Brophy, Sean

Dougherty, Joseph D.

Lee, Scott M.

Lewis, Renate

Liu, Yating

Llaci, Lorida

Maloney, Susan E.

Rieger, Michael A.

Sakers, Kristina

Tycksen, Eric

Vasek, Michael J.

English

Digital Commons@Becker

SUPPLEMENTARY INFORMATION Loss of Quaking RNA binding protein disrupts the expression of genes associated with astrocyte maturation in mouse brain. Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 SUPPLEMENTARY FILES Supplementary Data 1 Supplementary Data 2 Supplementary Data 3 Supplementary Data 4 Supplementary Data 5 Supplementary Table 1   250150100755037252010kDaB15037kDa IgG No XL 50 100 200 400QK IP[RNAse If]A C IgGNo XL50100200400RNase Dilution10 15 20 25 37 50 75 100150250kDa01234567 phosphor signal x 10440.341.644.8  4489Supplementary Figure 1: Optimization of QKI CLIP protocol. A) Western blot demonstrates that RNAse If digestion does not affect QKI IP. QKI-specific band approx. 38k Da. Band below 150 kDa is IgG heavy and light chains (samples prepared in non-reducing sample buffer). IgG IP does not pull down QK. Values along lanes represent dilution of RNAse If. Experiments were repeated at least 4 times. B) Phosphor screen image of 32P-labeled RNA from QKI IP, across RNAse If dilutions. Colors above lanes correspond to dilutions of RNAse If in plot in panel C. C) Quantification of 32P signal from image in panel B. QKI-bound RNA is around 40-44 kDA, and this area of the gel was excised for sequencing libraries. Source data are provided as a Source Data file.250150100755025372015IgG IP Qk6 IPIB: Qk6A BSparc208 bpSlc1a3144 bpSlc1a2116 bpMbp125 bpGapdh95 bpinput IgG IP Qk6 IPinputinputC50001000015000IgG Qk6 IgG Qk6 IgG Qk6 IgG Qk6IgGQk6IP: Qk6IgGGapdh Mbp Slc1a2 Slc1a3 SparcGlulP = 0.15P = 0.003P = 0.13P = 0.03P = 0.01P = 0.01Band Intensity (A.U.)Glul121 bpSupplementary Figure 2: Confirmation of CLIP target enrichment. A) Immunoblot of QKI-6 IPs from C57BL/6J mice. IgG IP shows non-specific bands. QKI-6-specific band (38kDa) is seen in the Input samples and in all 3 QKI IPs, indicated by the red arrow, but not in the IgG IPs. Experiments were repeated in at least 3 independent mice. B) RT-PCR gel images. Uncropped gel images are provided in Source Data file. C) Densitometric analysis of RT-PCR gel images. Y axis is arbitrary units. Data are represented by boxplots (center = median, minima and maxima represented by whisker ends, and box bounds representing the 25th and 75th percentiles of the data). Quantification was performed on uncropped, unaltered images. P-values represent two-sided Student’s t-tests. Source data are provided as a Source Data file.ACTargeting VectorWildtype Rosa26 LocusLocus following TargetingTargeted Locus following CreLeft Homology Arm(1087 bp)Right Homology Arm(1041 bp)CAG pro LoxPLoxP 3X PolyA Sig(SV40)STOP STOP STOP STOPFlag-Cas9 PolyA(BGH)Left Homology Arm Right Homology ArmTALEN Cut SiteLeft Homology Arm Right Homology ArmCAG pro LoxPLoxP 3X PolyA SigSTOP STOP STOP STOPFlag-Cas9(not expressed) PolyALeft Homology Arm Right Homology ArmCAG pro LoxPSTOPFlag-Cas9(expressed) PolyAFlanking Genome Flanking GenomeB5037Actin25015010075FlagGenotypingCas9      -     +      -     -    -  Cre        +    +     +    +    -D10897−1010897−610897−710897−911492−111492−211492−311492−411492−511492−611492−70 1 2 3 4 5Normalized QK6 signalAnimal IDWT Cas9 +Litter 1Litter 2kDa:kDa:Supplementary Figure 3: Generation of a Cre-dependent Cas9 expressing mouse line. A) Schematic of targeting strategy. TALENS targeting the ROSA26 locus were utilized to insert a targeting vector containing a CAG/Rosa hybrid promoter driving expression of Cas9, interrupted by a Lox-Stop-Lox cassette. Final locus is engineered to express Cas9-Flag in response to Cre recombinase. B) Anti-flag immunoblot detects protein only in brains from mice that genotyped positive for both the Cre allele and the Cas9-Flag Rosa allele. Experiments were performed in > 10 individual founder mice. C) Loading control (anti-actin) showing all lysates contained protein. Experiments were performed in > 10 individual founder mice. Marker indications are in kDa. Images from panels B-C are from the same blot. Uncropped blots for B-C can be found in the Source Data file. D) Quantification of QKI pixels in CFP+ cells across individual animals. Total pixel number per cell was normalized to WT littermates’ values, across two litters (labeled by litter 1, grey box and litter 2, yellow box). Median value within genotypes is represented as large black circle. P value represents results of a linear mixed model to account for random effects of individual animals. N = 270 WT, and 280 Cas9+ cells from 3 WT animals and 8 Cas9 animals. Source data are provided as a Source Data file.  Kruskal−Wallis, p < 2.2e−16************01020304050−4 0 4−log10(p−value)A01020304050−4 0 4−log10(p−value)B0.00.51.0−10 −5 0 5 10densityC0.00.51.0−10 −5 0 5 10densityD−50510Astrocyte Neuron NAEKruskal−Wallis, p < 2.2e−16******** ****−50510Astrocyte Neuron NAFAstrocyte genesNeuronal genesLog2 Fold Change Log2 Fold ChangeLog2 Fold ChangeLog2 Fold ChangeSupplementary Figure 4: Viral TRAP is comparable to bacTRAP. A,C,E) Viral CRISPR-TRAPseq. B,D,F) Aldh1l1 bacTRAP. A,B) Volcano plots showing enrichment and depletion of known astrocytic (red) and neuronal genes (green). C,D) Density of transcripts representing each enrichment. E,F) Boxplots showing the fold change of known marker genes (astrocytic, neuronal, or other (NA)). N = 580 astrocytic genes, n = 477 neuronal genes, and n = 13,159 other genes. The significance asterisks levels represent Mann-Whitney test. P-values of all comparison are < 2.2e-16. DAPI GFP NG2 MergeQK KOSupplementary Figure 5: QKI mutant cells do not express OPC marker NG2. Immunostaining of GFAP-CFP-Cre positive cells (Green, detected with GFP antibody), in Cas9 + animal does not reveal widespread overlap with Ng2+ OPC cells (red).  N=149 CFP+ cells evaluated across images, with only one cell showing an ambiguous Ng2 labeling. Scale bar is 20µm.AQKI + AstrocyteQKI - AstrocyteGFP Surface0.51.01.52.0Volume (µm³)QKI + QKI -Bn.s.Supplementary Figure 6: QKI KO does not affect astrocyte neuropil infiltration volume. A) Example images of QKI+ and QKI- astrocytes and Imaris surface reconstruction of GFP+ neuropil area. Scale bar is 25µm. B) Quantification of volume surface from each image. Data are represented by boxplots (center = median, minima and maxima represented by whisker ends, and box bounds representing the 25th and 75th percentiles of the data). There is no significant difference between genotypes. Repeated measures ANOVA, p = 0.59. Source data are provided as a Source Data file.Primer Name Sequence (5' -> 3')A01m adapter (/5Phos/rArGrArUrCrGrGrArArGrArGrCrGrUrCrGrUrGrUrArG/3SpC3/)Rand103tr3 Adapter (/5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/)Gapdh_RTpcr_For AGGTCGGTGTGAACGGATTTGGapdh_RTpcr_Rev GGGGTCGTTGATGGCAACAGlul_RTpcr_For TGAACAAAGGCATCAAGCAAATGGlul_RTpcr_Rev CAGTCCAGGGTACGGGTCTTSparc_RTpcr_For TGGGAGAATTTGAGGACGGTGSparc_RTpcr_Rev GAGTCGAAGGTCTTGTTGTCATMbp_RTpcr_For TCACAGCGATCCAAGTACCTGMbp_RTpcr_Rev CCCCTGTCACCGCTAAAGAASlc1a2_RTpcr_For TGAATGAAACCATGAACGAGGCSlc1a2_RTpcr_Rev GCCGAAAGCAATAAAGAATCCGASlc1a3_RTpcr_For ACCAAAAGCAACGGAGAAGAGSlc1a3_RTpcr_Rev GGCATTCCGAAACAGGTAACTCSupplementary Table 1: Primers used in this study.  See Methods for details.

Loss of Quaking RNA binding protein disrupts the expression of genes associated with astrocyte maturation in mouse brain

https://digitalcommons.wustl.edu/cgi/viewcontent.cgi?filename=0&article=11191&context=open_access_pubs&type=additional

Loss of Quaking RNA binding protein disrupts the expression of genes associated with astrocyte maturation in mouse brain

Abstract

Similar works

Full text

Available Versions

Digital Commons@Becker