Bonni, Azad

Ferguson, Cole J.

Fitzpatrick, James A. J.

Gabel, Harrison W.

Goncalves, Tassia M.

Kong, Lingchun

Liu, Hai-Kun

Majidi, Shahriyar P.

Moore, Michael

Nemera, Mati

Reddy, Naveen C.

Yamada, Tomoko

Zhao, Guoyan

English

Digital Commons@Becker

Supplementary Information CHARGE Syndrome Protein CHD7 Regulates Epigenomic Activation of Enhancers in Granule Cell Precursors and Gyrification of the Cerebellum   Naveen C. Reddy, Shahriyar P. Majidi, Lingchun Kong, Mati Nemera, Cole J. Ferguson, Michael Moore, Tassia M. Goncalves, Hai-Kun Liu, James A. J. Fitzpatrick, Guoyan Zhao, Tomoko Yamada, Azad Bonni, Harrison W. Gabel  8,039Ctrl cKOCHD7GAPDHacgCtrl cKOCHD7 HoechstEGLMLIGLEGLMLIGL25%75%RNA pol II + RNA pol II -bCtrl cKO HypoactivityTemporal lobe morphology Ataxia Locomotor coordination Forebrain development CognitionLearning/memory/conditioning Cerebral hemisphere morphology Synaptic transmissionCNS synaptic transmissionP4/P22 active enhancers-Log10 (adj. P-Value)0 10 20 30 40chr5100150801001001001003300K 3400K 3500KChd7 CtrlATAC CtrlRNACtrlH3K27ac CtrlH3K4me1 CtrlH3K27ac CtrlRNACtrlP4P22dCdk6CHD7 HoechstefCell migrationVestibular/ear phenotypeTelencephalon morphologyPostnatal lethalityNeuron morphologyBrain developmentChoroid plexus morphologyNervous system developmentBrain ventricle morphologyBrain morphologyTremorsTouch/nociceptionChannel responsesSeizuresConvulsive seizuresResponse to xenobioticAtaxiaImpaired coordinationCNS synaptic transmissionSynaptic transmissionLethality fetal growth/weaningCoordination/movementBehaviorBrain morphologyNervous system morphologyGrowth/size phenotypePreweaning lethalityNervous system phenotypeMortality/agingSurvivalCHD7 negativeP22 specific active enhancersCHD7 negativeP4 specific active enhancersCHD7 negativeP4/P22 active enhancers0 10 20 30 40 50 0 10 20 30 40 500 5 10 15 20 25-Log10 (adj. P-Value) -Log10 (adj. P-Value) -Log10 (adj. P-Value)250 kDa37 kDaSupplementary Fig. 1: Conditional CHD7 knockout in mouse cerebellum. a. P4 sagittal cerebellar sections from CHD7 ctrl (left) and cKO (right) mouse lines were subjected to immunohistochemistry by using antibodies recognizing CHD7 and DNA dye bisbenzimide (Hoechst). Experiment was repeated two times for each condition. Scalebar: 100um. b. P4 cerebellar sections from CHD7 ctrl (left) and cKO (right) mouse lines were subjected to immunohistochemistry by using antibodies recognizing CHD7 (left) and DNA dye bisbenzimide (Hoechst, right). EGL, external granule layer; ML, molecular layer; IGL, internal granule layer. Experiment was repeated two times for each condition. Scalebar: 25um. c. Immunoblotting of CHD7 (top) and GAPDH (bottom) in lysates of P4 mouse cerebellum harvested from CHD7 ctrl and cKO mice. Experiment was repeated three times for each condition. d. WashU Epigenome Browser view of a CHD7 bound P4-specific active enhancer (highlighted).  ChIP-seq coverage for CHD7, H3K27ac, H3K4me1, as well as, ATAC-seq and RNA-seq is shown. e. GREAT analysis showing enriched mouse phenotypes associated with enhancers active at P4 and P22. f. GREAT analysis showing enriched mouse phenotypes associated with CHD7-negative enhancers active at P4 specifically (left), P4 and P22 (middle), and P22 specifically (right). g. Pie chart representing proportion of CHD7 occupied poised enhancers displaying RNApolII binding.  Log2 intra-domain contacts (cKO/Ctrl)Log2 H3K27ac FC (cKO/Ctrl)Compartmental domains Loop domains0-0.10-0.050.050.100-0.10-0.050.050.10-1.5 -1.0 -0.5 0 0.5 1.0 -1.5 -1.0 -0.5 0 0.5 1.0Log2 H3K27ac FC (cKO/Ctrl)r = 0.240 r = 0.343All regions Active enhancersLog 2CTCF FC (cKO/Ctrl)Log 2RAD21 FC (cKO/Ctrl)CHD7- CHD7+ CHD7- C HD7+cKO1cKO2cKO3Ctrl1Ctrl2Ctrl3cKO1cKO2cKO3Ctrl1Ctrl2Ctrl3Contacts (x108 )2.55.07.50Ctrl cKOTotalLong-range cisShort-range cisTrans0-0.5-1.00.51.0Log2 O/E FC (cKO/Ctrl)CHD7- CHD7+ CHD7- CHD7+ATAC down ATAC upadb cef-0.5-1.00.51.00All regions Active enhancersCHD7- CHD7+ CHD7- C HD7+-0.5-1.00.51.002,311TADs 2,306 2,373Loops 9,764 11,422 13,559Loop domains 588 589 602Comp. domains 1,723 1,717 1,771Ctrl cKO Total0.6 0.7 0.8 0.9 1g0.5Reproducibility scoreDensity0505DensitySupplementary Fig 2: Conditional CHD7 knockout minimally alters genomic architecture and associated regulatory factors.  a. Distribution of pooled Hi-C contacts in CHD7 ctrl and cKO cerebellum.     b. Hi-C Spector analysis for reproducibility of CHD7 ctrl and cKO biological replicates. c. Table summarizing results of Hi-C analysis. d. Box-whisker plots showing the median, 1st quartile, 3rd quartile, and whiskers displaying the 5th and 95th percentiles of intradomain loops representing median and distribution of the log2 fold change of observed over expected Hi-C signal at CHD7 bound and unoccupied domains separated by decreasing (n=59, n=716) or increasing (n=14, n=192) ATAC-seq signal change in CHD7 cKO over ctrl. e. Density plots comparing the log2 fold change in H3K27ac-seq signal at CHD7 bound peaks in a contact domain with the log2 fold change in Hi-C contacts in compartmental domains (left) and loop domains (right). f. Box-whisker plots showing the median, 1st quartile, 3rd quartile, and whiskers displaying the 5th and 95th percentiles of CTCF occupied regions representing median and distribution of the log2 fold change of CTCF signal at all regions (n=13,758, n=1,088) and active enhancer (n=598, n=606). g. Box-whisker plots showing the median, 1st quartile, 3rd quartile, and whiskers displaying the 5th and 95th percentiles of RAD21 occupied regions representing median and distribution of the log2 fold change of RAD21 signal at all regions (n=15,188, n=8.623) and active enhancer (n=1,209, n=2,506).     a******0-11Log 2 RNA FC (cKO/Ctrl)0-112nsns **Log 2 RNA FC (cKO/Ctrl)Log2 ATAC FC (cKO/Ctrl) Log2 ATAC FC (cKO/Ctrl)Enhancer/gene changeUp DownCHD7 - 348 144CHD7 + 159 653p = 9.68E-77CHD7- CHD7+ CHD7- CHD7+ATAC down ATAC upLog2 O/E FC (cKO/Ctrl)0-0.5-1.00.51.0df-3-2-10123-1 0 1 2Log2 ATAC FC (cKO/Ctrl)Log2 RNA FC (cKO/Ctrl)Log2 RNA FC (cKO/Ctrl)-3-2-1012-1 0 1-2Log2 ATAC FC (cKO/Ctrl)Chroma�n org., transcrip�onal repressionCell projec�on org.Plasma membrane bound projec�on org.Locomo�onCellular component morph.Chroma�n silencingRepression of gene expression, epigene�cRegula�on of biological qualityRegula�on of biological processAxon developmentCell part morph.AxonogenesisCell projec�on morph.Plasma membrane bound projec�on morph.Neuron projec�on morph.Cell communica�onSignalingCell morph., differen�a�onRegula�on of cellular processCell morph. , neuron differen�a�onCell deveopmentCell Morph.System developmentBiological regula�onMul�cellular organismal processAnatomical structural developmentDevelopmental processCellular developmental processMul�cellular organism developmentCell differen�a�onNeuron developmentNeuron projec�on developmentNervous system developmentNeuron differen�a�onNeurogenesisGenera�on of neuronsCell communica�onCellular developmental processSignalingCell differen�a�onCell surface receptor signalingMul�cellular organismal processAnatomical structure developmentExtracellular structure org.Signal transduc�onExtracellular matrix org.Developmental process-Log10 (adj. P-Value)-Log10 (adj. P-Value)0 2 4 6 80 1 2 3 4 5CHD7 ac�vated biological processesCHD7 repressed biological processescber = 0.358r = 0.346 0.01.00.01.2DensityDensitySupplementary Fig. 3: Conditional CHD7 knockout disrupts many biological processes by changing enhancer accessibility and corresponding gene expression.  a. Panther gene ontology analysis of significantly dysregulated genes associated with CHD7 ChIP-seq peaks (p <= 0.05). Significantly enriched biological processes are shown for CHD7 activated (top, blue) and CHD7 repressed (bottom, red) genes.  b. Density plots comparing the log2 fold change in enhancer ATAC-seq signal to the log2 fold change in RNA expression of correspond gene. c. Table displaying number of significantly changed enhancers in the CHD7 cKO for which transcript levels of the gene linked to that enhancer change in the same direction as the enhancer. Enhancers are paired to a gene within 100Kb and withing the same TAD. P-value = 9.68E-77, one-sided Chi-squared test. d. Box plots showing the median, 1st quartile, 3rd quartile, and whiskers displaying the 5th and 95th percentiles of E-P pairs representing median and distribution of the log2 fold change of observed over expected Hi-C signal at CHD7 bound (2,203) and unoccupied (2,972) domains separated by decreasing (n=116, n=558) or increasing (n=308, n=156) ATAC-seq signal change in CHD7 cKO over ctrl. e. Density plots comparing the log2 fold change in domain ATAC-seq signal to the log2 fold change in RNA expression of correspond genes.  f.  Box-whisker plots showing the median, 1st quartile, 3rd quartile, and whiskers displaying the 5th and 95th percentiles of CHD7 bound proximal genes within TADs representing median and distribution of the log2 fold change of RNA signal in CHD7 cKO over CHD7 control. Active enhancers were divided into three groups based on significantly increasing or decreasing changes in ATAC-seq signal. We then quantified the change in gene expression of corresponding genes within groups defined by ATAC-seq changes. Boxplots are divided into groups of decreasing (left; n=399, n=399, n=398) and increasing (right; n=113, n=113, n=112) ATAC-seq fold change **p < 0.01, unpaired two-sided t-test,  Tukey’s multiple comparison test.   abGFAPHoechstdP3:proliferativeP14: post-proliferative P60:adult0246810P4P3 P7 P14 P60Number of gyriCtrl cKOCtrl cKOCtrl cKOfCtrl cKOcIGL thickness (um)I III V0100200300Ctrl cKO020406080020406080EGL thickness (um)EGL thickness (um)** ****** ** ************* ***** nsehgAP DV-20-15-10-50% Change in lengthM S+1 S+2S-2S-1M S+1 S+2S-2S-1Ctrl cKOCtrl cKOSupplementary Fig. 4: Cerebellar microgyria appears at the proliferative stage of granule cell precursor development.  a. Nano CT mediolateral scans of lobule IX of Ctrl (left) and cKO (right) p56 mouse cerebella. Scale bar: 2mm. b. Nano CT midline sagittal scans of Ctrl (left) and cKO (right) p56 mouse cerebella. Scale bar: 2mm. c. Bar graphs showing % change in total cerebellar (Cb) anterior-posterior (AP) and dorsoventral (DV) measurement upon CHD7 cKO in p56 mice (n=3 for each condition).  Length is shown as mean  s.e.m for each measurement. *p<0.05, **p<0.01 Paired two-sided t-test. d. Immunohistochemistry analysis of Ctrl and cKO p56 mice with antibodies recognizing GFAP, a marker of glial cells, and Hoechst. Experiment was repeated two times for each condition. Scalebar: 100um. e. Bar graph showing internal granule cell layer (IGL) thickness +/- s.e.m. of lobules I, III, and V for Ctrl and cKO p56 mice (n=3 for each condition). p= 0.0382 (I), p=0.0072 (III), p=0.9556 (V) Two-way ANOVA test; ns, not significant. f. Nano CT scans were taken of multiple stages of granule cell development. Onset of postnatal GCP proliferation (P3: proliferative); post GCP proliferation (P14: post-proliferative); adult granule cells (P60: adult). Scale bar: 500um (top), 2mm (middle and bottom). g. Graph displaying the time course of formation of additional gyri in CHD7 cKO mice. h.  Graphs displaying the thickness of the EGL +/- s.e.m. along the mediolateral plane of Ctrl and cKO P3 (top) and P4 (bottom) mice. Midline (M), Sulcus (S). *p<0.05, **p<0.01, ****p<0.0001.Two-way ANOVA.   n sn sn sb cd020406080100Bipolar Multipolar% of granule cellsCtrl cKO012345Dendrite numberLength Width Forelimb Hindlimbn sn sBody size (cm)051015n sn sStride width (cm)051015Ctrl cKOn s n sStride length (cm)051015 n s n sStride freq. (steps/s)012345Forelimb HindlimbForelimb HindlimbCtrlcKOArea (mm2 )02340 1 2 3 54EGL length (mm)0 1 2 3 54EGL length (mm)Folding Index00.51.01.5en spH3+ cells/100um2051015Ctrl cKOaP 3 CtrlP 3 cKOP 4 CtrlP 4 cKOSupplementary Fig. 5: Loss of CHD7 results in mediolateral differential expansion of granule cell precursors without perturbing post-proliferative granule cell development and gross motor output of mouse cerebellum.  a. Immunohistochemistry analysis of posterior cerebellum of Ctrl and cKO mice (n=3 for each condition) with antibodies recognizing phosphorylated histone H3 (pH3), a marker of dividing cells. Dividing cells were counted in the region posterior to the secondary fissure of the cerebellum (lobules IX and X), referred to in shorthand as the posterior cerebellum. Bar graphs show mean pH3 positive cells per 100um2 +/- s.e.m. ns = non-significant. Paired two-sided t-test. b. CHD7 Ctrl (n=3) and cKO (n=3) mice were electroporated at P6 with the pCAG-GFP vector and fixed 2 days later in order to identify migrating granule cells. Granule cells with a parallel fiber and one leading process were considered to be bipolar, while granule cells with a parallel fiber and multiple processes were considered to be multipolar. Percentage of bipolar and multipolar granule cells +/- s.e.m. was calculated for each mouse and analyzed for significance. One-sided Chi-square test. ns, not significant.  c. CHD7 Ctrl (n=3) and cKO (n=3) mice were electroporated at P6 with the pCAG-GFP vector and fixed 8 days later in order to identify mature granule cells. The number of dendrites of GFP positive cells were counted in each mouse and then averaged. Bar graphs show average dendrite numbers +/- s.e.m. . Two-sided t-test. ns, not significant. d. Scatter plots of cross sectional P3 and P4 cerebellum area (left) and folding index (right) vs EGL length. EGL length was measured in the anterior cerebellar vermis using Nano CT sections. Area was also quantified using Nano CT sections of the anterior cerebellar vermis. Folding index is the ratio of the EGL length to the length of the anterior cerebellar vermis. Slope of Ctrl (black line) and cKO (red line) define expansion properties of cerebellum. e. Analysis of body size and gait dynamics by Digigait assay did not reveal deficits in sex-matched cKO mice (n=14) relative to control (n=11) littermates on stride-related variables for both the forelimbs and hindlimbs. Data are presented as mean values +/- s.e.m. Two-way ANOVA with Sidak’s multiple comparison test.   0 4 8 0 4 80 15 30Human CHD7 Human H3K27ac Human Input-5.0 5.0Distance from center (kb)-5.0 5.0Distance from center (kb)-5.0 5.0Distance from center (kb)Enrichmenta bPAX6HoechstCalbindinHoechstS100BHoechst3,000K 4,000Kchr6TUBB2B3,200K 3,400K 3,600K 3,800Kc2,800K2,600K33,900K 34,900Kchr13Tubb2b34,100K 34,300K 34,500K 34,700K33,700K33,500Kchr5 71,000K 72,000K70,800K 71,200K 71,400K 71,600K 71,800K 71,200K 71,400Kchr13 99,000K 100,000K99,200K 99,400K 99,600K 99,800K 100,200K 100,400K 100,600KMAP1BMap1bHumanMouseHumanMouseSupplementary Fig. 6: CHD7 expression and genomic-wide occupancy in granule cell precursors of fetal human cerebellum.  a. Immunohistochemistry analysis of 22 gestational week human cerebellum with Hoechst and antibodies recognizing PAX6 (top), calbindin (middle), and S100B (bottom). Experiment was performed once on the individual human sample. Scale bar: 100um. b. Heatmap of ChIP-seq signal for human CHD7 (purple), human H3K27ac (blue), and input (black) centered on human CHD7 genomic binding sites (n=17,100). c. YUE lab Hi-C browser (http://3dgenome.fsm.northwestern.edu/view.php )  view of the TUBB2B and MAP1B loci showing the location of conserved CHD7 bound regulatory elements found within conserved topologically associated domains surrounding the TUBB2B and MAP1B loci in mouse cerebellar and in human prefrontal cortical tissue. Mouse data is aligned to mm10 and human data is aligned to hg19. TAD domains are shown in yellow and blue. Enhancers (light blue) and gene loci (black) are shown below TAD domains. Data from Schmitt et al., 2016.  Supplementary Table 1: Number of reads per sequencing sample.Sample_ID Total ReadsP4_ChIP_CTCF_cKO_1 30239450P4_ChIP_CTCF_cKO_2 23882825P4_ChIP_CTCF_cKO_3 26785055P4_ChIP_CTCF_Ctrl_1 23887827P4_ChIP_CTCF_Ctrl_2 22184978P4_ChIP_CTCF_Ctrl_3 30176045P4_ChIP_RAD21_cKO_1 25335111P4_ChIP_RAD21_cKO_2 28519279P4_ChIP_RAD21_cKO_3 21699710P4_ChIP_RAD21_Ctrl_1 20240974P4_ChIP_RAD21_Ctrl_2 22291115P4_ChIP_RAD21_Ctrl_3 21406366P4_ChIP_RNAP2_cKO_1 24645904P4_ChIP_RNAP2_cKO_2 31224374P4_ChIP_RNAP2_cKO_3 21358159P4_ChIP_RNAP2_Ctrl_1 25754990P4_ChIP_RNAP2_Ctrl_2 28502519P4_ChIP_RNAP2_Ctrl_3 24704851P4_ChIP_H3K27ac_cKO_1 29513035P4_ChIP_H3K27ac_cKO_2 22791409P4_ChIP_H3K27ac_cKO_3 27244501P4_ChIP_H3K27ac_Ctrl_1 28288347P4_ChIP_H3K27ac_Ctrl_2 24439089P4_ChIP_H3K27ac_Ctrl_3 31269223P4_ChIP_H3K4me1_Ctrl_1 24185291P4_ChIP_H3K4me1_Ctrl_2 25040047P4_ChIP_H3K4me1_Ctrl_3 24006539P4_ChIP_H3K4me1_cKO_2 19872430P4_ChIP_H3K4me1_cKO_3 25111457P4_ChIP_H3K4me3_Ctrl 20774101P4_Input_cKO 24975122P4_Input_Ctrl 22278616P4_ChIP_CHD7_Ctrl_1 36321205P4_ChIP_CHD7_Ctrl_2 34366964P4_ChIP_CHD7_cKO 60536381P4_CHD7_Input_cKO 34726055P4_CHD7_Input_Ctrl 36168280P4_ATAC_Ctrl_1 124020174P4_ATAC_Ctrl_2 120750568P4_ATAC_Ctrl_3 245511484P4_ATAC_cKO_1 119727870P4_ATAC_cKO_2 97125142P4_ATAC_cKO_3 133327052P4_RNA_Ctrl_1 43762737P4_RNA_Ctrl_2 44657732P4_RNA_Ctrl_3 52311021P4_RNA_Ctrl_4 40845072P4_RNA_Ctrl_5 44113339P4_RNA_cKO_1 38058427P4_RNA_cKO_2 39757228P4_RNA_cKO_3 41606151P4_RNA_cKO_4 34955069P4_RNA_cKO_5 3479489522w_ChIP_Human_CHD7 4621975222w_ChIP_Human_H3K27ac 2046510822w_Human_Input 9049801Hi-C_Ctrl_1 435398098Hi-C_Ctrl_2 432510890Hi-C_Ctrl_3 449314952Hi-C_cKO_1 417558715Hi-C_cKO_2 528193699Hi-C_cKO_3 449493952Supplementary Table 2: Primers used to genotype mice. Primer Name Sequence (5' - 3')CHD7 floxed allele forward (Genotyping) TGCAGATGGGACGTTTTCAGCHD7 floxed allele reverse (Genotyping) CTGCAAGAACACAGGGCAAGControl (without Atoh1-Cre transgene) forward (Genotyping) AAGGTGTGGTTCCAGAATControl (without Atoh1-Cre transgene) reverse (Genotyping) CTCTCCACCAGAAGGCTGAtoh1-Cre transgene forward (Genotyping) GATCCGAAAAGAAAACGTTGATGAtoh1-Cre transgene reverse primer (Genotyping) TTTTCGTTCTGCCAATATGGATT

CHARGE syndrome protein CHD7 regulates epigenomic activation of enhancers in granule cell precursors and gyrification of the cerebellum

https://digitalcommons.wustl.edu/cgi/viewcontent.cgi?filename=0&article=11917&context=open_access_pubs&type=additional

CHARGE syndrome protein CHD7 regulates epigenomic activation of enhancers in granule cell precursors and gyrification of the cerebellum

Abstract

Similar works

Full text

Available Versions

Digital Commons@Becker