Forsman, Dick

Lehikoinen, Petteri

English

Helsingin yliopiston digitaalinen arkisto

BIRDINGDUTCHVOLUME 42 • NO 5 • 2020341APPENDIX Procedure of DNA analyisA toepad sample was taken from the specimen and DNA was isolated using a QIAGEN QIAamp DNA Micro Kit following the manufacturer’s instructions, with the addi-tion of 0.1 M dithiothreitol to the proteinase K digest. Two mitochondrial fragments, one from the cytochrome b gene and one from the highly variable control region, were amplified using bespoke primers (cf table 2) and PCR conditions described in Shannon et al (2014). PCR products were visualised on a 1.5% agarose gel and ex-tracted using a QIAGEN QIAquick Gel Extraction Kit. Final products were sent to Source Bioscience (Notting-ham, England) for Sanger sequencing. Sequencing reads were checked by eye for quality and possible contami-nation. Alignments were made in CLC Sequence Viewer 8 for both fragments separately (182 bp for control re-gion, 234 bp for cytochrome b), utilising other publicly available shearwater sequences from GenBank.TABLE 2 Primers used to amplify short diagnostic mitochondrial fragments from Calonectris shearwatersprimer name sequence (5’-3’) mitochondrial locusCDiBo-CR-F1 CCCTTAAGCCCAATAGTCCC control regionCDiBo-CR-R1 CCCAGCTCGACAGCTACCGG control regionCDiBo-F2 CTCAGCTATTCCCTACATCG cytochrome bCDiBo-R2 CTTTTAGGGTGAAATAGGGG cytochrome b[Dutch Birding 42: 341-344, 2020]Chestnut-winged Cuckoo at Ayn Hamran, Oman, in December 2019 Petteri Lehikoinen & Dick ForsmanSituated on the eastern coast of the Arabian Peninsula and in the south-eastern corner of the ‘greater’ Western Palearctic (WP), Oman offers some great birding. While the country harbours a good share of Arabian endemics and specialities, the avifauna shows additional influences from both Africa and Asia. For these reasons, Oman has a huge potential for vagrants and the cyclones of the Indian Ocean are known to cast migrants from the Indian Subcontinent in autumn. In addition, the south-westerly monsoon, Khareef, gives a spe-cial twist to birding in southern Oman, as it bathes the southern coast with rains and immense humid-ity in late summer and early autumn. This, in turn, leads to lush greenery and several fresh-water pools, khawrs, which are utilized by large num-bers of migrants. The winds of Khareef also result in an upwelling of cold and nutritious water on the coast of southern Oman, providing food for a di-verse selection of seabirds.We were guiding an Avescapes Travels tour in southern Oman and on 6 December 2019, we visited Ayn Hamran, Dhofar (17°05’34’’N, 54°16’49’’E) for the second time. The first visit had been unrewarding due to near gale-force winds, which is quite exceptional for Oman at this time of year. We still experienced these unusal weather conditions on 6 December, with overcast sky and strong westerly gusts. We started descending slow-ly along the small stream in the wadi and soon en-countered surprisingly many Red-breasted Fly-catchers Fice dula parva accompanied by a Blyth’s Reed Warbler Acrocephalus dumetorum, which proved to be only the sixth record for Oman. In hope for rallids, I (Petteri Lehikoinen) decided to go through extensive scrub of acacia and other spiny vegetation fringing the stream but progress-ing through the scrub proved to be difficult, due to the thorny vegetation. Just when thinking of turn-ing back, a large, long-tailed bird flew up to lower branches of an acacia, with its wings flashing ma-roon red. With a walkie-talkie, I informed Dick Forsman that I was watching a Chestnut-winged Cuckoo Clamator coromandus in the middle of the thorny bush (plate 452-455). The bird moved deeper inside the scrub before I could take photo-graphs. It took a while for DF and the rest of the group to locate the exact position and, by that time, the bird had moved deeper into the scrub.When we finally got together, the situation looked dire. It had become clear that the cuckoo was most likely a first for Oman and possibly for the entire Middle East, as it was not illustrated in the field guide by Porter & Aspinall (2010). We had Scopoli’s Shearwater collected in Faeroes in August 1877342452 Chestnut-winged Cuckoo / Coromandelkoekoek Clamator coromandus, Ayn Hamran, Dhofar, Oman, 6 December 2019 (Petteri Lehikoinen)  453 Chestnut-winged Cuckoo / Coromandelkoekoek Clamator coromandus, Ayn Hamran, Dhofar, Oman, 6 December 2019 (Dick Forsman)  454-455 Chestnut-winged Cuckoo / Coromandelkoekoek Clamator coromandus, Ayn Hamran, Dhofar, Oman, 6 December 2019 (Petteri Lehikoinen)no idea of the bird’s where abouts and so far only one of us had seen it. Based on its elusive behav-iour it looked rather hopeless trying to relocate the bird and a hint of despair was in the air. However, we reasoned that the bird might not have been able to get back into the dense and extensive veg-etation without others seeing it, so we continued to follow the stream downwards. After reaching the second acacia in line, a call of relief ‘There!’ was roared, as the bird took off and flew to the next acacia viewed by the entire group. A strong gust of joy hit us. We followed the bird, and it flew always just when someone reached the tree or bush it had last landed in. It was very shy and for a long time we did not manage to see it perched as it always skulked inside the densest part of a bush. Chestnut-winged Cuckoo at Ayn Hamran, Oman, in December 2019343Eventually, we obtained some decent flight shots, and even saw it briefly perched quite open on two occasions. It was a smart looking bird, especially when delivered in a rarity context! We were, how-ever, not fully aware of this context until back in Finland and getting confirmation that the record was, indeed, the first for the entire ‘greater’ WP.DescriptionSIZE & STRUCTURE  Medium-sized, slim cuckoo with very long, graduated tail. Wing-tip rounded with four protrud-ing but short fingers. Bill pointed, slightly downcurved. Leg short, with two toes pointing forward and two back-ward. Head with long pointed crest.HEAD  Head including crest black.UPPERPARTS  Mantle black, separated from black head by white collar. Lower back black.UNDERPARTS  Throat and upper breast rusty. Lower breast and belly white, grading into grey lower belly. Vent and undertail-coverts black.WING  Upperwing chestnut with black tertials. Outer-most primaries with dark tip. Innermost upperwing-cov-erts also black. Underwing chestnut; underwing-coverts slightly paler than flight feathers and rusty coloured, with white leading edge. TAIL  Black with narrow white feather-tips, most promi-nent on outer tail feathers, and therefore mainly visible from below. BARE PARTS  Bill black. Leg grey.SOUND  No sounds heard.BEHAVIOUR  Rather shy and elusive when disturbed, fly-ing quickly with straight flapping flight from one tree to another and hiding well inside thickets. When initially found, flushed from ground near small stream where possibly feeding and moving calmly and slowly in low vegetation. Identification and ageingBeing such a distinctive looking bird, the identifi-cation did not really pose a challenge. The bird was in adult plumage but according to literature, the species should moult to this plumage in three months (Payne 2005, Erritzøe et al 2012), so it may have also been a juvenile with a completed body moult. The flight photographs show unmoulted primaries p3 and p6 (counting ascendantly) for both wings (plate 454-455). Similar moult signs can be seen also in the secondaries, where only the outermost secondary had been replaced. Juveniles arriving to winter in the Thai-Malay Peninsula are still in the middle of their post-juve-nile moult, while adults seemed to have complet-ed their moult before autumn migration (Wells 1999). The most retarded individual had moulted only few primaries and one rectrix by 18 Decem-ber, and many, likely juveniles, were still renew ing remiges in January-February (Wells 1999). This strongly suggest that the bird at Ayn Hamran was a first-year bird with an uncompleted post-juvenile remex moult. The unmoulted remiges are paler, and the tips of the secondaries are narrower than on the replaced ones. Unmoulted primaries show more diffuse dark tips compared with the freshly moulted ones. They also show a rusty fringe to the tip, which is typical of a juvenile feather.Distribution and movementsChestnut-winged Cuckoo is an uncommon breed-er from the foothills of the Eastern Himalayas to far-eastern China and South-East Asia. Northern populations are migratory and winter in South India, Sri Lanka, Thai-Malay Peninsula, Greater Sunda Islands and Philippines; the species is mono typic (Payne 2005, Erritzøe et al 2012, del Hoyo & Collar 2014). Records outside the normal range give insight of its vagrancy potential: vagrants have been docu-mented in Japan (c five records; Honshu, Iriomote, Tokara, Okinawa); South Korea (four to five re-cords, even suspected breeding); Spratly Islands (South China Sea); Maldives; Palau (Micronesia); and Cocos (Keeling) Islands (Australian external territory in the Indian Ocean) (Erritzøe et al 2012, Carter et al 2019, Payne & Kirwan 2020). It seems likely that the Ayn Hamran bird had overshot its autumn migration after which cyclones moved it across the Indian Ocean to the Arabian Peninsula. This might be supported by the numerous Red-breasted Fly catchers and the Blyth’s Reed Warbler, which should also be wintering on the Indian Sub-con tinent. Palau and the Cocos Keeling Islands are c 1000 km away from the closest mainland and these records could be considered a proof of the species’ ability to cross long distances over sea. Yet, southern Oman lies c 2000 km from the near-est wintering grounds, so the Ayn Hamran bird seems to be an example of extreme vagrancy for the species.AcknowledgementsWe thank Heljä Aittamaa, Juhani Aittamaa, Olli Kruuna, Matti Rekilä, Pertti Renvall and Heli Siikamäki for their company during the trip and for herding the cuckoo for documentation. William Velmala kindly provided access to some literature, for which we are thankful. Samenvattingcoromandelkoekoek te ayn Hamran, oman, in december 2019  Op 6 december 2019 werd door een reisgroep van Finse vogelaars een Coromandelkoekoek Clamator coro-mandus ontdekt en gefotografeerd te Ayn Hamran, Dhofar, Oman. De determinatie was eenvoudig, op basis van het middelgrote formaat met lange staart en duide-Chestnut-winged Cuckoo at Ayn Hamran, Oman, in December 2019344 [Dutch Birding 42: 344-347, 2020]Armenian Gull at Blåvand, Denmark, in May 2017During spring 2017, I worked as a ringer at Blåvand Bird Observatory, Syddenmark – the westernmost point in Denmark. With the day’s ringing finished on 4 May, I planned to go to the local community for some shopping. As so often before, a ‘detour’ led me past an area called Grønningen just south of the community. The area is a meadow with a few small fresh water ponds that attract a fair number of gulls which come in to bathe and drink. In the past, I have been lucky enough to find rare birds like Sharp-tailed Sand-piper Calidris acuminata and Pectoral Sand piper C melanotos in this area. As I was driving along the area a little too fast, I saw a single gull stand-ing by one of the fresh water holes, and, even to-day, I do not know why I thought it looked like an Armenian Gull Larus armenicus but I quickly slammed the brakes, checked the gull in my tele-scope and – much to my surprise – noted that it really looked like an adult Armenian. Luckily, I had brought my camera and managed to take a number of photographs before it suddenly took off and flew north-west. A few minutes later, it re-turned and I was able to take some more photo-graphs. I called a number of birders and told them about my observation. In total, seven local birders managed to see the bird before it again disap-peared to the north-west over the community of Blåvand, never to be seen again. The bird was ac-cepted by the Danish rarities committee as the first Armenian Gull for Denmark and western Europe (Olsen et al 2019).DescriptionThe description is based on field impressions and photographs (plate 456-459). The bird was mostly on its own and could not be compared directly with other gulls. At one point, however, c five European Herring Gulls L argentatus were stand-ing at a short distance from it.SIZE & STRUCTURE  Appearing smaller than European Herring Gull and more slender and longer winged, more similar to Lesser Black-backed Gull L fuscus. In flight, appearing more robust, like European Herring. Head profile very characteristic, appearing rounder headed than European Herring. Bill short and thick, giving com-pletely different impression from other large gulls in Europe.HEAD  All white.UPPERPARTS  Dark grey, darker than in European Herring and also seeming darker than in Yellow-legged Gull L michahellis. UNDERPARTS  White.WING  Primaries very black and conspicuous. Tertials with broad white edges. Whole hand extensively black, with only small white mirror on p10. Black reaching all the way inwards to p4 and present on both webs of p4 (plate 457-459).lijke kuif, overwegend zwarte bovendelen, lichtere on-derdelen, roestkleurige keel en overwegend roodbruine bovenvleugel en ondervleugel. De vogel werd gedeter-mineerd als eerstejaars op basis van de handpenrui. Dit betrof het eerste geval voor Oman en de ‘grote WP’. De soort komt voor in grote delen van zuidelijk Azië en noordelijke populaties overwinteren van Zuid-India tot de Filippijnen. Gevallen in Japan en Zuid-Korea en op de Malediven, de Spratlyeilanden, Palau en de Kokos eilan-den geven aan dat de soort als dwaalgast ver buiten de reguliere gebieden kan opduiken en vluchten over open zee niet schuwt. De waarneming in Oman was waar-schijnlijk gerelateerd aan uitzonderlijke weersomstan-digheden met cyclonen boven de Indische Oceaan.ReferencesCarter, M, Baxter, R, Mustafa, J, Shore, R & Christie, G 2019. Chestnut-winged Cuckoo Clamator coroman-dus on Home Island, Cocos (Keeling) Islands, 3rd December 2018 to 18th February 2019. A new bird for Australia and its territories. Website: www.birdlife.org.au/documents/barc/SUB1065.pdf. del Hoyo, J & Collar, N J 2014. HBW and BirdLife Inter-national illustrated checklist of the birds of the world 1: non-passerines. Barcelona. Erritzøe, J, Mann, C F, Brammer, F & Fuller, R A 2012. Cuckoos of the world. London.Payne, R B 2005. The cuckoos. Oxford. Payne, R & Kirwan, G M 2020. Chestnut-winged Cuckoo Clamator coromandus. In: del Hoyo, J, Elliott, A, Sargatal, J, Christie, D A & de Juana, E (editors), Birds of the world, Ithaca. Website: https://doi.org/10.2173/bow.chwcuc1.01. Porter, R & Aspinall, S 2010. Birds of the Middle East. Second edition. London. Wells, D R 1999. The birds of the Thai-Malay Peninsula. London.Petteri Lehikoinen, Finnish Museum of Natural History, PO box 17, 00014 University of Helsinki, Finland (petteri.lehikoinen@helsinki.fi)Dick Forsman, PO box 46, 02401 Kirkkonummi, Finland (dick@dickforsman.com)Chestnut-winged Cuckoo at Ayn Hamran, Oman, in December 2019

Chestnut-winged Cuckoo at Ayn Hamran, Oman in December 2019

https://helda.helsinki.fi/bitstream/10138/323313/1/DB_2020_42_5_CWC.pdf

Chestnut-winged Cuckoo at Ayn Hamran, Oman in December 2019

Abstract

Similar works

Full text

Available Versions

Helsingin yliopiston digitaalinen arkisto