A 97 + + 4 Cagnes sur Mer 1997 A CsM A 97 + + 3 Cap d'Antibes INRA 1997 A Cd'AI A 97 + + 6 Eze 1997 A Eze A 98 + + 5 Gothéron INRA 1997 A Got A 97 + + 12 Mont Boron 1997 A MtB A 97 + + 14 Panoramèr 1997 A Pmer A 97 + +   1997 A PdC A 97 + + 15 Saint Jan 1997 A StJ A 97 + + 13 Saint Laurent 1997 A StL A 97 + +   1997 A SV A 97 + + 18 Vallauris 1997 A Vala A 98 + + 26 Villefranche 1997 A VF A 98 + + 1 Anthéor 1998 A Anth A 98 + + 7 La Brague 1998 A LB A 98 + + 23 La Vallée Verte 1998 A VV A 98 - + 27 Mont Gros 1998 A MtG A 98 + - 28 Mont Vinagrier 1998 A MtV A 98 + - 14 Panoramèr 1998 A Pm A 98 + + 19 Saint Guitte 1998 A StG A 98 + + 3 Antibes Botanique 2003 A Ant Bot A 03 + + 12 Mont Boron 2003 A MtB A 03 + + 1 Anthéor 1997 T Anth T 97 + + 14 Panoramèr 1997 T Pmer T 97 + + 18 Vallauris 1997 T Val T 97 + + 3 Antibes Botanique 2003 T Ant Bot T 03 + + 12 Mont Boron 2003 T MtB T 03 + + 24 Valbonne 2003 T Valb T 03 + + Costa Blanca (Spain)        San Juan de Alicante 2003 T SJ T 03 + + SOM Table 2. Overview of microsatellite markers of Venturia canescens. Size: expected size of the sequenced allele (bp); Repeat motif: repeat comprised between the primers; Tm: annealing temperature (ºC); Primer sequences: forward and reverse 5’-3’ primer sequence. Alleles: allele sizes observed; NA: the number of alleles per locus. na: not amplified Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  NA Thelytokous  Alleles  NA            Vcan060 GU053668 244 (GA)9 58 F: GGAGTTACTGAAGGCAAACAAGG 253 247 2 247 249 2      R: AATGACTGAACGGGACTCGAT     Vcan061 GU053669 186 (CT)13 55 F: TACGGTACTGAGAGATGTGTGGA 178 184 188 190 192 194 200 7 188 190 2      R: TCGGTTAGAAGTGAGACCTGAAC     Vcan062 GU053670 254 (CT)8 55 F: TGACTCCCTATGCACTTCTTCTC 250 254 260 266 4 250 256 2      R: GAAGGTGTCGAGATATGGTGAAC     Vca GU05 17(AG) 5 F CGTATACTCACGCA 174 178 182 184 186 5 168 182 2 n063 3671 9 39 5 : CACACAAAG      R: CTTGACGATATGGGTTGATGG     Vcan064 GU053672 288 Complex* 55 F: GTTGCTAACTTCGAGGACAGACT 277 280 283 286 289 295 6 289 1      R: AGTAGTAACGTTCGATGGCAGAG     Vcan065 GU053673 218 (TGC)15 55 F: TCATTGTCACTGGTCGGTGT 200 209 212 215 218 221 224 227 230 233 236  11 215 221 227 3      R: GATCATAGGCAACAGCAGCA     Vcan066 GU053674 245 (CTTT)11 55 F: GATACCAGACTCGAGATCTATTCAA 238 240 242 244 248 250 252 260 8 244 248 2      R: CGACCGACAATCAAGGTTTT     Vcan067 GU053675 155 (CAA)26 55 F: ATGGTTCAGCAGCAACATCA 139 142 151 154 157 160 6 148 151 154 157  4      R: GTTCCCTTGTAAAGCGGATG     Vcan068 GU053676 155 (TTCG)21 58 F: TCCCGACTTTCTCACTCCTC 141 161 165 169 177 5 na Na      R: AGGAAGGAAGGAACGAAGGA     Vcan069 GU053677 228 (AAC)45 55 F: GAATGAGGATCAGCAAAATCG 199 218 220 223 226 229 6 229 1      R: GATGGCAGAGCAACTCGTTT     Vcan070 GU053678 228 (GCT)10 55 F: TGCTCGCCCTTTTCTTTATT 212 215 221 224 227 5 227 230 2      R: CATCTGCCACGACTCTCAAG     Vcan071 GU053679 232 (CAA)11 55 F: CTCCTACGCACTCCCTTCAC 228 231 234 237 240 243 246 252 8 222 225 231 243 4      R: TTGTACGTTGGCACTTGAGC     * (CAA) CAG (CAA)8 CAG (CAA) CAG (CAA)4 CAG CAT (CAA)4 CCA (CAA)2 (CAG)4 (CAA) CAG (CAA)2 CAC (CAG)2 CAA CAG (CAA)3 CCA SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan072 GU053680 196 (GAC)14 55 F: TGAATTTGTCGTTGCTGCTC 200 203 2 na Na      R: CGAGGAAGTTCAGGCTCAAG     Vcan073 GU053681 244 (TGT)15 60 F: GGTCCAACGGTACTTCCTGA 206 224 245 248 254 260  6 242 245 248 3      R: ACTTCCGTCAGCCCTACCTT     Vcan074 GU053682 198 (AGA)8 61 F: CCGAAGCTGAAGAAATCGAA 200 1 Na na      R: CTACAGAGAGGGGCAAATCG     Vcan075 GU053683 193 (CAA)10 60 F: TCGTCGGATCAACACAATTT 193 1 190 193 2      R: TCAAGAATTCGGGAACATCC     Vcan076 GU053684 154 (TGA)16 60 F: TTGACGCCGTCGAACTAATA 156 1 na Na      R: GTGAAACTGGAGCCTTTGGA     Vcan0 GU053 19 (GAC) 62 F GGTGGATTGACGTGC 196 1 193 196 2 77 685 5 3 : CTTAT      R: CCCTCCCCACTTCTCTCTTT     Vcan078 GU053686 170 (ATT)5 61 F: AGGTGATGTTAGGCGGTTTG 168 171 2 168 1      R: TTTTCGCGGGTTTTGTTTAC     Vcan079 GU053687 157 (GA)15 61 F: AGGAACGCAAAATGAAATGG 146 156 158 3 154 160 2      R: TCGTTCGAACTTTTCCCCTA     Vcan080 GU053688 181 (AGG)6 63 F: TCCATCTTCGCTCTTTTTCC 181 1 181 1      R: CTTTCTCTTCGCGCTCACTT     Vcan081 GU053689 249 (TGC)6 60 F: GCTAGACTCCACGGCTACCA 251 1 Na na      R: CAATAAGGGGCAATTCGTGA     Vcan082 GU053690 169 (CAA)8 63 F: GCAACTCCTGCAACAACAGA 169 1 169 172 1      R: GTGATGAGGGTAGCCGATGT     Vcan083 GU053691 250 (TGA)11 60 F: ATAGCTCATCGCTCCTCTGC 241 244 247  3 241 247 250 3      R: CGCCCATCTTGTGCTTATGT     Vcan084 GU053692 250 (AGA)7 60 F: ACTCGATTTGCGTGGAAAAA 250 1 na Na      R: TTTCGCTTGTTGCTGAGTTC     Vcan085 GU053693 199 (TTC)8 53 F: AGGTTCAATGGCTTTGCTGT 146 161 197 200 4 197 200 21      R: GCTTTCCGAGCTTTTCCTCT     Vcan086 GU053694 244 (AC)24 60 F: AGCAAACGGGACTTGAATTG 245 1 na na      R: GGGACTCCAAACCCTCTTGT     SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan087 GU053695 165 (GT)23 55 F: CTTCTAGCTCCGTCGGTGTC 165 1 165 1      R: CGGTGGTTGTTGTCGAGTTA     Vcan088 GU053696 198 (CA)44 60 F: AGTAACCGGTCAGCCTTTGG 132 136 142 144 4 132 134 136 142  4      R: CACGTTCCAATTTCCACACA     Vcan089 GU053697 234 (TC)33 50 F: GGCCATGTTTCCTACTTCCA 190 1 na na      R: GGCGGAAAGATTTTTCGATAG     Vcan090 GU053698 243 (CT)37 55 F: ATGCGGATGCGTAAGGATAG 251 1 na na      R: GCTGCTTAACGTTTCGGTCT     Vcan091 GU053699 184 (GA)32 60 F: GTAGGCACGTACCGAGGAAA 158 170 174 186 4 154 158 2      R: TCCACGCTCGTGTGTGTACT     Vcan092 GU053700 210 (TTCC)6 60 F: CGTTCGTTCTTTCGTTCGTT 208 212 216 220 4 212 216 220 3      R: CGGCATTGTCCTTCTTGTTT     Vcan0 GU053 20 (TC)2 50 F CTACCAGCACGAGAA 201 1 na na 93 701 1 1 : GCTGA      R: TTTCTCGGTGCTTCTCCACT     Vcan094 GU053702 152 (CT)26 60 F: ACGATCGCTCAATCGAAGTT 156 158 2 154 156 2      R: CTCCCATAAACTCGGAGCAA     Vcan095 GU053703 100 (CA)24 50 F: GTAATCATTTTCGCTCCGTGA 080 092 096 3 na na      R: TCGTTTCTCTTTTCGTTCGAG     Vcan096 GU053704 175 (AG)39 55 F: CTCACGCACACACAAAGTCC 172 176 178 3 176 1      R: TGCTTGACGATATGGGTTGA     Vcan097 GU053705 140 (GA)15 55 F: AATGGAGACAACGAGGCAAC 140 142 144 3 140 142 152 3      R: ATCAGAGTCGACCCAGCAAC     Vcan098 GU053706 233 (GT)15 50 F: CAATTCGGAAACACTGCAAA 233 1 na na      R: CCGCTCGATCTTTTCATTTC     Vcan099 GU053707 123 (AG)12 55 F: TGGCCATAACAGGGAGAAAG 126 128 130 138 4 126 1      R: GTCACTGGGGAAGAGTGGTG     Vcan100 GU053708 224 (GA)12 60 F: ACGGTCAAGTTACCCAAGCA 215 1 na na      R: GACCAAGCTCCGGATAAACA     Vcan101 GU053709 200 (CT)15 45 F: ATCTGGACTAAGCGCGAGAG 190 1 na na      R: CAACGAGAGGGAAAGAGACG     SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan102 GU053710 174 (TC)14 60 F: TTCCAATTCACGAATCAACG 161 165 169 175 4 161 169 172 175 177 5      R: CCTCTGAGTCACCGAAAAGC     Vcan103 GU053711 206 (TC)10 48 F: CTCAAGCTATGCATCCAACG 154 1 na na      R: TCTCGGAGTCAATCCCACTC     Vcan104 GU053712 164 (GA)14 55 F: CAAAAGGGAGGGAAAGGAAG 164 1 na na      R: CCCACGTTTTCGGTGTACTT     Vcan105 GU053713 188 (TC)15 48 F: TGGGCAATTACCCCACTAAA 156 1 na na      R: GCACGTGCAATTCTGATGAC     Vcan106 GU053714 197 (TC)24 60 F: CCTCATCTCGAGGGAGGATT 190 196 206 208 210 214 224 7 186 188 190 194 210 5      R: ATCGCGAGTTGCGTAGTTTC     Vcan107 GU053715 282 (AC)13 60 F: GTCGCCGGCTCATATTTTTA 283 1 na na      R: AGCAAGTCTGCGATCTTTCC     Vcan108 GU053716 188 (TC)24 50 F: GGATACACGAACCTGGCATT 190 1 na na      R: AGACCGAGAGAGGAGGAAGG     Vcan109 GU053717 192 (AG)10 60 F: TTAATTGAACGGGGAAAACG 189 191 193 3 193 1      R: GCAGTCGGTGTAGCGTGTTA     Vcan110 GU053718 172 (AC)25 55 F: CCATTCATTCGGATCTCACC 172 174 2 172 1      R: CCGACGTTTGTATCTTCGTTC     Vcan111 GU053719 264 (ACC)12 55 F: CCACACGAACAATGTCAAT 264 1 na na      R: CCGTTTTTATGAGCGTAGAG     Vcan112 GU053720 159 (TC)15 55 F: GCAGAGATTTTTGCCACAGG 143 147 149 151 161 172 176 178 8 143 149 161 3      R: TGGCTGGATGAAGGGATATT     Vcan113 GU053721 199 (GA)11 55 F: TTCAGGGAGGATAGAACGTA 199 1 199 1      R: TCTCTCTCCTTCCCTTTCTC     Vcan114 GU053722 241 (AG)10 55 F: AAAAATGAACGACAGAAGGA 237 241 245 247 251 5  243 1      R: GTTGCGCTCTTTGTGAATA     Vcan115 GU053723 106 (CT)11 55 F: TTTTTCACTCTTCGTTCCTC 096 104 106 124 4 104 110 2      R: TGCTACCCTCTTGATCTCC     SOM Table 3. Recombination between the csd locus and microsatellite marker Vcan071 from a cross between a heterozygous female and a hemizygous male with a matched allele for the marker. Diploid males are significantly more often homozygous for Vcan071. genotype Heterozygous Vcan071 Homozygous Vcan071 P 2n females 6 8  2n males 3 14 0.01<P<0.025 SOM Table 4. Linkage between the vlp-p40 locus (alleles + and -) and microsatellite marker Vcan109 (alleles m=maternal and p=paternal)  vlp Vcan109 + - total m 38 2 40 p 1 23 24 total 39 25 64 X2=48,246, df=1, p<0.0001, N=64 SOM Table 5 Genotyping raw data for 15 polymorphic microsatellites of the 29 field collected strains used in this study. Indv Location Year Vcan061 Vcan062 Vcan063 Vcan064 Vcan065 Vcan066 Vcan067 Vcan069 Vcan070 Vcan071 Vcan097 Vcan109 Vcan110 Vcan112 Vcan114   Arrhenotokous 1 Bl'E 1997 188190 254 182184 286 230233 240252 0 223226 224 0 142 0 0 143149 0 2 StJ 1997 190192 254266 182 286 209218 248 142154 226 220223 0 140 189 0 143 241251 3 Cd'Al 1997 188190 250 182184 280286 227236 240244 0 220226 224 228234 140 0 172 143149 247251 4 StL 1997 188190 250266 182 286295 233 240244 157 0 224 228234 140 189191 172 143 247 5 CsM 1997 184 250266 0 286 224233 244 157 226 215 0 140142 189191 172 143149 247 6 SV 1997 190200 260266 174184 286 215230 252260 151 226 224 0 140142 189 0 149 241 7 Got 1997 190200 260266 0 280286 212230 240244 151 0 224 231 142 191 172 149161 237241 8 Mt.B 1997 188190 250260 182 283289 218221 240 154160 223229 0 234 140 191193 0 143149 241 9 PdC 1997 188190 250254 182184 286289 209233 240 142 226229 0 234 140 189191 174 143 247 10 Pmer 1997 188190 250254 182 286 212227 240244 0 226 220223 0 140144 189193 172 143149 241247 11 Eze 1998 188200 250266 182184 277286 218 240244 142160 217226 223226 237 140142 191 172 143 247 12 LB 1998 178 250266 182 283286 221227 240244 157 223226 224 0 140144 191 172 143 241247 13 MtG 1998 188 266 182 286 209212 240244 157 226 0 237243 0 189191 172 143 241247 14 MtV 1998 188190 250266 182 280286 209218 240252 139 220226 223 0 140142 191193 174 147161 247251 15 Anth 1998 188 266 182186 286 230 244 142 226 212220 234 140142 189191 172 143 241 16 Pm 1998 190 260266 182186 286 218230 240244 142154 226 212220 0 140 189191 172 143 241247 17 StG 1998 188190 266 182 286 212227 240244 0 0 220223 234 140 191 172 143 241 18 Vala 1998 190 250266 182186 283286 215224 240260 0 223226 222 246 140142 191 172 143 247 19 VF 1998 190194 250 182186 286 209227 240244 154157 226 220223 246 140 189193 172 143 0 20 VV 1998 0 0 0 0 0 0 0 0 222 0 0 0 0 0 0 21 Ant Bot 2003 188 250260 182184 286 212227 240 139154 226 222 240 140 191193 172 143 241 22 MtB 2003 188190 266 182 283286 200227 244 154160 223226 224 0 140 189191 172 143 241247   Thelytokous 23 Anth 1997 188 256 182 289 221 248 157 229 0 231 142 193 172 161 243 24 Pmer 1997 188 256 182 289 221 248 157 229 227 231 142 193 0 161 243 25 Val 1997 188 256 182 286 221 248 157 229 230 0 142 193 172 0 243 26 Ant Bot 2003 188 256 182 289 221 248 157 229 230 231 142 193 172 161 243 2 Valb 2003 188 256 182 289 221 248 157 0 230 231 142 193 172 161 243 7 28 MtB 2003 188 256 182 289 221 248 157 229 230 231 142 193 172 161 243 29 SJ 2003 190 250 182 0 215 244 151 229 227 243 152 193 172 161 0 SOM Table 6. Observed allele frequencies in arrhenotokous and thelytokous females for 15 microsatellites. N designates de number of individuals tested of each reproductive mode. Locus Alleles Arrhenotokous Thelytokous  Locus Alleles Arrhenotokous Thelytokous Vcan61 N 21 7  Vcan69  18 6  178 0.048 0   217 0.028 0  184 0.048 0   220 0.056 0  188 0.381 0.857   223 0.139 0  190 0.405 0.143   226 0.722 0  192 0.024 0   229 0.056 1  194 0.024 0  Vcan70  19 6  200 0.071 0   212 0.053 0 Vcan62  21 7   215 0.053 0  250 0.333 0.143   221 0.316 0  254 0.119 0   224 0.553 0  256 0 0.857   227 0.026 0.333  260 0.119 0   230 0 0.667  266 0.429 0  Vcan71  12 6 Vcan63  19 7   228 0.083 0  174 0.026 0   231 0.083 0.833  182 0.711 1   234 0.417 0  184 0.158 0   237 0.125 0  186 0.105 0   240 0.083 0 Vcan64  21 6   243 0.042 0.167  277 0.024 0   246 0.167 0  280 0.071 0  Vcan97  20 7  283 0.095 0   140 0.700 0  286 0.738 0.167   142 0.250 0.857  289 0.048 0.833   144 0.050 0  295 0.024 0   152 0 0.143 Vcan65  21 7  Vcan109  19 7  200 0.024 0   189 0.342 0  209 0.119 0   191 0.526 0  212 0.119 0   193 0.132 1  215 0.048 0.143  Vcan110  17 6  218 0.143 0   172 0.882 1  221 0.048 0.857   174 0.118 0  224 0.048 0  Vcan112  21 6  227 0.167 0   143 0.738 0  230 0.143 0   147 0.024 0  233 0.119 0   149 0.190 0  236 0.024 0   161 0.048 1 Vcan66  21 7  Vcan114  19 6  240 0.452 0   237 0.026 0  244 0.381 0.143   241 0.447 0  248 0.048 0.857   243 0 1  252 0.071 0   247 0.447 0  260 0.048 0   251 0.079 0 Vcan67  16 7       139 0.094 0       142 0.219 0       151 0.125 0.143       154 0.188 0       157 0.281 0.857       160 0.094 0       

   University of GroningenGenetic variability of arrhenotokous and thelytokous Venturia canescens (Hymenoptera)Mateo Leach, Irene; Ferber, Steven; van de Zande, Louis; Beukeboom, Leo W.Published in:GeneticaDOI:10.1007/s10709-012-9657-6IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.Document VersionPublisher's PDF, also known as Version of recordPublication date:2012Link to publication in University of Groningen/UMCG research databaseCitation for published version (APA):Mateo Leach, I., Ferber, S., van de Zande, L., & Beukeboom, L. W. (2012). Genetic variability ofarrhenotokous and thelytokous Venturia canescens (Hymenoptera). Genetica, 140(1-3), 53-63.https://doi.org/10.1007/s10709-012-9657-6CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.Download date: 12-11-2019 Valence Avignon Marseille Toulon FRANCE 10 km Mediterranean Cap d’Antibes Cap Ferrat Nice Cannes St. Raphael Monaco 1 3 18 7 14 4 15 12 13 2 5 26 28 27 23 24 19 6 

Dissertations of the University of Groningen

   University of GroningenGenetic variability of arrhenotokous and thelytokous Venturia canescens (Hymenoptera)Mateo Leach, Irene; Ferber, Steven; van de Zande, Louis; Beukeboom, Leo W.Published in:GeneticaDOI:10.1007/s10709-012-9657-6IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.Document VersionPublisher's PDF, also known as Version of recordPublication date:2012Link to publication in University of Groningen/UMCG research databaseCitation for published version (APA):Mateo Leach, I., Ferber, S., van de Zande, L., & Beukeboom, L. W. (2012). Genetic variability ofarrhenotokous and thelytokous Venturia canescens (Hymenoptera). Genetica, 140(1-3), 53-63.https://doi.org/10.1007/s10709-012-9657-6CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.Download date: 04-06-2022SOM Table 1. Summary of samples used in this study. Indicated is the transect location number from SOM Figure 1, location name, collection year, reproductive mode, sample name and in which analysis the sample was used. A = arrhenotokous, T = thelytokous. Transect location  Location Collection Year Mode Sample Microsatellite data Mitochondrial data Côte d’Azur (France)       2 Belvre l'Èze 1997 A Bl'E A 97 + + 4 Cagnes sur Mer 1997 A CsM A 97 + + 3 Cap d'Antibes INRA 1997 A Cd'AI A 97 + + 6 Eze 1997 A Eze A 98 + + 5 Gothéron INRA 1997 A Got A 97 + + 12 Mont Boron 1997 A MtB A 97 + + 14 Panoramèr 1997 A Pmer A 97 + +   1997 A PdC A 97 + + 15 Saint Jan 1997 A StJ A 97 + + 13 Saint Laurent 1997 A StL A 97 + +   1997 A SV A 97 + + 18 Vallauris 1997 A Vala A 98 + + 26 Villefranche 1997 A VF A 98 + + 1 Anthéor 1998 A Anth A 98 + + 7 La Brague 1998 A LB A 98 + + 23 La Vallée Verte 1998 A VV A 98 - + 27 Mont Gros 1998 A MtG A 98 + - 28 Mont Vinagrier 1998 A MtV A 98 + - 14 Panoramèr 1998 A Pm A 98 + + 19 Saint Guitte 1998 A StG A 98 + + 3 Antibes Botanique 2003 A Ant Bot A 03 + + 12 Mont Boron 2003 A MtB A 03 + + 1 Anthéor 1997 T Anth T 97 + + 14 Panoramèr 1997 T Pmer T 97 + + 18 Vallauris 1997 T Val T 97 + + 3 Antibes Botanique 2003 T Ant Bot T 03 + + 12 Mont Boron 2003 T MtB T 03 + + 24 Valbonne 2003 T Valb T 03 + + Costa Blanca (Spain)        San Juan de Alicante 2003 T SJ T 03 + + SOM Table 2. Overview of microsatellite markers of Venturia canescens. Size: expected size of the sequenced allele (bp); Repeat motif: repeat comprised between the primers; Tm: annealing temperature (ºC); Primer sequences: forward and reverse 5’-3’ primer sequence. Alleles: allele sizes observed; NA: the number of alleles per locus. na: not amplified Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  NA Thelytokous  Alleles  NA            Vcan060 GU053668 244 (GA)9 58 F: GGAGTTACTGAAGGCAAACAAGG 253 247 2 247 249 2      R: AATGACTGAACGGGACTCGAT     Vcan061 GU053669 186 (CT)13 55 F: TACGGTACTGAGAGATGTGTGGA 178 184 188 190 192 194 200 7 188 190 2      R: TCGGTTAGAAGTGAGACCTGAAC     Vcan062 GU053670 254 (CT)8 55 F: TGACTCCCTATGCACTTCTTCTC 250 254 260 266 4 250 256 2      R: GAAGGTGTCGAGATATGGTGAAC     Vca GU05 17(AG) 5 F CGTATACTCACGCA 174 178 182 184 186 5 168 182 2 n063 3671 9 39 5 : CACACAAAG      R: CTTGACGATATGGGTTGATGG     Vcan064 GU053672 288 Complex* 55 F: GTTGCTAACTTCGAGGACAGACT 277 280 283 286 289 295 6 289 1      R: AGTAGTAACGTTCGATGGCAGAG     Vcan065 GU053673 218 (TGC)15 55 F: TCATTGTCACTGGTCGGTGT 200 209 212 215 218 221 224 227 230 233 236  11 215 221 227 3      R: GATCATAGGCAACAGCAGCA     Vcan066 GU053674 245 (CTTT)11 55 F: GATACCAGACTCGAGATCTATTCAA 238 240 242 244 248 250 252 260 8 244 248 2      R: CGACCGACAATCAAGGTTTT     Vcan067 GU053675 155 (CAA)26 55 F: ATGGTTCAGCAGCAACATCA 139 142 151 154 157 160 6 148 151 154 157  4      R: GTTCCCTTGTAAAGCGGATG     Vcan068 GU053676 155 (TTCG)21 58 F: TCCCGACTTTCTCACTCCTC 141 161 165 169 177 5 na Na      R: AGGAAGGAAGGAACGAAGGA     Vcan069 GU053677 228 (AAC)45 55 F: GAATGAGGATCAGCAAAATCG 199 218 220 223 226 229 6 229 1      R: GATGGCAGAGCAACTCGTTT     Vcan070 GU053678 228 (GCT)10 55 F: TGCTCGCCCTTTTCTTTATT 212 215 221 224 227 5 227 230 2      R: CATCTGCCACGACTCTCAAG     Vcan071 GU053679 232 (CAA)11 55 F: CTCCTACGCACTCCCTTCAC 228 231 234 237 240 243 246 252 8 222 225 231 243 4      R: TTGTACGTTGGCACTTGAGC     * (CAA) CAG (CAA)8 CAG (CAA) CAG (CAA)4 CAG CAT (CAA)4 CCA (CAA)2 (CAG)4 (CAA) CAG (CAA)2 CAC (CAG)2 CAA CAG (CAA)3 CCA SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan072 GU053680 196 (GAC)14 55 F: TGAATTTGTCGTTGCTGCTC 200 203 2 na Na      R: CGAGGAAGTTCAGGCTCAAG     Vcan073 GU053681 244 (TGT)15 60 F: GGTCCAACGGTACTTCCTGA 206 224 245 248 254 260  6 242 245 248 3      R: ACTTCCGTCAGCCCTACCTT     Vcan074 GU053682 198 (AGA)8 61 F: CCGAAGCTGAAGAAATCGAA 200 1 Na na      R: CTACAGAGAGGGGCAAATCG     Vcan075 GU053683 193 (CAA)10 60 F: TCGTCGGATCAACACAATTT 193 1 190 193 2      R: TCAAGAATTCGGGAACATCC     Vcan076 GU053684 154 (TGA)16 60 F: TTGACGCCGTCGAACTAATA 156 1 na Na      R: GTGAAACTGGAGCCTTTGGA     Vcan0 GU053 19 (GAC) 62 F GGTGGATTGACGTGC 196 1 193 196 2 77 685 5 3 : CTTAT      R: CCCTCCCCACTTCTCTCTTT     Vcan078 GU053686 170 (ATT)5 61 F: AGGTGATGTTAGGCGGTTTG 168 171 2 168 1      R: TTTTCGCGGGTTTTGTTTAC     Vcan079 GU053687 157 (GA)15 61 F: AGGAACGCAAAATGAAATGG 146 156 158 3 154 160 2      R: TCGTTCGAACTTTTCCCCTA     Vcan080 GU053688 181 (AGG)6 63 F: TCCATCTTCGCTCTTTTTCC 181 1 181 1      R: CTTTCTCTTCGCGCTCACTT     Vcan081 GU053689 249 (TGC)6 60 F: GCTAGACTCCACGGCTACCA 251 1 Na na      R: CAATAAGGGGCAATTCGTGA     Vcan082 GU053690 169 (CAA)8 63 F: GCAACTCCTGCAACAACAGA 169 1 169 172 1      R: GTGATGAGGGTAGCCGATGT     Vcan083 GU053691 250 (TGA)11 60 F: ATAGCTCATCGCTCCTCTGC 241 244 247  3 241 247 250 3      R: CGCCCATCTTGTGCTTATGT     Vcan084 GU053692 250 (AGA)7 60 F: ACTCGATTTGCGTGGAAAAA 250 1 na Na      R: TTTCGCTTGTTGCTGAGTTC     Vcan085 GU053693 199 (TTC)8 53 F: AGGTTCAATGGCTTTGCTGT 146 161 197 200 4 197 200 21      R: GCTTTCCGAGCTTTTCCTCT     Vcan086 GU053694 244 (AC)24 60 F: AGCAAACGGGACTTGAATTG 245 1 na na      R: GGGACTCCAAACCCTCTTGT     SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan087 GU053695 165 (GT)23 55 F: CTTCTAGCTCCGTCGGTGTC 165 1 165 1      R: CGGTGGTTGTTGTCGAGTTA     Vcan088 GU053696 198 (CA)44 60 F: AGTAACCGGTCAGCCTTTGG 132 136 142 144 4 132 134 136 142  4      R: CACGTTCCAATTTCCACACA     Vcan089 GU053697 234 (TC)33 50 F: GGCCATGTTTCCTACTTCCA 190 1 na na      R: GGCGGAAAGATTTTTCGATAG     Vcan090 GU053698 243 (CT)37 55 F: ATGCGGATGCGTAAGGATAG 251 1 na na      R: GCTGCTTAACGTTTCGGTCT     Vcan091 GU053699 184 (GA)32 60 F: GTAGGCACGTACCGAGGAAA 158 170 174 186 4 154 158 2      R: TCCACGCTCGTGTGTGTACT     Vcan092 GU053700 210 (TTCC)6 60 F: CGTTCGTTCTTTCGTTCGTT 208 212 216 220 4 212 216 220 3      R: CGGCATTGTCCTTCTTGTTT     Vcan0 GU053 20 (TC)2 50 F CTACCAGCACGAGAA 201 1 na na 93 701 1 1 : GCTGA      R: TTTCTCGGTGCTTCTCCACT     Vcan094 GU053702 152 (CT)26 60 F: ACGATCGCTCAATCGAAGTT 156 158 2 154 156 2      R: CTCCCATAAACTCGGAGCAA     Vcan095 GU053703 100 (CA)24 50 F: GTAATCATTTTCGCTCCGTGA 080 092 096 3 na na      R: TCGTTTCTCTTTTCGTTCGAG     Vcan096 GU053704 175 (AG)39 55 F: CTCACGCACACACAAAGTCC 172 176 178 3 176 1      R: TGCTTGACGATATGGGTTGA     Vcan097 GU053705 140 (GA)15 55 F: AATGGAGACAACGAGGCAAC 140 142 144 3 140 142 152 3      R: ATCAGAGTCGACCCAGCAAC     Vcan098 GU053706 233 (GT)15 50 F: CAATTCGGAAACACTGCAAA 233 1 na na      R: CCGCTCGATCTTTTCATTTC     Vcan099 GU053707 123 (AG)12 55 F: TGGCCATAACAGGGAGAAAG 126 128 130 138 4 126 1      R: GTCACTGGGGAAGAGTGGTG     Vcan100 GU053708 224 (GA)12 60 F: ACGGTCAAGTTACCCAAGCA 215 1 na na      R: GACCAAGCTCCGGATAAACA     Vcan101 GU053709 200 (CT)15 45 F: ATCTGGACTAAGCGCGAGAG 190 1 na na      R: CAACGAGAGGGAAAGAGACG     SOM Table 2. Continued Locus Accession No. Size (bp) Repeat Motif Tm (ºC)  Primer sequence (5’ – 3’) Arrhenotokous  Alleles  Na Thelytokous Alleles  Na Vcan102 GU053710 174 (TC)14 60 F: TTCCAATTCACGAATCAACG 161 165 169 175 4 161 169 172 175 177 5      R: CCTCTGAGTCACCGAAAAGC     Vcan103 GU053711 206 (TC)10 48 F: CTCAAGCTATGCATCCAACG 154 1 na na      R: TCTCGGAGTCAATCCCACTC     Vcan104 GU053712 164 (GA)14 55 F: CAAAAGGGAGGGAAAGGAAG 164 1 na na      R: CCCACGTTTTCGGTGTACTT     Vcan105 GU053713 188 (TC)15 48 F: TGGGCAATTACCCCACTAAA 156 1 na na      R: GCACGTGCAATTCTGATGAC     Vcan106 GU053714 197 (TC)24 60 F: CCTCATCTCGAGGGAGGATT 190 196 206 208 210 214 224 7 186 188 190 194 210 5      R: ATCGCGAGTTGCGTAGTTTC     Vcan107 GU053715 282 (AC)13 60 F: GTCGCCGGCTCATATTTTTA 283 1 na na      R: AGCAAGTCTGCGATCTTTCC     Vcan108 GU053716 188 (TC)24 50 F: GGATACACGAACCTGGCATT 190 1 na na      R: AGACCGAGAGAGGAGGAAGG     Vcan109 GU053717 192 (AG)10 60 F: TTAATTGAACGGGGAAAACG 189 191 193 3 193 1      R: GCAGTCGGTGTAGCGTGTTA     Vcan110 GU053718 172 (AC)25 55 F: CCATTCATTCGGATCTCACC 172 174 2 172 1      R: CCGACGTTTGTATCTTCGTTC     Vcan111 GU053719 264 (ACC)12 55 F: CCACACGAACAATGTCAAT 264 1 na na      R: CCGTTTTTATGAGCGTAGAG     Vcan112 GU053720 159 (TC)15 55 F: GCAGAGATTTTTGCCACAGG 143 147 149 151 161 172 176 178 8 143 149 161 3      R: TGGCTGGATGAAGGGATATT     Vcan113 GU053721 199 (GA)11 55 F: TTCAGGGAGGATAGAACGTA 199 1 199 1      R: TCTCTCTCCTTCCCTTTCTC     Vcan114 GU053722 241 (AG)10 55 F: AAAAATGAACGACAGAAGGA 237 241 245 247 251 5  243 1      R: GTTGCGCTCTTTGTGAATA     Vcan115 GU053723 106 (CT)11 55 F: TTTTTCACTCTTCGTTCCTC 096 104 106 124 4 104 110 2      R: TGCTACCCTCTTGATCTCC     SOM Table 3. Recombination between the csd locus and microsatellite marker Vcan071 from a cross between a heterozygous female and a hemizygous male with a matched allele for the marker. Diploid males are significantly more often homozygous for Vcan071. genotype Heterozygous Vcan071 Homozygous Vcan071 P 2n females 6 8  2n males 3 14 0.01<P<0.025 SOM Table 4. Linkage between the vlp-p40 locus (alleles + and -) and microsatellite marker Vcan109 (alleles m=maternal and p=paternal)  vlp Vcan109 + - total m 38 2 40 p 1 23 24 total 39 25 64 X2=48,246, df=1, p<0.0001, N=64 SOM Table 5 Genotyping raw data for 15 polymorphic microsatellites of the 29 field collected strains used in this study. Indv Location Year Vcan061 Vcan062 Vcan063 Vcan064 Vcan065 Vcan066 Vcan067 Vcan069 Vcan070 Vcan071 Vcan097 Vcan109 Vcan110 Vcan112 Vcan114   Arrhenotokous 1 Bl'E 1997 188190 254 182184 286 230233 240252 0 223226 224 0 142 0 0 143149 0 2 StJ 1997 190192 254266 182 286 209218 248 142154 226 220223 0 140 189 0 143 241251 3 Cd'Al 1997 188190 250 182184 280286 227236 240244 0 220226 224 228234 140 0 172 143149 247251 4 StL 1997 188190 250266 182 286295 233 240244 157 0 224 228234 140 189191 172 143 247 5 CsM 1997 184 250266 0 286 224233 244 157 226 215 0 140142 189191 172 143149 247 6 SV 1997 190200 260266 174184 286 215230 252260 151 226 224 0 140142 189 0 149 241 7 Got 1997 190200 260266 0 280286 212230 240244 151 0 224 231 142 191 172 149161 237241 8 Mt.B 1997 188190 250260 182 283289 218221 240 154160 223229 0 234 140 191193 0 143149 241 9 PdC 1997 188190 250254 182184 286289 209233 240 142 226229 0 234 140 189191 174 143 247 10 Pmer 1997 188190 250254 182 286 212227 240244 0 226 220223 0 140144 189193 172 143149 241247 11 Eze 1998 188200 250266 182184 277286 218 240244 142160 217226 223226 237 140142 191 172 143 247 12 LB 1998 178 250266 182 283286 221227 240244 157 223226 224 0 140144 191 172 143 241247 13 MtG 1998 188 266 182 286 209212 240244 157 226 0 237243 0 189191 172 143 241247 14 MtV 1998 188190 250266 182 280286 209218 240252 139 220226 223 0 140142 191193 174 147161 247251 15 Anth 1998 188 266 182186 286 230 244 142 226 212220 234 140142 189191 172 143 241 16 Pm 1998 190 260266 182186 286 218230 240244 142154 226 212220 0 140 189191 172 143 241247 17 StG 1998 188190 266 182 286 212227 240244 0 0 220223 234 140 191 172 143 241 18 Vala 1998 190 250266 182186 283286 215224 240260 0 223226 222 246 140142 191 172 143 247 19 VF 1998 190194 250 182186 286 209227 240244 154157 226 220223 246 140 189193 172 143 0 20 VV 1998 0 0 0 0 0 0 0 0 222 0 0 0 0 0 0 21 Ant Bot 2003 188 250260 182184 286 212227 240 139154 226 222 240 140 191193 172 143 241 22 MtB 2003 188190 266 182 283286 200227 244 154160 223226 224 0 140 189191 172 143 241247   Thelytokous 23 Anth 1997 188 256 182 289 221 248 157 229 0 231 142 193 172 161 243 24 Pmer 1997 188 256 182 289 221 248 157 229 227 231 142 193 0 161 243 25 Val 1997 188 256 182 286 221 248 157 229 230 0 142 193 172 0 243 26 Ant Bot 2003 188 256 182 289 221 248 157 229 230 231 142 193 172 161 243 2 Valb 2003 188 256 182 289 221 248 157 0 230 231 142 193 172 161 243 7 28 MtB 2003 188 256 182 289 221 248 157 229 230 231 142 193 172 161 243 29 SJ 2003 190 250 182 0 215 244 151 229 227 243 152 193 172 161 0 SOM Table 6. Observed allele frequencies in arrhenotokous and thelytokous females for 15 microsatellites. N designates de number of individuals tested of each reproductive mode. Locus Alleles Arrhenotokous Thelytokous  Locus Alleles Arrhenotokous Thelytokous Vcan61 N 21 7  Vcan69  18 6  178 0.048 0   217 0.028 0  184 0.048 0   220 0.056 0  188 0.381 0.857   223 0.139 0  190 0.405 0.143   226 0.722 0  192 0.024 0   229 0.056 1  194 0.024 0  Vcan70  19 6  200 0.071 0   212 0.053 0 Vcan62  21 7   215 0.053 0  250 0.333 0.143   221 0.316 0  254 0.119 0   224 0.553 0  256 0 0.857   227 0.026 0.333  260 0.119 0   230 0 0.667  266 0.429 0  Vcan71  12 6 Vcan63  19 7   228 0.083 0  174 0.026 0   231 0.083 0.833  182 0.711 1   234 0.417 0  184 0.158 0   237 0.125 0  186 0.105 0   240 0.083 0 Vcan64  21 6   243 0.042 0.167  277 0.024 0   246 0.167 0  280 0.071 0  Vcan97  20 7  283 0.095 0   140 0.700 0  286 0.738 0.167   142 0.250 0.857  289 0.048 0.833   144 0.050 0  295 0.024 0   152 0 0.143 Vcan65  21 7  Vcan109  19 7  200 0.024 0   189 0.342 0  209 0.119 0   191 0.526 0  212 0.119 0   193 0.132 1  215 0.048 0.143  Vcan110  17 6  218 0.143 0   172 0.882 1  221 0.048 0.857   174 0.118 0  224 0.048 0  Vcan112  21 6  227 0.167 0   143 0.738 0  230 0.143 0   147 0.024 0  233 0.119 0   149 0.190 0  236 0.024 0   161 0.048 1 Vcan66  21 7  Vcan114  19 6  240 0.452 0   237 0.026 0  244 0.381 0.143   241 0.447 0  248 0.048 0.857   243 0 1  252 0.071 0   247 0.447 0  260 0.048 0   251 0.079 0 Vcan67  16 7       139 0.094 0       142 0.219 0       151 0.125 0.143       154 0.188 0       157 0.281 0.857       160 0.094 0       

Crossref

Genetica

The ichneumonid wasp Venturia canescens (Hymenoptera) has been studied extensively for foraging behaviour and population dynamics of sexually (arrhenotokous) and parthenogenetically (thelytokous) reproducing individuals. Here we report the development of a set of microsatellite markers for V. canescens and use them to show that arrhenotokous individuals have more genetic variability than thelytokous ones, which are even homozygous for all tested loci. Crosses between arrhenotokous individuals suggested one marker, Vcan071, to be linked with the Complementary Sex Determiner (CSD) locus and one, Vcan109, with the Virus Like Protein (vlp-p40) locus. The genome size of V. canescens was estimated to be 274–279 Mb. We discuss how both reproductive modes can give rise to the observed genetic variability and how the new markers can be used for future genetic studies of V. canescens.

Beukeboom, Leo W.,

Ferber, Steven,

Zande, Louis van de,

Mateo Leach, Irene,

University of Groningen Digital Archive

Automictic parthenogenesis in the parasitoid Venturia canescens (Hymenoptera: Ichneumonidae) revisited. Genome 43:939–944 Beukeboom

Does constrained oviposition inﬂuence offspring sex ratio in the solitary parasitiod wasp Venturia canescens? Ecol Entomol 33:167–174 Nei M

Gene ﬂow between arrhenotokous and thelytokous populations of Venturia canescens (Hymenoptera). Heredity 90:260–267

Genes in new environments: genetics and evolution in biological control. Nat Rev Genet 4:889–899

Patch departure mechanisms and optimal host exploitation in an insect parasitoid.

Single locus complementary sex determination in Hymenoptera: an ‘‘unintelligent’’ design? Frontiers Zool 3:1 Wajnberg

The inﬂuence of temperature and host availability on the host exploitation strategies of sexual and asexual parasitic wasps of the same species. Oecologia 148:153–161

Genetic variability of arrhenotokous and thelytokous Venturiacanescens (Hymenoptera)

Abstract

Similar works

Full text

Available Versions

Springer - Publisher Connector

NARCIS

Proceedings - University of Groningen

ARTS repository - University of Groningen

University of Groningen

University of Groningen

Dissertations of the University of Groningen

Crossref

Springer - Publisher Connector

University of Groningen Digital Archive