The acquisition of malaria immunity is both remarkably slow and unpredictable. At present, we know little about the malaria parasite genes that influence the host\u27s ability to mount a protective immune response. Here, we show that a single-nucleotide polymorphism (SNP) resulting in a single amino acid change (S to F) in an ApiAP2 transcription factor in the rodent malaria parasit

Akkaya, Munir

et al,

Sheehan, Patrick W

English

Digital Commons@Becker

  advances.sciencemag.org/cgi/content/full/6/6/eaaw6957/DC1  Supplementary Materials for  A single-nucleotide polymorphism in a Plasmodium berghei ApiAP2 transcription factor alters the development of host immunity  Munir Akkaya*, Abhisheka Bansal, Patrick W. Sheehan, Mirna Pena, Alvaro Molina-Cruz, Lindsey M. Orchard,  Clare K. Cimperman, Chen-Feng Qi, Philipp Ross, Takele Yazew, Daniel Sturdevant, Sarah L. Anzick,  Girija Thiruvengadam, Thomas Dan Otto, Oliver Billker, Manuel Llinás, Louis H. Miller, Susan K. Pierce*  *Corresponding author. Email: spierce@nih.gov (S.K.P.); munir.akkaya@nih.gov (M.A.)  Published 5 February 2020, Sci. Adv. 6, eaaw6957 (2020) DOI: 10.1126/sciadv.aaw6957  The PDF file includes:  Fig. S1. CRISPR-Cas9 gene modification strategy is outlined. Fig. S2. The SNP in PBANKA_011210 ApiAP2 TF does not interfere with the progression of sexual and pre-erythrocytic stages of the P. berghei life cycle. Fig. S3. Flow cytometry gating strategy. Fig. S4. Graphs comparing mice infected with PbNK65F and PbNK65S. Table S1. Summary of changes observed between the WT and CRISPR-Cas9–mutated parasites based on whole-genome sequencing analysis. Supplementary information 2. The 900-nucleotide synthetic sequence.  Other Supplementary Material for this manuscript includes the following:  (available at advances.sciencemag.org/cgi/content/full/6/6/eaaw6957/DC1)  Data file S1 (.csv format). Supplementary information 1: DNA binding analysis of ApiAP2 domain 1. Supplementary Figures  ABCSupplementary Figure 1182418121810 1823P.berghei ANKA (WT)P.berghei NK65 NYU (WT)PbNK65SPbNK65FFig. S1. CRISPR-Cas9 gene modification strategy is outlined. (A) Chromatograms showing the DNA sequence of the region of PBANKA_011210 ApiAP2 TF.  harboring the SNP in WT P.berghei ANKA and WT P.berghei NK65 NYU. (B) The design of the genetic modification showing the predicted alteration in gene sequence in P. berghei NK65 NYU. (C) The DNA sequence analysis of WT (PbNK65S) and Crisper Cas-9 modified (PbNK65F) P. Berghei NK65 parasite confirming the existence of the planned genetic modifications.    Supplementary Figure 2106 infected RBCs i.p. ~1.2% parasitemia 14 daysOocysts (midgut) Sporozoites (Salivary)5X103  sporozoites i.v. 45 h PbNK65S PbNK65FPbNK65SPbNK65F020406080100120number of oocyst / mosquiton.s.PbNK65SPbNK65F02468!Ct (P.berghei 18S)n.s.  7 daysABCD      EPbNK65SPbNK65F02! 1034! 1036! 1038! 1031! 104sporozoites / mosquiton.s.Fig. S2. The SNP in PBANKA_011210 ApiAP2 TF does not interfere with the progression of sexual and pre-erythrocytic stages of the P. berghei life cycle. (A) Schematic illustration of the experimental strategy used to address the mosquito and liver stages of the P. berghei infection: C57BL/6 mice were infected with 106 iRBCs (i.p.) taken from either PbNK65F or PbNK65S infected donors (3 mice per group). Once parasitemia reached to 1.2%, female A. Stephensi mosquitos (approximately 80-100/ cup) were fed on these mice. Mosquitos that did not feed were removed and the remainder were kept in the incubator with frequent sucrose-water feeding. A portion of mosquitos were dissected at day 14 post feeding and midguts were visualized under microscope (B). Number of oocysts/ mosquito were counted and graphed (C). Each circle represents an individual mosquito. Remaining mosquitos were kept alive and dissected on day 21 post infection. Dissected mosquitos were pooled in groups of 10 and sporozoites were isolated from salivary glands. Graph show the quantification of sporozoites (D). Each circle represents 10 mosquitos. 5x103 sporozoites were injected i.v. to C57BL/6 mice (5 per group) and relative amounts of parasites in liver were quantified with qPCR at 46 h post injection (E). Data represents two independent experiments. Lines in each graph indicate means. (n.s.= p>0.05) Welch’s t-test.      FSC-HFSC-HFSC-HFSC-HCXCR5CD19CD44CD95FSC-AB220CD62LCD8CD4SSCFSC GL7PD1SplenocytesSingletsAliveLive-DeadB cells GC B CellsTfh cellsTh cellsTcyt cellsEffector memoryCentralMemoryNaiveSupplementary Figure 3ABday 10 day 19day 10 day 19day 10 day 1902! 1064! 1066! 1068! 1061! 107Number of cellsTotal CD8+ T-cells Effector MemoryCD8+ T-cellsCentral MemoryCD8+ T-cellsn.s.n.s. n.s.n.s. n.s. n.s.3 7 11 15 190100020003000Days IL10 (pg/ml)3 7 11 15 19050010001500Days IL12 p40 (pg/ml)CFig. S3. Flow cytometry gating strategy. (A) Stepwise gating strategy used to identify the populations in (Fig. 3). (B) Graphs showing the actual numbers of different CD8+ T cell subsets of infected mice from the experiment outlined in (Fig. 3A-C). Each circle represents an individual mouse. Bars show the mean values.  (n.s.= p>0.05) Welch’s t-test.) (C) Serum IL-10 and IL12p40 levels of PbNK65F and PbNK65S -infected mice from the experiment outlined in (Fig. 2D).    Supplementary Figure 4A0 5 10 15 200204060Parasitemia (%).........Days (post infection / reinfection)C0 10 20 300204060Parasitemia (%)Days (post infection)PbNK65SPbNK65F0 10 20 30 40020406080100Days (post infection)Survival (%)PbNK65SPbNK65F uiRBC lysatePbNK65S  iRBC lysatePbNK65F  iRBC lysate02000400060008000IgG2b anti NK65 (AU)*************** uiRBC lysatePbNK65S  iRBC lysatePbNK65F  iRBC lysate05000100001500020000IgG2c anti NK65 (AU)****************BDDay 37Fig. S4. Graphs comparing mice infected with PbNK65F and PbNK65S. (A-B) Representative graphs showing relative serum levels of parasite specific and self-reactive IgG2b (A) and IgG2c (B) antibodies at day 19 post infection in mice from the experiment outlined in Fig.5 Bars and error bars indicate mean and standard error of the mean respectively (***=0.0001<p≤0.001; ****= p≤0.0001) (One Way ANOVA with Tukey’s multiple comparisions test). (C)Parasitemia graph of the experiment outlined in Fig. 6D. (D) IFN- γ KO mice were infected with PbNK65F and PbNK65S parasites at 102 infected RBC per mouse.  Table S1. Summary of changes observed between the WT and CRISPR-Cas9–mutated parasites based on whole-genome sequencing analysis.     REFERENCE CHANGEA G CRISPR MUTATION (SILENT)T C CRISPR MUTATION (SILENT)A C CRISPR MUTATION (SILENT)A G CRISPR MUTATION (SILENT)C A CRISPR MUTATION (SILENT)A G CRISPR MUTATION (SILENT)A C CRISPR MUTATION (SILENT)A C CRISPR MUTATION (SILENT)A C CRISPR MUTATION (SILENT)C T CRISPR MUTATION (S--->F)CHROMOSOMAL POSITION COMMENTLT614627.1:436179LT614627.1:436180LT614627.1:436182LT614627.1:436197LT614627.1:436214LT614627.1:436185LT614627.1:436188LT614627.1:436191LT614627.1:436192LT614627.1:436194Supplementary information 2  The 900-nucleotide synthetic sequence of AP2 (PBANKA_011210) gene The following 900-nucleotides were used, as homology arm, for editing the AP2 gene in P. berghei NK65 to carry the SNP (5467 TCT to TTT) as in the P. berghei ANKA AP2. ccatggATATCTTGTGGAAATAATAATACAAATATTTTAAGATCAAACAAAAATAAATTT GGAAAAAAAAACAATTATAATAATTTGAATGAAGGGGAACATAAAGAAAATAATGAACCTC ACAGAAATACAGATAATCAAAAAATCGGAATAAAAGTAGATAAAAATGGTAAAAATGGAAA TATATCTATGAACGGTTTATTTGTAAGTTATGGACGTGGACAAAGGACAAAAGGATTAGAA AAAAATAAAAACTCAGCGGACAATGCAAGTTCGAATAAGAATAGTGGAAACACAAAAGGAA ATGGATCTAAAAGAGGCAATGGAAAAGATAAACAAAATGGTGGATGTTATGTAGACATTGG TGAAAATTATGAACTTAAATATACAGTTGCTGAGCTCAAGCCACAGCGCGGCGTTTATTTT GATAAATTTCAAAAAGCATGGATAGGAAGTTGGTATGAAGAAGGCAAACAAATAAAACGT CGATTTAAAATTAAATATTATGGTTGGGACGAAGCTAAAGAATTAGCAACAAAAGCTAGA TTTTCTTTTGAAAATCGAATCAAAAATTTAGAAGGAAATAACGGAAAAGGTAATTCTAGT ACATCTAAAAATAATACAAATTCAGGAGAAAAGAATGGAACAAAACTTACAGTAGTTAAT AATAAAAAAAGTGGAATTCAGGATATAGAAAATAATAATAATGATAGAATAAAAACAAGA AACAGTTCAAAAGATGTAGAAGAAAAAAATAATAATGAAAATGCTGGATTTGATGAAAAT AATTTTAATGATATAGATAATCATAATAATCCAAATGAAAAAAATAATTCTGATGATAAA AAAAAAAATAATAATATAGATGATGAAATATGGAGTAATCAAGAATCTCAAAATTGTGATctcgag  The underlined sequences are the restriction sites for NcoI and XhoI, respectively that were used to sub-clone the homology arm in the pYC plasmid. The nucleotides in red corresponds to the 5467-5469 position in the mRNA sequence of the AP2 gene. The nucleotides highlighted in red and underlined are shield mutations introduced to avoid repeated cutting of the edited locus by the Cas9 endonuclease. 

A single-nucleotide polymorphism in a Plasmodium berghei ApiAP2 transcription factor alters the development of host immunity

https://digitalcommons.wustl.edu/cgi/viewcontent.cgi?filename=0&article=9906&context=open_access_pubs&type=additional

A single-nucleotide polymorphism in a Plasmodium berghei ApiAP2 transcription factor alters the development of host immunity

Abstract

Similar works

Full text

Available Versions

Digital Commons@Becker