Ahmed, Kawther K

Borcherding, Nicholas

et al,

Kim, Myung-Chul

Pandey, Gaurav

Voigt, Andrew P

English

Digital Commons@Becker

Supplementary information:  Title: CD177 modulates the functions and homeostasis of tumor-infiltrating regulatory T cells    First Authors: Myung-Chul Kim, DVM, Nicholas Borcherding, MD/PHD/MS, Kawther K. Ahmed, PHD, Andrew P. Voigt, BA  Corresponding Authors: Xuefeng Wu, PHD, Yousef Zakharia, MD, Weizhou Zhang, PHD    Supplementary Figures   Supplementary Figure 1. Differential gene expression of TI-Treg cells in single-cell RNA sequencing and pooled RNA sequencing.  a. tSNE projection of T cells from five HCC patients with normal PB cells and TI cells. TI Treg population (green, n=634) and PB-Treg population (grey, n=264) were isolated for further analysis.  b. tSNE projection with highlighted expression of Treg markers, FOXP3 and IL2RA (CD25). c. Differential gene expression analysis using the log-fold change expression versus the difference in the percent of cells expressing the gene comparing TI- versus PB-Treg cells (Δ Percentage Difference).  d. Venn diagram showing the overlap in differentially-expressed genes in TI Treg cells compared to PB-Treg cells in breast carcinoma (GSE89225), colorectal adenocarcinoma (PRJEB11844), and non-small cell lung carcinoma (PRJEB11844). e. Heatmap showing differential genes shared between the three datasets with immune-related genes labeled. Genes are displayed in log2-fold change comparing TI Treg cells versus PB Treg cells with FDR q-values <0.05.      Supplementary Figure 2. Transcriptional heterogeneity in single-cell RNAseq of HCC Treg cells. a. Trajectory manifold of Treg cells from the HCC using the Monocle 2 algorithm. b. Pseudotime projections of transcriptional changes in immune genes based on the manifold. c. Cell trajectory projections of transcriptional changes in immune genes based on the manifold. ?̅? denotes the scaled mean of each pole of the manifold.  d. Gene signature analysis of the poles of the trajectory manifold. Boxplot plot drawn for values between 25th and 75th percentile, with median value lines. Outlier values were graphed as individual points for values 1.5 times the interquartile range. P-values are based on one-way ANOVA with individual comparisons corrected for multiple hypothesis testing using the Tukey HSD method. e. Results of the cell cycle regression analysis of single cells for each cell fate using the Seurat R package.         Supplementary Figure 3. Clonotype analysis of TI- or PB-Treg cells. a. Percentages of assigned clonotypes by patients in PB- (upper panel) and TI-Treg cells (TM, lower panel).  b. Relative increase in clonotypes with two copies in the same patient comparing PB-Treg cells (grey) to TI-Treg cells (orange). Significance testing utilized T test with Welch’s correction.  c. Relative increase in clonotypes with three or more copies in the same patient comparing PB-Treg cells (grey) to TI-Treg cells (orange). b-c: two-sided unpaired T-test d. Cell trajectory projections of shared clonotype percentages by cell fate, combining the PB- and TI-Treg cells clonotypes of a single patient. Significance based on χ2 testing. e. Kaplan-Meier curves for overall survival in the TCGA KIRC/ccRCC using the CF1-Treg gene signature (upper panel) and TI-Treg common gene signature (lower panel) by the histological grades. Logrank test for trend was used for e.    e   Supplementary Figure 4. CD177+ TI lymphocytes are comprised of Treg cells. a. Trajectory manifold of Treg cells from HCC or PB with the number of CD177+ and CD177- Treg cells for each respective cell fate. Significance based on χ2 testing comparing the three poles of the manifold. b. Proportional distribution of CD177+ Treg cells by cell fate across the manifold from HCC. c. Violin plot showing mRNA expression of CD177 (upper panel) or Proportional distribution of CD177+ Treg cells from HCC, junctional zone, normal liver, or PB (lower panel). d. IHC staining protocol is established and the specificity of anti-CD177 antibody (clone: 4C4) is confirmed using isotype IgG on sequential sections of normal human colon tissue, scale bar = 100µm. Note colon-associated granulocytes were evident for CD177 positivity (lower panel) (n = 2 biological repeats). e. CD177 IHC staining on different normal human tissues showing CD177 expression on normal epithelium for select tissues as well as infiltrating leukocytes. Black arrows: epithelial cells; orange arrows: lymphocytes scale; bar = 200µm. (n = 2 biological repeats) f. CD177 protein expression within human splenocytes. Two human splenocytes from cancer patients (spleen-1 from melanoma and spleen-2 from pancreatic cancer) were analyzed by flow cytometry to quantify CD177 expression within different T cell subsets. g. Two additional breast cancer specimens were further analyzed for CD177 expression on Treg cells (CD4+FoxP3+ or CD4+CD25+FoxP3+) or conventional CD4 T cells (CD4 conv, CD4+CD25-) from TI lymphocytes in breast cancer or PBMC lymphocytes. h. Schematic flow cytometry data gating on lymphocytes (lym) or myeloid cells (mye) were further analyzed for CD177 expression on Treg cells (CD4+CD25+CD127-), conventional CD4 T cells (CD4 conv, CD4+CD25-CD127+/-) and CD8 T cells (CD8+) isolated from TI immune cells in breast cancer or PBMC. Schematic gating is used for Figure 4d-e as well. i. Representative dual IHC staining for CD177 (red) and FoxP3 (brown) in breast carcinoma section. Dual-positive cells are indicated with red arrows and FoxP3-positive cells are indicated by black arrows (n = 3 biological repeats).      Supplementary Figure 5. Schematic targeting mouse Cd177 gene locus using CRISPR/Cas9-based homologous recombination. Exon 2 was flanked by two LoxP sites and expected to be removed by cre DNA recombinase, which produces a stop codon after joining Exon 1 and Exon 3.      Supplementary Figure 6. Impact of Treg-specific Cd177-deficiency on immune cells within tumors or other tissues. a. Confirmation of Cd177-deficiency using real-time PCR analysis. Treg cells isolated from tumors from WT or KO mice in Figure 5b were subjected to mRNA isolation, reverse transcription, and real-time PCR analysis (n = 4) of Foxp3 (left) or Cd177 (right), using Ppia as the reference housekeeping gene. b. Depletion of TI-CD177+ Treg cells within Treg-specific Cd177-KO (Cd177fl/fl/Foxp3-Cre) mice (n = 5-8) from MC38-tumor-bearing mice in Figure 5c. a-b: All error bars represent mean  s.t.d. c. Schematic gating strategy for analysis of mouse lymphocytes from tumor or other tissues used in Figure 6a-c; Figure 7e; Supplementary Figures 7-8; 9b,d,h). Lymphocyte gating from all tissues was guided by lymphocyte population from mouse splenocytes. d-e. CD177 expression from (d) T cells or (e) neutrophils within different tissues of tumor-bearing mice. MC38 tumor-bearing WT or Treg-specific Cd177 KO (Treg-KO) mice were analyzed for CD177 protein expression from various T cell subtypes including Treg cells (CD4+CD25+FoxP3+) or neutrophils (CD11b+Ly6G+) within different tissues.      Supplementary Figure 7. Impact of Treg-specific Cd177-deficiency on immune cells within normal mice. 7-8-week-old mice – including 3-4 females and 3 males of WT or Treg-specific Cd177 KO mice – were analyzed for different immune cell populations from (a) blood, (b) spleen, (c) lymph node, (d) colon, (e) pancreas, and (f) thymus. All data are presented mean  s.t.d. Two-sided unpaired T-test was used for all group comparisons without adjustment for multiple comparisons.     Supplementary Figure 8. Impact of Treg-specific Cd177-deficiency on immune cells within tumor-bearing mice. MC38 tumor-bearing WT or Treg-specific Cd177 KO mice were analyzed for different immune cell populations from (a) tumor, (b) blood, (c) spleen, (d) draining or (e)  non-draining lymph nodes. f-g. Heatmap showing Treg-relevant gene expression of CD177+ and CD177- TI-Treg cells. CD177+ and CD177- TI Treg cells from 5 human breast cancer specimens (f, data adapted from GSE89225 with patient numbers included) or from our own ccRCC SCRS dataset (g, based on CD177 mRNA expression, GSE121638) were analyzed for Treg-relevant genes. All data are presented mean  s.t.d. Two-sided unpaired T-test was used for all group comparisons without adjustment for multiple comparisons.    Supplementary Figure 9. Functional characterization of CD177+ TI-Treg cells. a. Schematic gating strategy for analysis of mouse lymphocytes from tumors for Fig. 6f-j. b. FOXP3 expression within CD177+ or CD177- CD4+CD25+CD127low Treg cells from human cancer specimens, including 1 breast cancer, 3 ccRCCs and 2 colon cancers. Two-sided paired T-test was used here. c. FOXP3 mRNA expression of CD177+ and CD177- TI Treg cells from 5 breast cancer patients, data adapted from GSE89225. d. Validation of post-sorting purity by flow cytometry – illustrated by FOXP3 positivity – of CD177+ and CD177- TI Treg cells from breast cancer specimen. e. Impact of CD177 blockage on the immune suppressive function of CD177+ TI Treg cells. Total number of CD4 Tconv cells were enumerated (n=2, supplementary to Fig. 7b). f. Impact of anti-CD177 antibody on effector T cells. Effector CD4 and CD8 T cells from PBMC were purified and stimulated with anti-CD3 + APC with the presence of control IgG or anti-CD177 (MEM166) antibody. Total cells were enumerated after 4 days of incubation (n=3 biological replicates). g. Suppressive capacity of CD177+ or CD177- TI Treg cells isolated from WT or germline CD177-KO mice bearing MC38 tumors as in Figure 5b. Effector CD4 T cells were stimulated by anti-CD3/CD28 co-stimulation and combined with TI Treg cells at 2:1 ratio (n = 3 biological replicates). h. Impact of CD177-deficiency on effector CD4 and CD8 T cells. Effector CD4 and CD8 T cells were purified from splenocytes of WT or germline CD177-KO mice, stimulated by anti-CD3 + APC. Left: Histograms showing the CFSE dilution as indicator of T cell proliferation and right: Percent proliferation as defined by the histogram (n=3 biological replicates). i. Impact of Treg-specific Cd177-KO (cKO) on the suppressive capacity of splenic Treg cells from non-tumor bearing mice (n = 3 biological replicates). All data are presented mean  s.t.d. Two-sided unpaired T-test was used for all group comparisons without adjustment for multiple comparisons, unless otherwise indicated.   FC (mouse) Clone Company Cat# Color Dilution CD45.1 A20 BioLegend 110730 PE-CY7 1:100 CD45.2 30-F11 eBioscience 58-0451-82 AF532 1:100 CD45.2 104 BioLegend 9822 FITC 1:100 CD3 17A2 BioLegend 100241 BV711 1:100 CD3 17A2 BioLegend 100236 APC 1:100 CD3 17A2 BioLegend 100225 BV570 1:100 CD4 GK1.5 BioLegend 100434 PERCP-CY5.5 1:100 CD4 RM4-5 BioLegend 100548 BV605 1:100 CD8a 53-6.7 BioLegend 100752 BV510 1:100 CD8a 53-6.7 BioLegend 100744 BV605 1:100 CD8a QA17A07 BioLegend 155022 AF700 1:100 CD25 PC61 BioLegend 102008 PE 1:100 CD25 3C7 BioLegend 101904 PE 1:100 CD25 3C7 BioLegend 101916 PE-CY7 1:100 FOXP3 FJK-16S eBioscience 48-5773-82 EF450 1:50 CD11b M1/70 BioLegend 101235 BV421 1:100 CD11b M1/70 BioLegend 101256 PE-Dazzle 594 1:100 CD44 IM7 BioLegend 103040 BV421 1:100 CD44 IM7 BioLegend 103049 BV650 1:100 CD62L MEL-14 BioLegend 104440 BV785 1:100 CD45RB C363-16A BioLegend 103317 PE-CY7 1:100 CD177 Y127 BD Biosciences 566599 AF647 1:100 CD1D 1B1 eBioscience 62-001-182 SB436 1:100 CD80 16-10A1 BD Biosciences 746775 BV480 1:100 TIM3 5D12 BD Biosciences 747625 BV510 1:100 F4/80 BM8 BioLegend 123149 BV650 1:100 LY6C HK1.4 BioLegend 128037 BV711 1:100 LY6G 1A8 BioLegend 127606 FITC 1:100 MHCII I-A/I-E 2G9 BD Biosciences 565254 BB515 1:200 PD1 29F.1A12 BioLegend 135206 PE 1:100 Ki-67 16A8 BioLegend 652424 PERCP-CY5.5 1:100 B220 RA3-6B2 eBioscience 46-0452-82 PERCP-EF710 1:100 CD11C N418 BioLegend 117318 PE-CY7 1:100 CD19 6D5 BioLegend 115532 PERCP 1:100 GITR YGITR765 BioLegend 120222 PE-CY7 1:100       FC (Human) Clone Company Cat# Color Dilution CD45 HI30 BioLegend 982316 FITC 1:100 CD45 HI30 BioLegend 304036 BV510 1:100 CD3 HIT3a BioLegend 300312 APC 1:100 CD3 HIT3a BioLegend 300310 PE-CY5 1:100 CD4 RPA-T4 BioLegend 300556 BV605 1:100 CD4 OKT4 BioLegend 317433 BV421 1:100 CD8 SK1 BioLegend 344760 SB550 1:100 CD8 RPA-T8 BioLegend 301044 BV711 1:100 CD25 BC96 BioLegend 302622 AF700 1:100 CD25 M-A251 BioLegend 356108 PE-CY7 1:100 CD127 A019D5 BioLegend 351348 APC-CY7 1:100 CD127 A019D5 BioLegend 351316 APC 1:100 FOXP3 259D BioLegend 320216 Pacific Blue 1:50 FOXP3 259D/C7 BD Biosciences 560047 AF488 1:50 CD44 IM7 BioLegend 103049 BV650 1:100 CD45RA HI100 BioLegend 304140 BV785 1:100 CD62L DREG-56 BioLegend 304822 PE-CY7 1:100 CD177 MEM166 BioLegend 315806 PE 1:100 CD11b M1/70 BioLegend 101256 PE-Dazzle 594 1:100       Blocking experiment Clone Company Cat# Color Concentration CD177 MEM166 BioLegend 315802 Not Applicable 5 ug/ml CD177 1171A R&D SYSTEM MAB8186 Not Applicable 5 ug/ml CD177 Polyclonal LSBIO LS-C295622-100 Not Applicable 5 ug/ml Mouse IgG G3A1 Cell Signaling 5415S Not Applicable 5 ug/ml CD3e 145-2C11 BioLegend 553058 Not Applicable 1 ug/ml CD28 37.51 eBioscience 16-0281-82 Not Applicable 1.5 ug/ml  Supplementary Table 1. List of antibodies in this paper.  Real-time PCR primers Gene Primer sequence mCd177-1 CCGGGAGAATATGGAGACAC mCd177-2 CGCTGCTGCTCATAGACGTA mPpia-1 CAGTGCTCAGAGCTCGAAAGT mPpia-2 GTGTTCTTCGACATCACGGC mFoxp3-1 CTCGTCTGAAGGCAGAGTCA mFoxp3-2 TGGCAGAGAGGTATTGAGGG Genotyping Primers Gene Primer sequence mCd177-1 5’ loxp GTGTTGCGTTTCCTGCTTG mCd177-2 5’ loxp CTGGTTACCTTATGCCACTCC mCd177-1 3’ loxp GGGTTGCCAAGACTTGATAATG mCd177-2 3’ loxp AGGTGAGACACTAGAGAAGAGG  Supplementary Table 2. List of primers used for real-time PCR.   

CD177 modulates the function and homeostasis of tumor-infiltrating regulatory T cells

https://digitalcommons.wustl.edu/cgi/viewcontent.cgi?filename=0&article=12055&context=open_access_pubs&type=additional

CD177 modulates the function and homeostasis of tumor-infiltrating regulatory T cells

Abstract

Similar works

Full text

Available Versions

Digital Commons@Becker