Couch, Fergus J.

Gregg, R. G.

Hogan, K.

McCarthy, Tommie V.

Nucleic Acids Research

Cork Open Research Archive

Title Dinucleotide repeat polymorphism at the RTR1 locus (19q13.1)Author(s) Couch, Fergus J.; Hogan, K.; McCarthy, Tommie V.; Gregg, R. G.Publication date 1991Original citation Couch, F.J., McCarthy, T.V., Hogan, K. and Gregg, R.G. (1991)‘Dinucleotide repeat polymorphism at the RTR1 locus (19q13.1)’,Nucleic Acids Research, 19(18),p. 5094. doi: 10.1093/nar/19.18.5094Type of publication OtherLink to publisher'sversionhttp://dx.doi.org/10.1093/nar/19.18.5094Access to the full text of the published version may require asubscription.Rights © 1991, Oxford University PressItem downloadedfromhttp://hdl.handle.net/10468/5044Downloaded on 2018-08-23T19:03:10Z5094 Nucleic Acids Research, Vol. 19, No. 18Dinucleotide repeat polymorphismat the RYR1 locus (19q13.1)F.J.Couch1'2, K.Hogan1, T.V.McCarthy2 and R.G.Gregg1department of Anesthesiology, University of Wisconsin-Madison, 600 Highland Avenue, Madison, Wl 53705,USA and department of Biochemistry, University College,Cork, IrelandMicrosatellite polymorphism inhuman insulin receptor gene(INSR) on chromosome 19K.Xiang, M.Granqvist, M.Seino, S.Seino and G.I.Bell*Howard Hughes Medical Institute, University of Chicago,5841 S. Maryland Avenue, Box 391, Chicago, IL 60637,USASource/Description: A HaeHI fragment from acosmid containinga portion of the human skeletal Ryanodine receptor gene (RYR1)(1) was selected by hybridisation to poly(dC-dA).poly(dG-dT)and was designated Wisl. Sequencing was performed fordetermination of primer sequences for the polymerase chainreaction. The predicted length of the amplified fragment was 227bp.Primer Sequences:5'GCATCACGGTCTGCAATTCAT 3' (CA strand);5'GCAATGGCATAATCTCAGCT 3' (GT strand).Frequency: Estimated from 160 chromosomes of the CEPHparents.Observed heterozygosity = 0.43, PIC = 0.38Allele (bp)Al 233A2 231A3 229A4 227Frequency0.01250.01250.10000.7688Allele (bp)A5 225A6 223A7 221Frequency0.02500.03130.0500Chromosomal Localisation: The skeletal muscle Ryanodinereceptor gene (RYR1) has been mapped to 19ql3.1 (2).Mendelian Inheritance: Co-dominant segregation was observedin 40 two generation families.PCR Conditions: Amplification reactions were as follows,denaturation at 94°C (3 min), 32 cycles of denaturation at 94°C(1 min), annealing at 54°C (45 sec) and extension at 72°C (1min) using 0.5 U Amplitaq, 1 xGeneAmp buffer and 200 /tMdNTPs (Perkin Elmer-Cetus), 100 ng genomic DNA and 10 pmolof each primer in a volume of 15 /tl. Allele sizes were determinedon 8% denaturing polyacrylamide gels with autoradiography bycomparison to the cloned sequence. The sequenced repeat was(CA)17. The sequence has been submitted to Genbank. Accessionnumber = X60187 Human RYR1 DNA.Acknowledgements: This work was supported by a grant fromthe Department of Veterans Affairs (K.H.), and Eolas, the IrishScience and Technology board (F.C., T.V.M.). Special thanksto Dr. J. Mulley for assistance with CEPH pedigree typing.References: 1) Zorzato.F. el al. (1990) / . Biol. Chem. 265,2244-2256. 2) MacKenzie,A.E. et al. (1990) Am. J. Hum.Genet. 46, 1082-1089.Primers/Description: Two primers (INSR E3-2B, 5'-ATTGC-TGCATATGCAGACAG-3' and INSR E3-rC3, 5'-TGC-AGCCGTGTGACTTACAG-3') were used to amplify a138-156 bp A r i l and CT repeat-rich region in intron 2 of thehuman INSR gene (1).Frequency: Nine alleles were observed in 48 unrelatedCaucasians. The heterozygosity was 58%.AlleleAA1AA3AA5AA7AA9bp156152148144138Frequency0.010.010.650.030.02AlleleAA2AA4AA6AA8bp154150146142Frequency0.010.100.050.12Chromosomal Localization: INSR was assigned to chromosome19pl3.3-pl3.2 (2).Mendelian Inheritance: Codominant inheritance was observedin four nuclear families.Other Comments: The PCR was performed using 32P-labeledINSR E3-2B and unlabeled INSR E3-rC3 for 30 cycles:denaturation at 94°C for 1 min; annealing at 56°C for 2 min;and extension at 72°C for 2.5 min. The PCR products wereanalyzed on a 5% denaturing polyacrylamide gel (Fig. 1). Themicrosatellite sequence in intron 2 was of the form(ATTT)I,CC(CT)1O.References: 1) Seino,S. etal. (1990) Diabetes 39, 123. 2) Yang-Feng.T.L. et al. (1985) Science 228, 728.14 45 58 48 68 55 59 36 58 45 56GenotypeFigure 1. PCR amplification of microsatellite repeat polymorphism in INSR gene.The genotypes are noted at the bottom of the figure.* To whom correspondence should be addressedDownloaded from https://academic.oup.com/nar/article-abstract/19/18/5094/1078902by University College Cork useron 30 November 2017

Dinucleotide repeat polymorphism at the RTR1 locus (19q13.1)

https://cora.ucc.ie/bitstream/10468/5044/1/19-18-5094a.pdf

Dinucleotide repeat polymorphism at the RTR1 locus (19q13.1)

Abstract

Similar works

Full text

Available Versions

Cork Open Research Archive