Human Papillomavirus (HPV) infection has been shown as a risk factor in oral carcinogenesis. The association between HPV and benign and malignant neoplasm of oral mucosa, especially surface epithelium-derived tumors, is well established. The role of HPV in pathogenesis of odontogenic cysts and tumors has been published in few articles. The aim of this study was detection of HPV in Iranian patients with intrabony ameloblastoma and investigation of specific risk factors associated with ameloblastoma. One hundred intrabony ameloblastoma and 50 age-sex matched samples as controls were evaluated by polymerase chain reaction for the detection and typing of HPV. Fisher exact and chi square tests were used to assess the data. HPV DNA was detected in 32% of patients and 10% of controls. HPV-6 was the most prevalent genotype (31.6%) in infected cases. It was followed by HPV-11 (12.5%), HPV-16 (12.5%) and HPV-31 (3.1%). We found a significant association between presence of HPV and location of tumor (p = 0.02), traumatic history (p = 0.03) and ododontic therapy (p = 0.01). These findings indicated that HPV-6 probably is one of the most important etiologic agents in causing intraosseous ameloblastoma in Iranian population. © 2006 Academic Journals Inc., USA

Khodayari-Nemin, A.

Mokhtari-Azad, T.

Moradi, A.

Reza Keikhaee, M.

Sargolzaei, S.

Shahrokhi, M.

English

Golestan University of Medical Sciences Repository

International Journal of Virology 2 (1): 1-6, 2006 ISSN 1816-4900 © 2006 Academic Journals Inc., USA Detection ofHuman Papillomavirus DNA in Intraosseus Ameloblastoma 'Talat Mokhtari-Azad, 'Abdolvahab Moradi, 'Abbas Khodayari-Nemin, 4Mohammad Reza Keikhaee, 5Sudabeh Sargolzaei and 3Mahrnud Shahrokhi 1Departrnent of Virology, Tehran University of Medical Sciences, Tehran 2Departrnent ofMicrobilogy, Medical School, Gorgan University of Medical Sciences, Gorgan, Iran 'Department of Oral and Maxillofacial Surgery, Dental School, ShahidBeheshti University of Medical Sciences, Tehran, Iran 4Genetic Research Center, Welfare and Rehabilitation University, Tehran 'Department of Oral and Maxillofacial Pathology, Dental School, ShahidBeheshti University of Medical Sciences, Tehran, Iran Abstract: Human Papillornavirus (HPV) infection has been shown as a risk factor in oral carcinogenesis. The association between HPV and benign and malignant neoplasm of oral mucosa, especially surface epithelium-derived tumors, is well established. The role ofHPV in pathogenesis of odontogenic cysts and tumors has been published in few articles. The aim of this study was detection of HPV in Iranian patients with intrabony arneloblastoma and investigation of specific risk factors associated with arneloblastoma. One hlllldred intrabony arneloblastoma and 50 age-sex matched samples as controls were evaluated by polymerase chain reaction for the detection and typing ofHPV. Fisher exact and chi square tests were used to assess the data. HPV DNA was detected in 32% of patients and 10% of controls. HPV-6 was the most prevalent genotype (31.6%) in infected cases. It was followed by HPV-11 (12.5%), HPV-16 (12.5%) and HPV-31 (3.1 %). We found a significant association between presence ofHPV and location of tumor (p = 0.02), traumatic history (p = 0.03) and ododontic therapy (p = 0.01). These findings indicated that HPV-6 probably is one of the most important etiologic agents in causing intraosseous arneloblastoma in Iranian population. Key words: Arneloblastoma, risk factors, PCR, human papillomavirus, Iran Introduction Arneloblastoma has been associated with the most complex group of pathogenic viruses. Eighty-five genotypes of HPV have been fully characterized (zur Hausen, 1999). The association between Human Papillomavirus (HPV) and development ofbenign and malignant oral neoplasm is well established (Bouda et al., 2000; Sumrnersgill et al., 2000; Van Rensburg et al., 1996; Miller et al., 1996; Fomatora et al., 1996; Dekrnezian et al., 1987). The role of HPV in oral cancer is inevitable and presumably HPV is a cofactor in 100% of patients who developed oral cancer in 4-12 years of age (Nielson et al., 1996). The specific HPV types, most notably types 16, 18 and a few others, have been shown to cause the majority of cervical cancers and their high-grade precursor lesions (zur Hausen, 1999). Some types also seem to be responsible for other anogenital and a subset of head Corresponding Author: 	 Dr. Abdolvahab Moradi, Department ofMicrobilogy, Medical School, Gargan University ofMedical Sciences, Gargan, Iran Tel: +98-171-44221651-3 1 Intl. J Viral., 2 (I): 1-6, 2006 and neck cancers (zur Hausen, 2002). Association between HPV and odontogenic cysts and tumors has been studied in a few cases (Sand et al., 2000). Particularly, types 6, 11, 16 and 18 have been detected in peripheral and intrabony ameloblastoma (Sand et al., 2000; Kahn, 1991, 1989). The aim of the current study was to investigate the presence of HPV in intrabony arneloblastorna by PCR, using consensus primers and identify different genotypes, using type-specific primers. Materials and Methods Through 1999-2000 one hlllldred blocks ofparaffin embedded tissue intraosseous arneloblastorna were retrieved from the archives of the Department ofOral Pathology, Dental School, Shahid Behesht:i University of Medical Sciences and the Department of Pathology, Taleghani General Hospital, Tehran. The tissues with arneloblastorna were providing confirmed by pathologists. The control samples selected from dental follicles of patients, referred to our clinics for excision were of their impacted teeth. They were selected if their histopathologic examinations showed no evidence of arneloblastic changes. All of the cases and controls were classified in four groups of age. With respect to the tumor site, 90 were located in mandible and 10 in maxilla. Thirty-five patients were smoker. We also recorded history of tooth extraction, endodontic surgery and tooth repair in cases and control groups. Four to six 5 µm sections were cut from each paraffin embedded tissue and placed in 2.5 rnL Eppendorf tubes. DNA was extracted as described previously (Fomatora et al., 1996). In brief, the sections were deparaffinized in 2 mL Xylene, this was repeated for three times. Xylene was pipetted off and its residue was removed using 2 mL of 100% ethanol. It was followed by vortexing and spinning. Most of the ethanol was pipetted off and the remaining was removed by incubation at 56°C for 30 min. Two hundrad microliter digestion buffer (50 mM KCL, 1.5 mM MgCl,, 10 mM HCL, 0.45% v/v Tween 20, 10 mg mL- 1 proteinase K (pH= 8.3) was added and incubated overnight at 36°C. Proteinase K was inactivated by incubation at 95°C for 8 to 10 min. This was followed by spinning at 7000 rpm for 5 min. The supernatant was collected in a clean and sterile tube and stored at -20°C for PCR processing. HPV DNA was amplified with GP''/GP'' primers (Jacobs et al., 1995), which amplify a portion of the Ll gene of most ofmucosal HPV types (Table 1). Preparations were also tested by Table 1: Polymerase chain reaction primers Type of primers Primers sequences Length ofPCR products (bp) p-globin• PC03 Y ACACAACTGTGTTCACTAGC 110 PC04 5, CAA CTT CAT CCA CGT TCA CC GP5+ Y TIT GIT ACT GTG GTA GAT ACT AC 150 GP6+ YGAA AAA TAA ACT GTA AAT CAT ATI C HPV6.1' +Y TAGTGGGCCTATGGCTCGTC 3' 280 HPV6.2 -5' TCCATIAGCCTCCACGGGTG 3' HPV 11.1' +Y GGA ATA CAT GCG CCA TGT GG 3' 360 HPV 11.2 -5' CGA GCA GAC GTC CGT ccr CG 3' HPV 16.1' +Y TGCTAGTGCTTATGCAGCAA 3' 152 HPV 16.2 -5' ATITACTGCAACATIGGTAC 3' HPV 18.1' +Y AAGGATGCTGCACCGGCTGA 3' 216 HPV 18.2 -5' CAC GCA CAC GCT TGG CAG GT 3' HPV31.1' +5' ATGGTGATGTACACAACACC 3' 514 HPV 31.2 -5' GTA GTT GCA GGA CAA CTG AC 3' HPV33.1' +Y ATGATAGATGATGTAACGCC 3' 455 HPV33.2 -5' GCA CAC TCC ATG CGT ATC AG 3' a-(Baay et al., 1996); b-(Jacobs et al., 1995); c-(Melchers et al., 1994) 2 -----------------------Intl. J Viral., 2 (I): 1-6, 2006 PCR with primers PC03 and PC04 (Baay et al., 1996), specific to the human p-globin gene to monitor the integrity of DNA in the samples and the potential of amplification. Only samples showing successful amplification of p-globins sequences were subjected to GP 5+/GP 6 + PCR. All HPV positive specimens were further analyzed with type-specific primers for HPV types 6, 11, 16, 18, 31 and 33 (Melchers etol., 1994) (Table 1). Ten rnicroliters of the DNA solution were used for PCR in 50 µL of reaction mixture, containing 10 mM Tris-HCl (pH~ 8.3), 50 mM KC!, 2.5 mM MgCl,, 0.01 % gelatin, 10 mM each dNTP (dATP, dTTP, dCTP, dGTP), 1 unit Taq polymerase and 50 pmol of each primers GP''/GP''. Each cycle included 1 min denaturat:ion at 94°C, annealing step at 40°C for 2 min and extension at 72°C for 1.5 min. Forty cycles of PCR amplification were performed. The first cycle was preceded by a 5 min denaturation at 95°C and the last cycle was extended by a 4 min elongation at 72°C. Descriptive statistic was performed and were analyzed by chi-square for categorical variables. Results Human Papillomavirus (HPV) DNA was detected in 32 (32%) patients and 5 (10%) of the controls. HPV genotyping using type-specific-primers, detected HPV-6, 11, 16 and 31 in 10 (31.6%), 4 (12.5%), 4 (12.5%), 1 (3.1%) positive of samples, respectively. Mix infection of types 6 and 16 was revealed in 2 (6.3%) positive samples. HPV 18 and 33 were not detected. Eleven (34.4%) HPV positive specimens were not identified by the specific primers used in this study (Table 2). HPV-6 was the predominant type, being present in 31.6% of the infected cases, either alone or together with other types. A significant association was observed between the location of tumor and the presence ofHPV (p = 0.02). There was a strong correlation between traumatic history and HPV infection (p = 0.03). In addition, HPV infection showed a significant correlation with age group of 36-45 years (p = 0.03). We folllld also a significant correlation between endodontic therapy and HPV presence (p = 0.01). In relation to further clinicopathologic features of the analyzed patients, statistical analysis revealed no correlation between HPV infection and gender, tooth extraction, smoking, type of tumor and history of operative dentistry procedure (Table 3). Table 2: Frequency of cases and controls and the results ofHPV types detection Cases Controls Characteristic n % HPV % n % HPV % Age/years 16-25 34 34 13 38.3 18 36 2 11.8 26-35 35 35 6 17.2 17 34 1 5.9 36-45 21 21 11 52.4 11 22 1 9.1 46-55 10 10 2 20.0 4 8 25.0 Table 3: Clinicopathological feahJre of samples and the results ofHPV detection Extraction Samples Ag~ear y,~ No Endo R~air Trauma Smoking HPV+ Cases 16-25 25 9 10 24 7 4 13 26-35 28 7 16 27 5 17 6 36-45 19 2 8 20 10 11 11 46-55 10 4 7 2 3 2 Controls 	 16-25 15 3 9 15 5 3 2 26-35 12 5 5 12 3 9 1 36-45 9 2 4 10 4 4 1 46-55 3 1 1 2 1 1 1 Total 121 29 57 117 37 52 37 3 Intl. J Viral., 2 (I): 1-6, 2006 Discussion The role of human papillornavirus infection in the development of benign, prernalignant and malignant lesions of oral mucosa has received attention in the past several years (Van Rensburg et al., 1996; Miller et al., 1996; Fornatora et al., 1996; Dekrnezian et al., 1987; Eversole et al., 1987). These lesions are surface epithelium-derived. Arneloblastorna is an epitheliurn-derivedlesion with odontogenic origin (Harada et al., 1998). Some studies suggest an association between HPV and arneloblastorna (Sand eta/., 2000; Kahn, 1991; Kahn, 1989; Harada et al., 1998; Van-Heerden et al., 1993). The HPV has been proposed to be one of the initiating factors by authors. Unspecified disturbances, including pressure and nutritional disturbances, rickets, extraction, caries and tooth repair, endodontic surgery, several oral sepsis, viruses might be of important in initiating ameloblastoma (Robinson, 1973; Tsahn and Nelson, 1980; Stanley et al., 1964; Ueno et al., 1986; Mehlisch et al., 1972; Goldberg and Friedman, 1975; Forsberg, 1954; Csiba et al., 1970; Levy and Ring, 1950; Main and Dawe, 1966; Fleining, 1963). In the present study, 32% of ameloblastoma specimens were HPV positive. Kahn found HPV in three (two intrabony and one peripheral) of thirty-eight juvenile ameloblastoma (Kahn, 1989). He concluded that the HPV presence in peripheral ameloblastoma is expected and proposed that the virus is acquired in uteri or at purhui.tition and involves the invaginating primitive enamel organ. He described the HPV-6/18 in a peripheral ameloblastoma (Kahn, 1991). In other study, Sand and his co-workers investigated 12 intrabony ameloblastoma by southern blot hybridization; five cases (42%) were HPV positive (Sand et al., 2000). In study cani.ed out in Texas, America on 5 patients types 11 and 16 were spotted (Dekrnezian et al., 1987). Interestingly in another report articulated by other workers concerning 62 samples, types 2, 6, 11 were detected (Eversole et al., 1987). Another worker detected HPV type 18 in ameloblastoma (Van-Heerden et al., 1993). Present findings showed a high prevalence of HPV-6 and 11 (31.6 and 12.5%, respectively). These types of HPV were found in one peripheral ameloblastoma in Kahn's study (Kahn, 1991) and in 4 of 8 (50%) HPV positives studied by Sand et al. (2000) HPV-16 was detected in 4 (12.5%) cases in the present study. Kahn (1991) also found this type in one peripheral ameloblastoma it was not detected. We also found HPV-31 in one (3.1 %) of HPV positive cases, it was not reported in other studies. HPV-18 that was detected (Kahn, 1991) and in 7 of 8 (87%) HPVpositive cases in was not found in our investigation (Sand et al., 2000). From the clinical point ofview, 56 (56%) of our cases were males and forty-four ( 44%) were females. Kahn (1989) reported that 47.4% were males and 52.6% were females, while in Sand investigation, 9 (75%) were males and 3 (25%) were females. However, it seems that there is no significant correlation between sex and HPV presence. A significant correlation between age and HPV infection was shown in the present study. All three cases were under 20 years old and in Sand study, almost all cases were between 44 to 53 years old. These correlation derived from different studies are not consistent and therefore, further investigation is needed to clarify possible correlation between age and HPV. In present investigation for the first time, an analytical study showed a significant correlation between intrabony ameloblastoma and HPV presence. These findings emphasis the role of HPV as an important etiologic factor of ameloblastoma. However, as Kahn (1989) proposed the penetration of HPV via the primitive oral mucosa to enamel organ and then dental follicle it is possible that HPV can penetrate from the oral squamous epithelium when a trauma, tooth extraction, endodontic surgery or similar stimulation occurs. Further studies need to test this hypothesis. Acknowledgements We wish to express our appreciation to Dr. Zinat Kamali and Dr. Farzaneh Kashanian for filling questionnaires and other information collection activities. 4 Intl. J Viral., 2 (I): 1-6, 2006 References Baay, F.D., G.V. Quiunt Win, J. Keudstaal, H. Hollema, D.M. lites, P.M.Matthe and D.B. Robert, 1996. Comprehensive study of several general and type specific primers for detection ofhuman papillornavirus DNA in paraffin embedded tissue cervical carcinoma. J. Clin. Microbial., 34: 745-747. Bouda, M., VG Gorgoulis and N.G. Kastrinahs, 2000. High-risk HPV types are frequently detected in potentially and malignant oral lesions, but not in normal mucosa. Mod. Pathol., 13: 644-53. Csiba, A., I. Okros, C.S. Dzsinich and D. Szabo, 1970. Virus like particle in a human arneloblastorna. Arch. Oral. Biol., 15: 817-826. Dekmezian, RH., J.G. Batsahs and H. Goepfert, 1987. In Situ Hybridization of papillomavirus DNA in head and neck squamous cell carcinoma. Arch. Otolaryngol. Head. Neck. Surg., 113: 819-821. Eversole, L.R., P.J. Laipis, P. Merrell and E. Choi, 1987. Dernonestrat:ion ofhuman papillornavirus DNA in oral condylorna acurninaturn. J. Oral. Pathol., 16: 266-272. Fleming, H.S., 1963. Polyomavirus tumor and the teeth. J. Dent Res., 42: 1405-1415. Forsberg, A., 1954. A contribution to the knowledge of the histology, histogenesis and etiology of adarnantinoma. Acta Odont. Scand., 12: 39-64. Fomatora, M., A.C. Jones, S. Kerpel and P. Freedman, 1996. Hurnanpapillomavirus associated oral epithelial dysplasia. Oral. Surg. Oral. Med. Oral. Pathol., 82: 47-56. Goldberg, S.J. and J.M. Friedman, 1975. Arneloblastoma: Review of the literature and report of case. JADA, 90: 432-438. Harada, H., T. Mitsuyasu, N. Nakamura, U. Higuchi, K. Toyoshima, A. Taniguchi and S. Yasumoto, 1998. Establishment ofameloblastoma cell line AM-1. J. Oral. Pathol. Med., 27: 207-712. Jacobs, M.V., A.M. de Roda Husman, A.J.V. van den Brule, P.J.F. Sniders, C.J.L. Meijer and J.M.M. Walboomer, 1995. Group-Specific differentiation between high and low-risk human papillomavirus genotypes by general primer-mediated PCR and two cocktails of oligonucleotide probes. J. Clin. Microbiol., 33: 901-905. Kahn, M.A., 1989. Arneloblastoma in young person: A clinicopathologic analysis and etiologic investigation. Oral. Surg. Oral. Med. Oral. Pathol., 67: 706-715. Kahn, M.A., 1991. Demonestration of HPV DNA in peripheral arneloblastoma by in situ Hybridization. Hum. Pathol., 23: 188-191. Levy, B. and J.R. Ring, 1950. The experimental production ofjaw tumors in hamster. Oral. Surg. Oral. Med. Oral. Pathol., 3: 262-271. Main, J.H.P. and C.J. Dawe, 1966. Tumor induction in transplated tooth buds infected with polyoma Virus. J. Nat Cancer. Inst, 39: 1121-1126. Mehlisch, D.R., D.C. Dahlen and J.K. Masson, 1972. Arneloblastoma a clinicopathologic report. J. Oral. Surg., 30: 9-22. Melchers, W., A. Ferrera, D. Willemse, J. Walboomers, 0. de Barahona, M. Figueroa and P. Snijders, 1994. Human Papillomavirus and cervical cancer in Honduran women. Arn. J. Trop. Med. Hyg., SO: 137-142. Miller, C.S. and D.K. \Vhite, 1996. Human papillomavirus expression in oral mucosa, premalignant condition and squamous cell carcinoma. Oral. Surg. Oral. Med. Oral. Pathol., 82: 57-68. Nielson, H., B. Norrild, P. Vedtofte, F. Praetorius, J. Rebel and P. Holmstrup, 1996. Human Papillomavirus in Oral Premalignant Lesions. Oral. Oncol. Eur. J. Cancer., 32: 264-270. 5 Intl. J Viral., 2 (I): 1-6, 2006 Robinson, H.B.G., 1973. Arneloblastorna: a survey of three hundred and seventy-nine cases from the literature. Arch. Pathol., 23: 831-835. Sand, L., J. Jalouli, P. Larsson, B. Magnusson and J.M. Hirsch, 2000. Presence of human papillornavirus in intraosseous arneloblastorna. J. Oral. Maxillofac. Surg., 58: 1129-1136. Stanley, H.R., C.J. Dawe and L.W. Law, 1964. Oral tumors induced by polyorna virus in mice. Oral. Surg. Oral. Med. Oral. Pathol., 17: 547-558. Surnmersgill, K.F., E.M. Smith, H.L. Kirchner, T.H. Haugen and L.P. Turek, 2000. P53 polymorphism, human papillornavirus infection in oral cavity and Oral. Cancer Oral. Surg. Oral. Med. Oral. Pathol., 90: 334-339. Tsakin, P.J. and J.F. Nelson, 1980. The maxillary arneloblastorna: An analysis of24 cases. J. Oral. Surg., 38: 336-342. Ueno, S., S. Nakamura, K. Mushirnoto and R. shiraso, 1986. A clinicopathologic study of ameloblastoma. J. Oral. Maxillofac. Surg., 44: 361-365. Van Rensburg, E.J., S. Engelbrecht, W.F.P. Van Heerden, E.J. Raubennheirner andB.D. Schoub, 1996. Human Papillornavirus DNA in oral squamous cell carcinoma from African population sample. Anticancer Res., 16: 969-973. Van-Heerden, W.F., D.J. Van-Resburg, E.J. Rauhenheirner and E.H. Venter, 1993. Detection of HPV DNA in an arneloblastorna using the in situ Hybridization technique. J. Oral. Pathol. Med., 22: 109-112. zur Hausen, H., 1999. Papillornavirus in human cancers. Proc. Assoc. Arn. Physicians, 111: 581-587. zur Hausen, H., 2002. Papillornaviruses and cancer: from basic studies to clinical application. Nature Rev. Cancer, 2: 342-350. 6 

Detection of human papillomavirus DNA in intraosseus ameloblastoma

http://eprints.goums.ac.ir/2434/1/Detection_of_human_papillomavirus_DNA_in_intraosseus_ameloblastoma.pdf

Detection of human papillomavirus DNA in intraosseus ameloblastoma

Abstract

Similar works

Full text

Available Versions

Golestan University of Medical Sciences Repository