al, et

Gallerand, Alexandre

Liu, Yongjian

Luehmann, Hannah P.

Sultan, Deborah H.

English

Digital Commons@Becker

Supplementary information for :  Brown adipose tissue monocytes support tissue expansion.   Authors  Alexandre Gallerand1£, Marion I. Stunault1£, Johanna Merlin1, Hannah P. Luehmann2, Deborah H. Sultan2, Maria M. Firulyova3, Virginie Magnone4, Narges Khedher1, Antoine Jalil5, Bastien Dolfi1, Alexia Castiglione1, Adelie Dumont1, Marion Ayrault1, Nathalie Vaillant1, Jérôme Gilleron1, Pascal Barbry4, David Dombrowicz6, Matthias Mack7, David Masson5, Thomas Bertero4, Burkhard Becher8, Jesse W. Williams9, Konstantin Zaitsev3, Yongjian Liu2, Rodolphe R. Guinamard1, Laurent Yvan-Charvet1 and Stoyan Ivanov1*  Affiliations 1 Université Côte d’Azur, INSERM, C3M, Nice, France. 2 Department of Radiology, Washington University School of Medicine, Saint Louis, Missouri 63110 United States. 3 Computer Technologies Department, ITMO University, Saint Petersburg, Russia. 4 Université Côte d'Azur, CNRS, IPMC, Valbonne, France. 5 Université Bourgogne Franche-Comté, LNC UMR1231, F-21000 Dijon, France. 6 Univ.Lille, Inserm, CHU Lille, Institut Pasteur de Lille, U1011-EGID, 59000 Lille, France.  7 Department of Internal Medicine - Nephrology, University Hospital Regensburg, Regensburg, Germany. 8 Institute of Experimental Immunology, University of Zürich, Switzerland. 9 Department of Integrative Biology and Physiology, Center for Immunology, University of Minnesota Medical School, Minneapolis, MN, USA.  £Equal contribution *Corresponding author  Correspondence to: Stoyan.ivanov@unice.fr     Figure S1. This figure is related to Figure 1. (A) (Left) Cell-sorting strategy used for isolation of BAT CD45+ cells before scRNA-Seq and (right) Single Cell RNA-Seq analysis of Ptprc expression among BAT CD45+ cells (B) Breeding scheme for generating Adipo∆/∆ mice. (C) TdTomato reporter expression (red) in epididymal (EAT) and brown (BAT) adipose tissues by fluorescence microscopy. (D) ATGL protein expression in Adipo∆/∆ mice brown adipose tissue (BAT) compared to controls (Ctrl) by Western Blot analysis; HSP90 was used as loading control for protein expression. (E) Glycerol levels in control (n=18) and Adipo∆/∆ (n=20) mice sera. p= 0,0096. (F) Myristic acid (C14:0), palmitic acid (C16:0) and a-linoleic acid (C18:3 n-3) levels in control (n=7) and Adipo∆/∆ (n=9) mice sera. p=0,0003 (left), p=0,0115 (middle), p= 0,0418 (right). (G) Lipidomic analysis of serum from control and Adipo∆/∆ mice. Data are represented in ratio compared to Ctrl condition ± SEM. Stars indicate a statistically significant difference between controls and Adipo∆/∆ mice (p<0,05). Panel C is representative of 3 experiments. Panel D represents one experiment. Panel E represents pooled data from 5 independent experiments. Panels F and G represent pooled data from 2 independent experiments. All data are represented in means ± SEM. Two-tailed Mann Whitney tests were used to determine statistical significance in panels E and F. ns p>0,05 ; * p<0,05 ; **<0,01 ; *** p<0,001 ; **** p<0,0001. Source data, and notably uncropped blots for panel S1D, are provided as a Source Data file. A.B.AdipoQcre-ERT2 TdTomato fl/+Pnpla2fl/fl CX3CR1gfpX X XCtrl Adipo∆/∆ATGLHSP90BAT5590kDaC.D.TdTomatoName Formula Ratio compared to ctrl +/- SEMLaureic acid C12:0 1,0437643 0,0457Myristic acid * C14:0 0,47300615 0,0328Palmitoleic acid C16:1 n-9 0,96329024 0,1434Methyl palmitoleic acid * C16:1 n-7 0,57340346 0,07513Palmitic acid * C16:0 0,73588931 0,06703Oleic acid C18:1 n-9 0,74614637 0,08332Trans-vaccenic acid C18:1 n-7 0,93253779 0,1181Stearic acid C18:0 0,83793297 0,05683linoleic acid C18:2 n-6 0,83610225 0,04359α-linolenic acid * C18:3 n-3 0,7386928 0,03713cis-11-Eicosenoic acid C20:1 n-9 0,8906383 0,09488dihomo-γ-linolenic acid C20:3 n-6 0,92904146 0,1156Mead acid C20:3 n-9 0,89803058 0,1329Arachidonic acid C20:4 n-6 0,9339235 0,109Eicosapentaenoic acid C20:5 n-3 1,00486347 0,1208Docosahexaenoic acid C22:6 n-3 0,90164926 0,1014E.F. G.PtprcSSC-AFSC-AFSC-AFSC-HDAPICD45-APC-Cy7Ctrl AdipoΔ/Δ0.00.10.20.30.40.5Glycerol (g/L)**Myristic acidCtrl AdipoΔ/Δ0.00.51.01.52.0C14:0 (fold change)***Palmitic acidCtrl AdipoΔ/Δ0.00.51.01.52.0C16:0 (fold change)*α-Linolenic acidCtrl AdipoΔ/Δ0.00.51.01.52.0C18:3 n-3 (fold change)*     B.050100150200MHC II (MFI normalized)AdipoΔ/ΔCtrlnsEAT MonocytesC. D.0.00.51.01.52.0EAT Monocytes (105) AdipoΔ/ΔCtrlns0510152025EAT Macrophages (105) nsAdipoΔ/ΔCtrlEAT Macrophages050100150200250CD206 (MFI normalized)AdipoΔ/ΔCtrlns050100150200250CD301 (MFI normalized)AdipoΔ/ΔCtrlnsF.I.A.J.E. G.CD206-APCCD226-PerCP-Cy5.5BAT MacrophagesBAT EAT0204060CD226high macrophages (% of macrophages)****AdipoΔ/ΔBAT EAT0204060CD206high macrophages (% of macrophages)AdipoΔ/Δ0.0788CD226CD206H.Ctrl BATΔ/Δ01234 **BAT Monocytes (103)Ctrl BATΔ/Δ012345 **BAT Macrophages (103)FSC-ASSC-ACD45-APC-Cy7SSC-ACD64-BV421MerTK-PEMacrophagesCD64-BV421CD11b-BV510MonocytesFigure S2. This figure is related to Figure 2. (A) Single Cell RNA-Seq analysis of the PID “lysophospholipid metabolism” pathway, the KEGG “glycerolipid metabolism” gene set and the KEGG “glycerophospholipid metabolism” gene set expression. (B) Single Cell RNA-Seq analysis of Mrc1 and CD226 expression among BAT monocytes and macrophages. (C) Gating strategy used for identification of tissue macrophages, and tissue monocytes in mice lacking the CX3CR1gfp reporter. (D) Representative dot plots (left) and proportions (right) of BAT and EAT CD206high and CD226high macrophages in Adipo∆/∆ mice (n=11). p=0,0788 (left), p<0,0001 (right). (E) Quantification of EAT macrophage and monocyte counts in control (n=11) and Adipo∆/∆ (n=16) mice using flow cytometry. p=0,3607 (left), p=0,1207 (right). (F) Quantification of BAT monocyte and macrophage numbers in control (n=6) and BAT∆/∆ (n=4) mice using flow cytometry. p= 0,0095 (left and right). (G) Quantification of surface MHCII expression on EAT monocytes in control (n=14) and Adipo∆/∆ mice (n=15) using flow cytometry. p=0,9095. (H) Quantification of surface CD206 and CD301 expression by EAT macrophages in control (n=11) and Adipo∆/∆ (n=16) mice using flow cytometry. p=0,6905 (left and right). (I) Single Cell RNA-Seq analysis of Mrc1 (CD206) and Clec10a (CD301) expression among BAT myeloid cells. (J) Single Cell RNA-Seq analysis of genes involved in cell proliferation. Panel D represents pooled data from 2 independent experiments. Panels E, G and H represent pooled data from 4 independent experiments. Panel F is representative from 2 independent experiements. All data are represented in means ± SEM. Two-tailed Mann Whitney tests were used to determine statistical significance. ns p>0,05 ; * p<0,05 ; **<0,01 ; *** p<0,001 ; **** p<0,0001. Source data are provided as a Source Data file.                                     Figure S3. This figure is related to Figure 3. (A) (Top panel) Representative photos showing the enlarged BAT in Adipo∆/∆ mice compared to control groups 16 days post-tamoxifen administration. (Bottom panel) Representative autoradiography images showing the increased 64Cu-DOTA-ECL1i signals in the BAT of Adipo∆/∆ mice compared to control groups 16 days post-tamoxifen administration. (B) Representative dot plots of blood monocytes in control and Adipo∆/∆ mice. (C) Quantification of blood neutrophil, T cell and B cell counts in control (n=12) and Adipo∆/∆ (n=14) mice using flow cytometry. p=0,4428 (left), p=0,5826 (middle), p=0,6848 (right). (D) Quantification of bone marrow LSK (Lin- Sca1+ cKit+) and monocytes in control (n=9 and 13 respectively) and Adipo∆/∆ (n=10 and 14 respectively) mice using flow cytometry. p=0,4002 (left) and p=0,0850 (right). (E) Bone marrow monocyte proliferation rate and survival in control (n=4 and n=5 respectively) and Adipo∆/∆ (n=8 and n=7 respectively) mice by flow cytometry. p=0,3144 (left), p=0,0657 (right). (F) Schematic representation of Brdu injection protocol to visualize monocyte export from bone marrow to blood (left) and its quantification by flow cytometry in control (n=5) and Adipo∆/∆ mice (n=7). p= 0,1490. Panels C and D represent pooled data from 4 independent experiments. Panel E (left) represents pooled data from 2 independent experiments. Panels E (right) and F are representative of one experiment. All data are represented in means ± SEM. Two-tailed Mann Whitney tests were used to determine statistical significance. ns p>0,05 ; * p<0,05 ; ** p<0,01 ; *** p<0,001 ; **** p<0,0001. Source data are provided as a Source Data file.   A. B.C.Adipo∆/∆CtrlCD115-PECD11b-BV510D.E. F.Ctrl AdipoΔ/Δ 051015Neutrophils (105/mL)nsCtrl  AdipoΔ/Δ 05101520T cells (105/mL)nsCtrl AdipoΔ/Δ 0.00.51.01.52.02.5B cells (105/mL)nsBloodCtrl AdipoΔ/Δ01234Monocytes (106)nsCtrl AdipoΔ/Δ0.00.51.01.52.0LSK (105)nsBone MarrowIV-BrdUinjection16hBlood sample 050100Monocyte export (%)AdipoΔ/ΔCtrlns020406080100Monocyte survival (%)AdipoΔ/ΔCtrlnsBMBMCtrl AdipoΔ/Δ0102030 nsMonocyte Proliferation (%) Figure S4. This figure is related to Figure 4. (A) Representative dot plots (left) and quantification (right) of blood and spleen monocytes in MC-21 (n=13 and 15 respectively) or vehicle-treated (n=15 and 18 respectively) Adipo∆/∆ mice. p= 0,0002 (left) and p<0,0001 (right). (B) (Left panel) EAT weight of MC-21 or vehicle-treated control (n=5 and 6 respectively) and Adipo∆/∆ (n=15 and 18 respectively) mice and (right panel) EAT adipocyte diameter measurement. p>0,05 (all comparisons). (C) Quantification of crown-like structures (CLS) (left) ) and immunofluorescence microscopy analysis in BAT of control (n=10) and MC-21-treated (n=9) Adipo∆/∆ mice. CX3CR1+/+ samples were used to determine background signal. White stars indicate crown-like structures. Scale bar = 100um. p=0,0364. (D) Glycerol, TG and NEFA levels in the serum of control (n=17) and MC-21-treated (n=15) Adipo∆/∆ mice. p= 0,2948 (left), p= 0,5800 (middle) and p= 0,4474 (right). Data were obtained from 3 pooled independent experiments. All data are represented in means ± SEM. Two-tailed Mann Whitney tests were used to determine statistical significance. ns p>0,05 ; * p<0,05 ; ** p<0,01 ; *** p<0,001 ; **** p<0,0001. Source data are provided as a Source Data file.   A. B.C.Vehicle MC-21051015CLS / fieldAdipoΔ/Δ* CX3CR1-GFP- CX3CR1-GFP+ AdipoΔ/ΔVehicleCX3CR1-GFP+ AdipoΔ/ΔMC-21*** ***Vehicle MC-21CX3CR1GFPCD11b-BV510BloodSpleenCD45+CD19- TCRb-Blood SpleenVehicle MC-2102468Monocytes (105 / mL)***AdipoΔ/ΔVehicle MC-21051015Monocytes (105)****AdipoΔ/ΔD.Vehicle MC-210.00.51.01.5NEFA (mmol/L)nsAdipoΔ/ΔVehicle MC-210123TG (mmol/L)AdipoΔ/ΔnsVehicle MC-210.00.51.01.52.0Glycerol (g/L)AdipoΔ/ΔnsEATVeh MC-21Veh MC-210204060Adipocyte diameter (µm)Ctrl AdipoΔ/ΔnsVehMC-21VehMC-210100200300400500EAT (mg)Ctrl AdipoΔ/Δns Figure S5. This figure is related to Figure 5. (A) a-SMA staining (red) in the BAT of Adipo∆/∆ mice. Autofluorescence signal (green) is used to show tissue architecture. Data representative of 2 independent experiments. (B) Histograms showing CLEC-2 and FMO stainings among BAT monocytes and macrophages from Adipo∆/∆ mice. Data representative of 2 independent experiments. (C) (Left) Quantification of MEF morphological features after a 18hour co-culture experiment with monocytes in the presence of anti-Podoplanin blocking antibody. (Right) Representative images of MEF morphology at the end of the co-culture experiment. Scale bar = 20µm. p=0,3784 (left) and p=0,9203 (right). Data representative of 2 independent experiments. (D) Quantification of BAT macrophage and monocyte numbers in anti-Podoplanin (n=8) and isotype control-treated (n=10) Adipo∆/∆ mice using flow cytometry. (E) Glycerol, TG and NEFA levels in the serum of isotype control (n=10) and anti-Podoplanin-treated (n=8) Adipo∆/∆ mice. Data were obtained from 2 pooled independent experiments. Panel C is representative of 2 independent experiments. Panels D and E represent pooled data from 2 pooled independent experiments. All data are represented in means ± SEM. Two-tailed Mann Whitney tests were used to determine statistical significance. ns p>0,05 ; * p<0,05 ; ** p<0,01 ; *** p<0,001 ; **** p<0,0001. Source data are provided as a Source Data file.   A. B.C.MEFs aPodoMEFs WT Monos aPodo01234MEFs MEFs +MonocytesCell area (x103 um2 )nsMEFs aPodoMEFs WT Monos aPodo0246810 nsMEFs MEFs +MonocytesProtrustions per cellMEFsMEFs WT MonosMEFs WT Monos TranswellMEFs WT Monos aPodoMEFs aPodo01000200030004000 *****MEFsMEFs +MonocytesMEFs +MonocytesTranswellMEFsMEFs WT MonosMEFs WT Monos TranswellMEFs WT Monos aPodoMEFs aPodo01000200030004000 *****MEFsMEFs +MonocytesMEFs +MonocytesTranswell+ anti-PodoplaninDAPIF-ActinFMOMonocytesFMOMacrophagesNormalizedto ModeClec2-PEAutofluorescenceaSMADAPID. E.Isot a-Pdpn0.00.51.01.5NEFA (mmol/L)AdipoΔ/ΔnsIsot a-Pdpn0.00.20.40.60.8Glycerol (g/L)AdipoΔ/ΔnsIsot a-Pdpn1.01.21.41.61.82.0TG (mmol/L)nsAdipoΔ/ΔBATIsot a-Pdpn0246810nsMacrophages (103)AdipoΔ/ΔIsot a-Pdpn01234 0.0705Monocytes (103)AdipoΔ/ΔSupplementary Table 1 Primers used for genotyping and RT-qPCR.   Mouse RT-qPCR Primer sequences Gene name Primer Forward (Left) Primer Reverse (Right) GAPDH ACCACAGTCCATGCCATCACTGCCA GGCCATCCACAGTCTTCTGC ß-Actin GAGACCTTCAACACCCC GTGGTGGTGAAGCTGTAGGC CXCL12 CCAAACTCTCCCCTTCAGAT ATTTCGGGTCAATGCACACT CCL2 CATCCACGTGTTGGCTCA GATCATCTTGCTGGTGAATGAGT TNF-a CACAAGATGCTGGGACAGTGA TCCTTGATGGTGGTGCATGA   Supplementary Table 2 List of reagents, materials, models and software used.  Reagent or resource Source Identifier  Antibodies   CD115 PE (clone AFS98) eBioscience Cat# 12-1152-82 CD11b Brilliant Violet 510 (cloneM1/70) Biolegend Cat# 101263 Gr1 PerCP-Cy5.5 (clone RB6-8C5) BD Biosciences Cat# 552093 Ly6C PerCP-Cy5.5 (clone HK1.4) Biolegend Cat# 128011 F4/80 PE-Cy7 (clone BM8) Biolegend Cat# 123114 CD45 APC-Cy7 (clone 30-F11) BD Biosciences Cat# 557659 CD64 Brillant Violet 421 (clone X54-5/7.1) Biolegend Cat# 139309 CD19 FITC (clone 6D5) Biolegend Cat# 115506 CD301 FITC (clone ER-MP23) Bio-Rad Cat# MCA2392 MerTK PE (clone 2B10C42) Biolegend Cat# 151506 CD11c PE-Cy7 (clone HL3) BD Biosciences  Cat# 558079 MHC II IA/IE APC (clone M5/114.15.2) Biolegend Cat# 107618 CD206 PerCp-Cy5.5 (clone C068C2) Biolegend Cat# 141715 CD206 AF647 (clone C068C2) Biolegend Cat# 141712 CD226 PerCp-Cy5.5 (clone10E5) Biolegend Cat# 128813 Clec2 PE (clone 17D9/CLEC-2) Biolegend Cat# 146103 TCRb PB (clone H57-597) Biolegend Cat# 109226 CD3 APC (clone 17A2) Biolegend Cat# 100236 NK1.1 APC (clone PK136) Biolegend Cat# 108720 Ter119 APC (clone TER-119) Biolegend Cat# 116212 B220 APC (clone RA3-6B2) BD Biosciences Cat# 561226 CD19 APC (clone REA749) Miltenyi Biotec Cat# 130-111-884 CD150 PE-Cy7 (clone TC15-12F12.2) Biolegend Cat# 115914 Sca1 PB (clone D7) Biolegend Cat# 108120 c-Kit APC-Cy7 (clone ACK2) eBioscience Cat# 47-1172-82 CD48 AF488 (clone HM48-1) Biolegend Cat# 103414 Mouse Genotyping Primer sequences Gene name Primer Forward (Left) Primer Reverse (Right) GAPDH ACCACAGTCCATGCCATCACTGCCA GGCCATCCACAGTCTTCTGC ß-Actin GAGACCTTCAACACCCC GTGGTGGTGAAGCTGTAGGC CXCL12 CCAAACTCTCCCCTTCAGAT ATTTCGGGTCAATGCACACT CCL2 CATCCACGTGTTGGCTCA GATCATCTTGCTGGTGAATGAGT TNF-a CACAAGATGCTGGGACAGTGA TCCTTGATGGTGGTGCATGA CXCR4 APC (clone 2B11) eBioscience Cat# 51-9991-80 CD11b APC (clone M1/70) Biolegend  Cat# 101218 MC-21 Dr Mack M.   Podoplanin (clone 8.1.1) BioXCell Cat# BE0236 InVivoMAb polyclonal Syrian hamster IgG BioXCell Cat# BE0087 Ly6G Biotin (clone REA526) Miltenyi biotec Cat# 130-116-512 CD3 Biotin (clone REA641) Miltenyi biotec Cat# 130-123-861 B220 Biotin (clone REA755) Miltenyi biotec Cat# 130-110-844 NK1.1 Biotin (clone REA1162) Miltenyi biotec Cat# 130-120-513 Ter-119 Biotin (clone Ter-119) Miltenyi biotec Cat# 130-120-828 SiglecF Biotin (clone REA798) Miltenyi biotec Cat# 130-112-329 a-SMA Abcam Cat# ab5694 Goat anti Rabbit Cy3 Jackson ImmunoResearch Cat# 111-165-003  Chemicals   DAPI Sigma Cat# D9542 Phalloidin Texas Red Invitrogen Cat# T7471 PFA 4% VWR International Cat# 9713.1000 Bovine serum Albumin (BSA) Sigma Cat# A7030 Tamoxifen Sigma Cat# T5648 RPMI medium Life Technologies Cat# 21875091 DMEM medium  Life Technologies Cat# 11960044 Collagenase A Sigma Cat# 11088793001 IHC Antigen retrieval solution  eBiosciences Cat# 00-4955-58 ImmunoHistoMount Sigma Cat# I1161 Thiazolyl blue tetrazolium bromide Sigma Cat# M2128 Fetal bovine serum  Fisher Scientific Cat# 12350273 Lysing buffer BD Biosciences Cat# 555899 L-Glutamine Life Technologies Cat# 25030024 Penicillin Streptomycin Life Technologies Cat# 15070063 Sodium Pyruvate Life Technologies Cat# 11360039 Free glycerol reagent Sigma Cat# F6428 Power SYBRTM green PCR Master Mix Applied Biosystems Cat# 4367659 RIPA buffer Cell signaling Cat# 9806 Anti-Biotin MicroBeads Miltenyi Biotec Cat# 130-090-858  Critical commercial Assays   High-Capacity cDNA reverse transcription kit Applied Biosystems Cat# 4368814 CCL2 DuoSet ELISA R&D Systems Cat# DY479-05 TNF-alpha DuoSet ELISA R&D Systems Cat# DY410-05 RNeasy Plus Mini Kit (250) QIAGEN Cat# 74136 Mouse CXCL12/SDF-1 DuoSet ELISA R&D Systems Cat# DY460 (Stromal Cell Derived Factor 1), Human, Elisa Kit EUROMEDEX Cat# EH3755 NEFA-HR2 R1 + R2 FUJFILM WAKO Cat# W1W270-77000 Glucose dosage Kit BioSentec Cat# 075 Triglyceride dosage Kit DiaSys Cat# 157109910021 BrdU APC Staining Kit  ThermoFisher Cat# 8817-6600-42 0.4 µm Cell culture Inserts 24 well format Falcon Cat# 353095    Experimental models: Organisms/Strains Mouse: C57BL/6-Tg(Adipoq-cre/ERT2)1Soff/J The Jackson laboratory JaxStock# 025124 Mouse: B6.FVB-Tg(Ucp1-cre)1Evdr/J The Jackson laboratory JaxStock# 024670  Mouse: B6N.129S-Pnpla2tm1Eek/J The Jackson laboratory JaxStock# 024278 Mouse: B6.129P-Cx3cr1tm1Litt/J The Jackson laboratory JaxStock# 008451 Mouse: B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J The Jackson laboratory JaxStock# 007909 Mouse: C57BL/6NTac-Ccr2tm2982(T2A-Cre7ESR1-T2A-mKate2] Dr. Burkhard Becher N/A Mouse: CCR2GFP  Dr. Marco Colonna N/A Cell line : Mouse Embryonic Fibroblasts (MEFs) ATCC  CRL-2907  Accessories   StepOne Applied Biosystem N/A Thermo Cycler SimpliAmp Applied Biosystem N/A Nanodrop OZYME  MACS Multistand Miltenyi Biotec Cat# 130-042-303 MACS LS Columns Miltenyi Biotec Cat# 130-042-401  Softwares   Prism6 GraphPad N/A FlowJo Tree Star N/A Fuji Fiji N/A GENEsys Syngene N/A StepOne Software v.2.2.2 Applied Biosystem N/A Fiji https://imagej.net/software/fiji/ N/A  

Brown adipose tissue monocytes support tissue expansion

https://digitalcommons.wustl.edu/cgi/viewcontent.cgi?filename=0&article=11767&context=open_access_pubs&type=additional

Brown adipose tissue monocytes support tissue expansion

Abstract

Similar works

Full text

Available Versions

Digital Commons@Becker