Toll-like receptors (TLR) are the first signal receptors of innate immunity, recognizing bacteria and viruses and promoting development of inflammation through the activation of proinflammatory cytokines secretion (1). In animal models it was shown, that TLRs play role in pathogenesis of miscarriages (2, 3) and can influence to trophoblast apoptosis. The aim of research was to investigate study specialty of mRNA expression of TLR1-10 and caspase-3a in endometrium at patients with early miscarriagesyesBelgorod State Universit

Churnosov, M.

Ivashova, O.

Lebedeva, O.

Pakhomov, S.

Starceva, N..

DSpace at Belgorod State University

Giorn. It. Ost. Gin. - Vol. XXXV - п. 1 Gennaio-Febbraio 2013Expression of TLR1-10 and caspase-3 alfa at women with early miscarriagesLEBEDEVA O., PAKHOMOV S., IVASHOVA 0., STARCEVA N.. CHURNOSOV M„ KUZNETSOVA Y„ KUZNICHENKO E.Belgorod State National Research University, Obstetrics and Gynecology Department, Belgorod, RussiaIntroductionToll-like receptors (TLR) are the first signal receptors o f  innate immunity, recognizing bacteria and viruses and promoting development o f inflammation through the activation o f proinflammatory cytokines secretion (1). In animal models it was shown, that T L R s play role in pathogenesis o f  miscarriages (2, 3) and can influence to trophoblast apoptosis (4).The aim o f  research was to investigate study specialty o f  m RNA expression o f TLR1-10 and caspase-3a in en­dometrium at patients with early miscarriages.M aterials and methodsm RN A  expression o f T L R  1-10 and caspase-3 alfa in epithelial cells o f  endometrium was detected using qPCR  according to M IQ E  guideline (5). Samples were taken from 57 women with early miscarriages (6-10 weeks o f  gestation) and 57 women with medical abortion (6- 10 weeks) as a control group. mRNA was extracted using Trizol (“ Invitrogen” , USA). First-strand cD N A  synthe­sis was performed using oligodT and M int reverse tran­T a b l e  1 - PRIMERS FOR QUANTATIVE PCR.scriptase (“Eurogen”, Russia). Quantitative real-time PCR was performed using qPCRmix-HS SYBR kit (“Eurogen”, Russia). Results were analyzed using C FX 96 (“Bio-rad laboratories”, USA). Human beta-actin and peptidylprolyl isomerase A  (PPIA) were used as housekeeping genes (Ta­ble 1). Amplification was performed using the fol­lowing cycling conditions: 5 minutes at 95°C , and 45 three-step cycles o f  15 seconds at 95°C, 30 seconds o f ap­propriate gene annealing according to the table 1 and 30 seconds at 68°C. Results were calculated as delta-delta cq and estimated by Mann-Whitney criteria.ResultsIt was shown that in endometrium at patients with mi­scarriages significantly higher expression o f T L R  3, whi­ch ligand is double-stranded viral RNA, was detected (Ta­ble 2). O n the contrary, expression o f  T L R 4 (ligand - lipopolysaccharides o f  Gram-negative bacteria), T LR 6 (ligand - lipopeptides) and T LR 8 (ligand -  single-stran­ded RNA) were significandy lower, than in control group. It was studied m RN A expression o f caspase-3 alfa, whi­ch can influence on trophoblast apoptosis. ExpressionGene Forward primer Reverse primer Annealing temperature,“CTLR1 CAGGCACCAGGGCGTGATGG GATGGAGGGGCCGGACTCGT 57TLR2 ATCCTGCTCACGGGGGTCCTG TGCTGGGAGCTTTCCTGGGC 57TLR3 ACTGATGCTCCGAAGGGTGGC TGCGTGTTTCCAGAGCCGTGC 56TLR4 GGAGCCCTGCGTGGAGGTGGTT GTTGAGAAGGGGAGGTTGTCGGGGA 57TLR5 GGGTCAGTTCTGGACTTCAGAG GGCTTCAAGGCACCAGCCATCTC 58TLR6 ACCCTTTAGGATAGCCACTGC GACOTGAAGCTGAGGGATGT 59TLR7 GTGGGGCCAGGAGCACACAAG ACAGACGTTGGTGGCTCCCCT 57TLR8 AGGCTACGGCAGCGGATCTGT GCAGGCCATCCCAGGACAGCA 65TLR9 AGACCTGAGGGTGGAAGTGT TCCCCTCTCAGACAGCCTAC 61TLR 10 AGTGCAAGCCGTGGGGGTTT GTGGCTGGGGTCAAGTCTGCG 60CASP-За GTGCTATTGTGAGGCGGTTG CACGGATACACAGCCACAGG 55Beta-actin CAGGCACCAGGGCGTGATGG GATGGAGGGGCCGGACTCGT 64PPIA CCGCCGAGGAAAACCGTGTACT TGGACAAGATGCCAGGACCCGT 64©  C opyright 2013 , C I C  Edizioni Intcrnazionali, Rom a270T a ble  2 - EXPRESSION OF TOLL-LIKE RECEPTORS 1-10 AND CASPASE-3 ALFA IN HUMAN ENDOM ETRIUM  AT PA­TIEN TS WITH MISCARRIAGES AND IN TH E CON TROL GROUP.№ Gene Women with early miscarriages (n=57) Control group (n=57)1. TLR IE 7,16 (1,57; 27,66) 4,41 (1,97; 2,48)2. TLR2E 0,72 (0,35; 1,46) 0,54 (0,32; 1,15)3. TLR3E 105,42 (55,52; 297,14) 63,78 (32,22; 144,01)4. TLR4E 0,17 (0,06; 0,36) 0,26 (0,12; 0,51)5. TLR5E 0,0002 (0,00008; 0,0004) 0,0002 (0,0001; 0,0007)6. TLR6E 0,044 (0,006; 0,129) 5,063 (0,105; 9,747)7. TLR7E 131,14(66,72; 224,41) 153,27(106,52;261,37)8. TLR8E 0,2862 (0,1451; 0,7579) 0,5230 (0,2793; 1,0353)9. TLR9E 0,0434 (0,0073; 0,3322) 0,0209 (0,0009; 0,1713)10. TLR10E 1,3803(0,6417; 3,1059) 1,2527 (0,5141:2,4708)11. CASP-3 alfa 0,0026(0,00017:0,0150) 0,0004 (0,0001; 0,0039)o f caspase-3a in endometrium was significantly higher versus control group and had moderate negative corre­lation with expression o f  T L R 6  in endometrium (R=- 0,52; p=0 ,000057).DiscussionAt present it is no doubt, that viral infection plays an im­portant role in the pathogenesis o f spontaneous abortions(6). The literature describes the results o f  a series o f  ex­periments on mice, concerning the T L R , activated by viral ligands, in the development o f  spontaneous abor­tion. Poly I:C  acid, which is ligand o f  T LR 3, in mice induces resorption both syngeneic and allogeneic embryos(7). Blocking o f T L R 3 by specific antibodies cancel in­fluence o f poly I:C  on embryo (8). Moreover, viral in­fection can impact on bacterial infection outcome. It was shown, that in herpes simplex infected mice insertion o f lipopolysaccharide led to miscarriages. In control group with absence o f viral infection progression o f pregnancy was observed (9). It could be suggested, that stimula­tion o f  TLR 3 by viral ligands can lead to decrease o f bac­terial T L R  expression.Futhermore, in vitro studies suggest that the pro-apop- totic effect observed following PD G treatment is mediated by TLR1 and T LR 2 heterodimers, which then activa­te caspase-8, caspase-9 , and caspase-3 through M yD 88/F A D D  pathway, whereas the presence o f TLR -6 may shift: the type o f response, cell death is pre­vented and a cytokine response ensues through N F k B activation (10).ConclusionAccording to our data, at patients with early stages m i­scarriages decrease o f  T LR 6 in endometrium is obser­ved. Therefore, an increase o f  caspase-3 alfa level pro­bably appears because o f  absence o f  its protective effect. Therefore, T LR 3 activation is important for early m i­scarriages development. It could be suggested, that suf­ficient expression o f T LR 6 can play protective role in en­dometrium, preventing miscarriages by avoidance o f  trophoblast apoptosis.AcknowledgementsSupported by grant o f  President o f  Russian Federation №  M D -936.2012.7  and State Assignment №  4.3493. 2011.References1. Horne A., Stock S., King A. Innate immunity and disorders of female reproductive tract. Reproduction 2008;135:p. 739-749.2. Wang H., Hirsch E. Bacterially-induced preterm labor and re­gulation of prostaglandin-metabolizing enzyme expression in mice: the role of toll-like receptor 4. Biology of Reproduction 2003;Vol. 69:p. 1957-1963.3. Mulla M.J., Brosens J.J., Chamley L.W. Antiphospholipid an­tibodies induce a pro-inflammatory response in first trimester trophoblast via the TLR4/MyD88 pathway. Am J Reprod Im­munol Aug 2009;Vol. 62(2): P. 96-111.4. Rose J. A., Rabenhold M.M., Parast D.S., Milstone D.S. et al. Peptidoglycan induces necrosis and regulates cytokine produc­tion in murine trophoblast stem cells. Am J  Reprod Immunol Sep 201 l;Vol. 66 (3):P. 209-222.5. Bustin S. A. et al. The MIQE Guidelines: Minimum informa­tion for publication o f quantitive Real-Time PCR experi­ments. Clinical Chemistry 2009; №  55, Vol. 4:p. 611-622.6. Anzivino E., Fioriti D., Mischitelli М., Bellizzi A., et al. Her­pes simplex virus infection in pregnancy and in neonate: sta­tus o f art of epidemiology, diagnosis, therapy and prevention// Virology journal 2009; №  6:P. 40.7. Lin Y„ Zeng Y„ Di J., Zeng S. Murine CD200+ CK7+ trophoblasts in a poly (I:C)-induced embryo resorption model. Reproduction 2005;Vol. 130 :P. 529-537.8. Lin Y., Liang Z., Chen Y., Zeng Y. TLR3-involved modula­tion o f pregnancy tolerance in double-stranded RNA-stimu- lated N O D /SCID  mice. J  Immunol 2006;Vol. 176:P. 4147- 4154.9. Nansen A., Thompsen A.R. Viral infection causes rapid sensi­tization to lipopolysaccharide: central role o f IFN-alpha beta. J. Immunol 2002;Vol. 166:P. 982-988.10. Abrahams V.M., Aldo P.B., Murphy S.P., Visintin I. et al. TLR6 modulates first trimester trophoblast responses to peptidoglvcan. J . Immunol 2008;Vol 180:P. 6035-6043.271

Expression of TLR1-10 and caspase-3 alfa at women with early miscarriages

http://dspace.bsu.edu.ru/bitstream/123456789/9223/1/Lebedeva_Expression_12.pdf

Expression of TLR1-10 and caspase-3 alfa at women with early miscarriages

Abstract

Similar works

Full text

Available Versions

DSpace at Belgorod State University