Cui, Jianmin

Hou, Panpan

Kang, Po Wei

Kasimova, Marina A.

Kongmeneck, Audrey Deyawe

Liu, Yongfeng

Seebohm, Guiscard

Shi, Jingyi

Tarek, Mounir

White, Kelli McFarland

Xu, Xianjin

Yang, Nien-Du

Zaydman, Mark A.

Zhong, Ling

Zou, Xiaoqin

English

Digital Commons@Becker

                                                                                           1  Supplementary files for:    Two-stage electro-mechanical coupling of a KV channel in voltage-dependent activation Panpan Hou, Po Wei Kang, Audrey Deyawe Kongmeneck, Nien-Du Yang,  Yongfeng Liu, Jingyi Shi, Xianjin Xu, Kelli McFarland White, Mark A. Zaydman, Marina A. Kasimova, Guiscard Seebohm, Ling Zhong, Xiaoqin Zou, Mounir Tarek*, and Jianmin Cui*  *To whom correspondence should be addressed.  E-mail: jcui@wustl.edu (J.C.) or mounir.tarek@univ-lorraine.fr (M.T.)    This PDF File Includes:  Supplementary Table 1  Supplementary Figures. 1 to 7                                                                                                       2  Supplementary Table 1. All primer sequences used in this study. Mutations Primer sequences C214A pB: cttggaTcccacCGCgaggaccacca pC: cGCGgtgggAtccaaggggcaggtg  G219C pB: cctgaCacttggaTcccacCGC pC: ggAtccaagtGtcaggtgtttgccacg C331A pB: gacagagaaTGCggaggcgatggtcttc pC: ctccGCAttctctgtctttgccatc E160R pB: cgatTCTcatccagaagagagt pC: ctcttctggatgAGAatcgtgctggtggtgttct R231E pB: caggaaTTCgatgcccctgatggc pC: gggcatcGAAttcctgcagatcctgag R237E pB: gcatcTCcaggatctgcaggaag pC: cagatcctgGAgatgctacacgtcgac F127A pB:  gaagacggcgGCAtggtaaacgaagcatttc pC:  caTGCcgccgtcttcctcatc K183N pB:  cacgtaAttgctgcggcagcc pC:  ccgcagcaaTtacgtgggcctctgg R190Q pB: gcagcTgcccccagaggcc pC: ctgggggcAgctgcgctttgccc F193A pB: cgTgcaGCgcgcagccgcccc pC: ctgcgcGCtgcAcggaagcccatttcc R195A pB: ggcttAGCggcaaagcgcagccg pC: gctttgccGCTaagcccatttccatcatc K196E pB: ctgcgctttgcccggGagcccatttc pC: ccggGagcccatttccatcatc P197A pB: ggaaatTGCcttccgggcaaagcg pC: ccggaagGCAatttccatcatcgacctc R237W pB: gcatccAcagTatctgcaggaagcgg pC: cagatActgTggatgctacacgtcg Q244W pB: cctccccaccggtcgacgtgtagc pC: gaccggtggggaggcacctggag G245W pB:ccaggtcccccactggcggtcgacgtg pC:cagtgggggacctggaggctcct G246W pB: ccaggtccaaccctggcggtcgac  pC:cagggttggacctggaggctcctg T247W pB: gagtctccaccagcctccctggcggtc pC: ggctggtggagactcctgggctccgtg W248R pB: cctccGggtgcctccctggc pC: gaggcaccCggaggctcctgggc R249W pB: gagccAccaCgtgcctccctggcg pC: ggcacGtggTggctcctgggctcc L250W pB: gagccGagCCAcctccaggtgcctc pC: gaggTGGctCggctccgtggtcttc                                                                                            3  L251A pB:  cggaTcccGCgagcctccaggtgcc pC: gctcGCgggAtccgtggtcttcatcc G252W pB: gaccacTgaCcAcaggagcctccaggtg pC: cctgTgGtcAgtggtcttcatccaccg  S253W pB: gaccacCCagcccaggagcctcc pC: gggctGGgtggtcttcatccacc V254M pB: gaagaccaTggagcccaggagcc pC: ggctccAtggtcttcatccaccg  V255W pB: gatgaaCCAcacggagcccaggag pC: ctccgtgTGGttcatccaccgccagg F256A pB: gtggatgGCgaccacggagcccag pC: gtggtcGCcatccaccgccagg I257W pB: gcggtgCCAAaagaccacggagccc pC: ggtcttTTGGcaccgccaggagctg H258W pB: ctggcgCCAgatgaagaccacggag pC: cttcatcTGGcgccaggagctgataac R259W pB: cagctcctgCcAgtggatgaagaccacgg pC: cacTgGcaggagctgataaccac Q260W pB: gctccCACcggtggatgaagaccac pC: ccaccgGTGggagctgataaccacc E261K pB: gttatAagctTctggcggtggatgaag pC: cgccagAagctTataaccaccctgtacatc L262A pB: ggtggtAatTGCctcctggcggtggatg pC: ggagGCAatTaccaccctgtacatcg I263A pB: ggtggttGCcagctcctggcggtg pC: gagctgGCaaccaccctgtacatc T264A pB: cagTgtggCtatcagctcctggcg pC: ctgataGccacActgtacatcg T265A pB: gtacagAgCggttatcagctcctg pC: gataaccGcTctgtacatcggcttc L266A pB: GATAACCACCGCCTACATCG pC: CGATGTAGGCGGTGGTTATC Y267A pB: ccgatAGCcagggtggttatcagc pC: caccctgGCTatcggcttcctgggcc I268W pB: gaagccCCAgtacagggtggttatcag pC: cctgtacTGGggcttcctgggcctc G269A pB: CTGTACATCGCCTTCCTGGGCCT pC: AGGCCCAGGAAGGCGATGTACAG F270A pB: GTACATCGGCGCCCTGGGCCTC pC: GAGGCCCAGGGCGCCGATGTAC L271E pB: gatgaggccTTCgaagccgatgtacagg pC: cttcGAAggcctcatcttctcc G272A pB: CTTCCTGGCCCTCATCTTCT pC: AGAAGATGAGGGCCAGGAAG L273F pB: gaagatgaATcccaggaagccgatg pC: cctgggATtcatcttctcctcgtac                                                                                            4  I274A pB: TGGGCCTCGCCTTCTCGAGCTA pC: TAGCTCGAGAAGGCGAGGCCCA F275A pB: GCCTCATCGCCTCGAGCTA pC: TAGCTCGAGGCGATGAGGC F335A pB: CTTCTCTGTCGCTGCCATCTCC pC: CTTCTCTGTCGCTGCCATCTCC  A336G pB: gaaggaAatTCcaaagacagagaagcag pC: gtctttgGAatTtccttctttgcgctcc I337A pB: CTGTCTTTGCCGCCTCCTTCTTTGC pC: GCAAAGAAGGAGGCGGCAAAGACAG S338F pB: gaagAATatTgcaaagacagagaag pC: gtctttgcAatATTcttctttgcgctccc F339S pB: gcaaaACTggagatggcaaagacag pC: ccatctccAGTtttgcgctcccagcg F340A pB: GCCATCTCCTTCGCTGCGCTCCCA pC: TGGGAGCGCAGCGAAGGAGATGGC  A341V pB: gggagcAcaaagaaggagatggc pC: ccttctttgTgctcccagcgggg L342A pB: CTTCTTTGCGGCCCCAGCG  pC: CGCTGGGGCCGCAAAGAAG P343A pB: ccgcGgCgagcgcaaagaaggag pC:gcgctcGcCgcggggattcttggc A344V pB: gaatccccActgggagcgcaaagaag pC: ctcccagTggggattcttggctcg G345A pB: gccaagaatcGccgctgggagcgc pC: gcggCgattcttggctcggg I346A pB: gagccaagGGCccccgctgggagcgc pC: gggGCCcttggctcggggtttg L347A pB: gagccaGCaatccccgctgggagc pC: ggggattGCtggctcggggtttgcc G348A pB: ccgaCGcaagaatccccgctg pC: ggattcttgCGtcggggtttgccctg  S349A pB: gcaaaccccgCgccaagaatccccgc pC: ggcGcggggtttgccctg G350A pB: ggcaaacGccgagccaagaatcc pC: gctcggCgtttgccctgaaggtg F351A pB: ggcaGCGcccgagccaagaatcc pC: gctcgggCGCtgccctgaaggtgcag A352C pB: GATCCGGGTTTTGCCTGAAGGTGCAG pC: CTGCACCTTCAGGCAAAACCCGGATC L353K pB: ccttcTTggcaaaccccgagc pC: gggtttgccAAgaaggtgcagcagaag K354A pB: ctgcacGGCcagggcaaaccccg pC: ccctgGCCgtgcagcagaagcag V355W pB: gggtttgccctgaagTGgcagc pC: gggtttgccctgaagTGgcagc                                                                                            5  Q356A pB: GTTTGCCCTGAAGGTGGCGCAGAAGCAG pC: CTGCTTCTGCGCCACCTTCAGGGCAAAC Q357A pB: GAAGGTGCAGGCGAAGCAGAGGCAGA pC: TCTGCCTCTGCTTCGCCTGCACCTTC K358A pB: GTGCAGCAGGCGCAGAGGCAGAAGCAC pC: GTGCTTCTGCCTCTGCGCCTGCTGCAC Q359A pB: GTGCAGCAGAAGGCGAGGCAGAAGCAC pC: GTGCTTCTGCCTCGCCTTCTGCTGCAC R360A pB: CAGCAGAAGCAGGCGCAGAAGCACTTC pC: GAAGTGCTTCTGCGCCTGCTTCTGCTG M238W pB: gacgtgCagcCAcctcaggatctgcagg pC: gaggTGgctGcacgtcgaccgccag E160R/ R237E/ M238W Use E160R/R237E as template M238W-pB: gacgtgCagcCAcTCcaggatctgcagg M238W-pC: GAgTGgctGcacgtcgaccgccag L239W pB: cgacgtgCCAcatcctcaggatctgc pC: ggatgTGGcacgtcgaccgccag E160R/ R237E/ L239W Use E160R/R237E as template L239W-pB: gacgtgCCAcatcTCcaggatctgc L239W-pC: GAgatgTGGcacgtcgaccgccag D242W pB: gcgCCAgacgtgtagcatcctc pC: ctacacgtcTGGcgccagggaggcac R243W pB: ccctgCcAgtcgacgtgtagcatc pC: gtcgacTgGcagggaggcacctgg I268A pB: caggaaTccgGCgtacagggtggttatcag pC: gtacGCcggAttcctgggcctcatcttc L251F pB: gagccGaAgagcctccaggtgcc pC: gaggctcTtCggctccgtggtcttc F339L pB: cgcGaaGaGggagatggcaaagacag pC: catctccCtCttCgcgctcccagcggg                                                                                                6  Supplementary Figures   Supplementary Fig. 1, Molecular docking results of ML277 onto KCNQ1 channel.  (a) Residues interacting with ML277 based on molecular docking and experimental results. Top view of the binding mode of ML277 (green) at the homology model of hKV7.1 (see Methods). Two neighboring subunits (light red and light blue) are highlighted. (b) Side view of the binding mode of ML277. Only two neighboring subunits (light red and light blue) are shown for clarity. Right panels, detailed structure of the ML277 (green) binding at the S4-S5L/pore interface. Interacting residues that consistent with mutagenesis results shown in cyan (S4-S5L) and magenta (pore).                                                                                              7                                                                                               8  Supplementary Fig. 2. Dataset for functional validations of AO state E-M coupling residues identified by the ML277 screen.  (a-b) Currents of WT and mutant KV7.1 with and without KCNE1. Currents are shown in the same scale. VCF experiments was performed on S338F+KCNE1 and L251A+KCNE1, indicating membrane expression and VSD function. (c-e) Currents of WT and mutant KV7.1 on top of the IO background E1R/R2E, the AO background E1R/R4E and F351A. Currents are shown in the same scale. (f) VCF results of WT and eight mutations in KV7.1*. n ≥ 3. Source data are provided as a Source Data file.                                                                                              9   Supplementary Fig. 3. Dataset for functional validations of S4c residues critical for AO state E-M coupling.  (a-b) Currents of S4c mutations with and without KCNE1. Currents are shown in the same scale. (c-e) Currents of the S4c mutations on top of the IO background E1R/R2E, the AO background E1R/R4E and F351A. Currents are shown in the same scale. VCF results (three out of four) are shown in blue. (f) VCF results of the four mutations in S4c in KV7.1*. n ≥ 3. Source data are provided as a Source Data file.                                                                                              10   Supplementary Fig. 4. Double mutant cycle analysis.  (a) Mapping the key residues on to the Kv7.1 cryoEM structure, the VSD of which is at the activated state. Cyan, S4c residues (M238, L239, D242, and R243); Orange, F0 and H5 in the charge transfer center; Blue, S4-S5L residues; Pink, pore residues. Lower panels, detailed structure of the key residues. (b-c) Double mutant cycle analysis of the interactions at S4-S5L/pore interface: W248 and I268 (∆∆G= 1.4 kcal/mol) and L251 and F339 (∆∆G= 2.7 kcal/mol), as well as the S4c/S5 interface: M238 and L271 (∆∆G= 1.7 kcal/mol) and L239 and L271 (∆∆G= 4.4 kcal/mol). G–V relations from WT and mutations are fitted with Boltzmann equation. n ≥ 3. (d) Mapping the interactions M238/L271 and L239/L271 at the S4c/S5 interface, and W248/I268, L251/I268, and L251/F339 at the S4-S5L/pore interface. Color code is the same as in a, and yellow dashed lines indicate the interactions.                                                                                              11                                                                                               12  Supplementary Fig. 5.  Structural validation of the MD trajectories obtained for KV7.1 models.  (a) State-dependent KV7.1 VSD salt-bridges1-4. Representation of S2 (in black, green, blue and red) and S4 (in blue) segments in KV7.1 RC, IO, AO and AC models, respectively. S4 gating charges are represented in blue sticks, while its S2 countercharges are represented in red sticks. The hydrophobic plug F167 (F0) is represented in orange sticks. (b) Summary table of state-dependent KV7.1 VSD salt-bridges in the subunits of KV7.1 models. (c) Intracellular view of S4-S5L and PD segments in KV7.1 IO (top, left), AO (top, right), RC (bottom, left) and AC (bottom, right) models. The gray spheres are sidechains of F340. (d) Average pore radii of the conduction pathways of KV7.1 models. Standard deviations are represented by black, green, blue and red horizontal bars for the MD trajectories obtained from RC, IO, AO and AC models, respectively. (e) Summary table of state-dependent KCNQ1 neighbor residues pairs identified by cysteine scanning studies and previous double mutant cycle analysis in the subunits of KCNQ1 RC, IO, AO and AC models involving T144 5, F232 6, and L353 7. In this analysis we calculated the distance between Cβ atoms of the residue pairs with a cut-off of 13 Å to determine if these residues are prone to interact when mutated into Cys. (f) Interacting pairs of KCNQ1 neighbor residues. In the upper panel, the side view (left) and the extracellular view (right) of the seven pairs of neighbor residues in the KCNQ1 IO model are shown. The transmembrane segments (in cartoon) bearing the residues of interest are highlighted in transparent colors. In the lower panel, the zoomed views of IO state specific interaction in IO model (left), RC state specific interactions in RC model (middle), and of AO state specific residue pairs in AO model (right) are displayed. (g-h) Comparison of the pore domain of KV7.1 RC model with KCNQ1EM structure. (g) The graph project the root-mean-square deviation (RMSD) of the pore domain segments of KV7.1 RC model with respect to KCNQ1EM structure throughout its MD simulation time (in ns). Average RMSD values are displayed for each subunit (labeled chain A, B, C, D). The orange vertical line represents the simulation time at which the pictures displayed in (h). (h) A cartoon representation of the structural alignment of the S6 segment of KCNQ1EM structure (in transparent orange) with those of KV7.1 (top) RC subunits, each captured at ~420 ns. Each subunit is represented in solid black, red, green and blue cartoon, respectively. Source data are provided in Source Data file.                                                                                             13    Supplementary Fig. 6.  Possible intra-subunit interactions at the classical E-M coupling region in RC and AO states.   (a-b) Representations of the IO and AO state models of a KV7.1 subunit. Inset: enlarged structures of the boxed area. Blue, residues identified as important for E-M coupling in experiments (Fig. 1c-g); grey: V255 and T265, which were identified in MD simulations as important for E-M coupling, but for which mutations still show functional currents (Fig. 3c). Residue V255 was found to be important for the AO state E-M coupling (Fig. 3). Each pair of residues is represented by a black dashed line connecting their respective sidechains.                                                                                             14   Supplementary Fig. 7. Statistical coupling analysis of domain-swapped KV channels.  (a) Expanded sample MSA (from Figure 6a) used as input for analysis by SCA. MSA uses the nomenclature established by the HUGO Gene Nomenclature Committee (HGNC) for voltage-gated potassium channels8. KV channels can adopt two types of architectures. In “domain-swapped” channels, the VSD from one subunit contacts the PD from the neighboring subunit. In “non-domain-swapped” channels, the VSD from one subunit contacts the PD from the same subunit. These distinct architectures likely give rise to different modes of E-M coupling. SCA was applied to the KV channel superfamily previously9; however, prior studies utilized both domain-swapped and non-domain swapped KV channels in the input data. In this MSA, only domain-swapped KV channels were included. One member from each of KV1 – KV9 is shown. The final processed MSA includes 1421 sequences at 200 positions. (b) First order conservation by amino acid position within the MSA. Di on the y-axis is calculated based on Kullback-Leibler divergence which measures deviation of the observed amino acid frequency in the MSA (Fig. 6a)                                                                                            15  from the natural “background” amino acid frequency (see Methods). Bars indicate positions of the helical segments. (c) A histogram of eigenmodes tallied by their associated eigenvalues from SCA calculation (black). Red indicates the spectrum calculated by randomizing the input. Five significant eigenmodes can be seen by the black bars rising above the randomized red curve (blue arrows) at high eigenvalues. Inset shows enlarged scales. (d) Amino acid residues within independent component 1 through independent component 5 identified by SCA mapped onto the KV7.1 cryoEM structure. Blue surfaces indicate all IC positions on one subunit, pink surfaces indicate the same IC positions on the neighboring subunit. Only the S5 and S6 helices are shown on the neighboring subunit for sake of clarity (pink helices). Accordingly, only the IC positions on the neighboring subunit on S5 and S6 are shown (pink surfaces). Using the IC submatrix and based on the strength of external correlation (see Methods, Figure 6c), IC2+IC3 are combined to form sector 1 (Fig. 6d), while IC1+IC4+IC5 are combined to form sector 2 (Fig. 6e). Source data for SCA are provided in Source Data file.   References 1. Hou, P. et al. Inactivation of KCNQ1 potassium channels reveals dynamic coupling between voltage sensing and pore opening. Nat Commun 8, 1730 (2017). 2. Hou, P., Shi, J., White, K. M., Gao, Y. & Cui, J. ML277 specifically enhances the fully activated open state of KCNQ1 by modulating VSD-pore coupling. Elife 8 (2019). 3. Zaydman, M. A. et al. Domain-domain interactions determine the gating, permeation, pharmacology, and subunit modulation of the IKs ion channel. Elife 3, e03606 (2014). 4. Wu, D., Pan, H., Delaloye, K. & Cui, J. KCNE1 remodels the voltage sensor of Kv7.1 to modulate channel function. Biophys J 99, 3599-608 (2010). 5. Xu, Y. et al. Building KCNQ1/KCNE1 channel models and probing their interactions by molecular-dynamics simulations. Biophys J 105, 2461-73 (2013). 6. Nakajo, K. & Kubo, Y. Steric hindrance between S4 and S5 of the KCNQ1/KCNE1 channel hampers pore opening. Nat Commun 5, 4100 (2014). 7. Choveau, F. S. et al. KCNQ1 channels voltage dependence through a voltage-dependent binding of the S4-S5 linker to the pore domain. J Biol Chem 286, 707-16 (2011). 8. Gutman, G. A. et al. International Union of Pharmacology. LIII. Nomenclature and molecular relationships of voltage-gated potassium channels. Pharmacol Rev 57, 473-508 (2005). 9. Lee, S. Y., Banerjee, A. & MacKinnon, R. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+) channels. PLoS Biol 7, e47 (2009).   

Two-stage electro–mechanical coupling of a KV channel in voltage-dependent activation

https://digitalcommons.wustl.edu/cgi/viewcontent.cgi?filename=0&article=9841&context=open_access_pubs&type=additional

Two-stage electro–mechanical coupling of a KV channel in voltage-dependent activation

Abstract

Similar works

Full text

Available Versions

Digital Commons@Becker