The mitochondrial hypervariable region 1 (HVR1) sequence of 67 goats belonging to the Girgentana, Maltese and Derivata di Siria breeds was partially sequenced in order to present the first phylogenetic characterization of Sicilian goat breeds. These sequences were compared with published sequences of Indian and Pakistani domestic goats and wild goats. Mitochondrial lineage A was observed in most of the Sicilian goats. However, three Girgentana haplotypes were highly divergent from the Capra hircus clade, indicating that a new mtDNA lineage in domestic goats was found

BALLESTER M

FINOCCHIARO, Raffaella

FOLCH M.

MARMI J

PORTOLANO, Baldassare

SARDINA, Maria Teresa

VAN KAAM JBCHM

Archivio istituzionale della ricerca - Università di Palermo

SHORT COMMUNICATION doi:10.1111/j.1365-2052.2006.01451.xPhylogenetic analysis of Sicilian goats reveals a new mtDNA lineageM. T. Sardina*, M. Ballester†, J. Marmi†, R. Finocchiaro*, J. B. C. H. M. van Kaam‡, B. Portolano*and J. M. Folch†*Dipartimento S.En.Fi.Mi.Zo.-Sezione Produzioni Animali, Facolta` di Agraria, Universita` degli Studi di Palermo, Viale delle Scienze, Palermo90128, Italy. †Departament de Cie`ncia Animal i dels Aliments, Facultat de Veterina`ria, Universitat Auto`noma de Barcelona, Bellaterra 08193,Spain. ‡Istituto Zooprofilattico Sperimentale della Sicilia A. Mirri, Via G. Marinuzzi 3, 90129 Palermo, ItalySummary The mitochondrial hypervariable region 1 (HVR1) sequence of 67 goats belonging to theGirgentana, Maltese and Derivata di Siria breeds was partially sequenced in order to presentthe first phylogenetic characterization of Sicilian goat breeds. These sequences were com-pared with published sequences of Indian and Pakistani domestic goats and wild goats.Mitochondrial lineage A was observed in most of the Sicilian goats. However, threeGirgentana haplotypes were highly divergent from the Capra hircus clade, indicating that anew mtDNA lineage in domestic goats was found.Keywords goat, hypervariable region 1, mitochondrial DNA, Sicilian breeds.Domestic goats (Capra hircus) are important and adaptableanimals that humans have domesticated (Porter 1996).They provide a full range of useful products to humansincluding meat, milk, skin and hair. Archaeological studiesshowed that goats were probably first domesticated in theFertile Crescent region around 10 000 years ago (Zeder &Hesse 2000). Mannen et al. (2001) have suggested that atleast two wild species of the genus Capra have contributed tothe gene pool of domestic goats, whereas a second inde-pendent domestication event may have given rise to theCashmere-like goat breeds in Pakistan (Meadow 1993).However, most of the issues related to the origins ofdomestic goats still remain uncertain and controversial.To elucidate the origin and genetic diversity of caprinebreeds, recent studies based on mtDNA sequences (Luikartet al. 2001; Sultana et al. 2003; Joshi et al. 2004) haveallowed the identification of several maternal lineages,suggesting that the goat was domesticated from differentpopulations of the wild bezoar goat (Capra aegagrus). Indomestic goats five maternal lineages (A–E) have beendescribed based on mtDNA data. Luikart et al. (2001) par-tially sequenced the mtDNA hypervariable region 1 (HVR1)and defined mitochondrial lineages A, B and C. Mitoch-ondrial lineage A is predominant and corresponds to theinitial domestication event. Mitochondrial lineages B(detected in India, Malaysia, Mongolia and Pakistan) and C(detected in Slovenia, Switzerland and Mongolia) representrecent secondary expansions. Most recently, Sultana et al.(2003) found mitochondrial lineage C in Pakistan, and Joshiet al. (2004) detected mitochondrial lineages D and E inIndia. Chen et al. (2005) found the four mitochondriallineages A, B, C and D in Chinese goat breeds.There are several hypotheses about the origin of Siciliangoats. According to morphology, the Girgentana breedprobably came from Afghanistan and the Himalaya regions(Portolano 1987). The origin of Maltese and Derivata di Siriagoats remains uncertain. However, it has been suggested thatthe Maltese goat originated in Malta Island due to crossesamong the typical Mediterranean common goat and somebreeds fromNorth Africa; the Derivata di Siria probably camefrom the Middle East (Porter 1996). In 1983, the Girgentanapopulation consisted of 30 000 (AssociazioneNazionale dellaPastorizia (ASSONAPA 1984), while 10 years later almost98% of the initial population disappeared (Giaccone et al.1994). The aim of this study was to genetically characterizeSicilian goat breeds using the mtDNA HVR1 sequence. Itshould be noted that Maltese and Derivata di Siria goats wereinvestigated previously using blood biochemical polymor-phisms (Rasero et al. 1988).Blood samples from 67 Sicilian goats were collected fromthe Agrigento (Girgentana n ¼ 33, Maltese n ¼ 11 andDerivata di Siria n ¼ 9) and Palermo (Girgentana n ¼ 14)provinces. DNA was isolated from blood samples using aphenol–chloroform extraction method.A fragment of the mtDNA control region was ampli-fied using primers CGCTCGCCTACACACAAATA andAddress for correspondenceJosep M. Folch, Departament de Cie`ncia Animal i dels Aliments, Fac-ultat de Veterina`ria, Universitat Auto`noma de Barcelona, Bellaterra08193, Spain.E-mail: josepmaria.folch@uab.esAccepted for publication 17 February 2006 2006 The Authors, Journal compilation  2006 International Society for Animal Genetics, Animal Genetics, 37, 376–378376AATGCCCATGCCTACCATTA (Amills et al. 2004), resultingin 546-bp fragment. Amplified products were sequenced ina 3730 DNA Analyser (Applied Biosystems, Foster City, CA,USA) according to the manufacturer’s instructions.Sequences (DQ241305–DQ241371) were aligned viaClustal W (Thompson et al. 1994) using BioEdit v7.0.5(Hall 1999). Included in the analysis were 14 mtDNAHVR1 sequences from seven wild goat speciesTable 1 Molecular diversity indices from546 bp of the mtDNA hypervariable region 1sequence in the Girgentana, Maltese, andDerivata di Siria breeds, and across these threebreeds (all Sicilian). Haplotype and nucleotidediversities include standard deviations.BreedSamplesize(n)No.haplotypesHaplotypediversity (h)No.polymorphicsitesNucleotidediversity (p)Girgentana 47 24 0.963 ± 0.011 78 0.02415 ± 0.00530Maltese 11 6 0.855 ± 0.085 13 0.00917 ± 0.00130Derivata di Siria 9 5 0.806 ± 0.120 19 0.01252 ± 0.00237All Sicilian 67 33 0.969 ± 0.007 84 0.02359 ± 0.004500.05GirgentanaC. caucasica C. cylindricornis C. nubianaC. aegagrusC. falconeriC. cylindricornisC. sibiricaC. hircus lineage CC. hircus lineage BC. hircus lineage DSicilianHaplotypesC. hircus lineage A0.05959996979479 GirgentanaMalteseDerivata di SiriaFigure 1 Neighbour-joining tree obtained considering haplotypes from Sicilian and wild goats, as well as sequences from GenBank. 2006 The Authors, Journal compilation  2006 International Society for Animal Genetics, Animal Genetics, 37, 376–378Phylogenetic analysis of Sicilian goats 377(AB044305–AB044306, AJ317864–AJ317875), as wellas sequences of domestic goats from Joshi et al. (2004)(AY155674, AY155875, AY155883 and AY156039)and from Sultana et al. (2003) (AB044295–AB044304,AB110552–AB110589). Positions 15 705–16 250 ofall sequences were analysed. Using the DnaSP v4.10.3software (Rozas et al. 2003), genetic diversity indices(number of haplotypes, haplotype diversity, number ofpolymorphic sites and nucleotide diversity) were deter-mined for each breed as well as for the whole Sicilianpopulation (Table 1). A neighbour-joining (NJ) tree wasconstructed with MEGA v3.0 (Kumar et al. 2004) usingthe Tamura–Nei model with a ¼ 0.29 (according toLuikart et al. 2001) and 1000 bootstrap replications.Genetic distances between Sicilian breeds were computedwith the same parameters.Thirty-three haplotypes were obtained from the 67 HVR1sequences; these included five haplotypes typical for theMaltese breed and four haplotypes typical for the Derivata diSiria breed. Only two haplotypes were shared betweenbreeds, one between the Girgentana and Maltese breeds andone between the Girgentana and Derivata di Siria breeds.The remaining 22 haplotypes were typical for the Girgen-tana breed. The Girgentana goat breed displayed the highesthaplotype diversity (0.963 ± 0.011) and nucleotide diver-sity (0.02415 ± 0.00530). This haplotype diversity is inaccordance with the previously described values in Indianand Chinese goats (Joshi et al. 2004; Chen et al. 2005respectively), although the Girgentana breed suffered adrastic decrease in its population size during the 1980s.Genetic distances comparing Girgentana vs. Maltese andDerivata di Siria were 0.023 ± 0.004 and 0.026 ± 0.004respectively. The lowest genetic distance was found betweenthe Maltese and Derivata di Siria breeds (0.012 ± 0.003).The NJ tree (Fig. 1) indicates that some Sicilian hapl-otypes were more closely related than with other popu-lations, suggesting genetic isolation in Sicilian breeds. Themitochondrial lineage A was detected in all Sicilianhaplotypes with the exception of three Girgentana hapl-otypes that were very different from previously describedlineages. These three haplotypes clustered with wild goathaplotypes (Fig. 1). This result could be explained assu-ming a new mtDNA lineage or a historical introgressionfrom wild goats. Further studies will be needed toinvestigate the origin of the Girgentana goat, one of themost autochthonous breeds in Sicily. In addition, theextinction of the Girgentana breed may result in the lossof important genotypes in domestic goats. This reinforcesthe need to promote a conservation program to avoid theextinction of Girgentana goat breed.AcknowledgementsThis research was conducted while the first author wassupported by a grant of the University of Palermo. Dr J. B. C.H. M. van Kaam had a Marie Curie European ReintegrationGrant of the European Community programme Quality ofLife under contract number MERG-CT-2004-516458 dur-ing this research.ReferencesAmills M., Capote J., Toma`s A., Kelly L., Obexer-Ruff G., AngiolilloA. & Sanchez A. (2004). Strong phylogeographic relationshipsamong three goat breeds from the Canary Islands. Journal of DairyResearch 71, 257–62.Associazione Nazionale della Pastorizia (ASSONAPA) (1984). LibroGenealogico Nazionale della Specie Caprina. Regolamenti, Roma,Italy.Chen S.-Y., Su Y.-H., Wu S.-F., Sha T. & Zang Y.-P. (2005). Mi-tochondrial diversity and phylogeographic structure of Chinesedomestic goats.Molecular Phylogenetics and Evolution 37, 804–14.Giaccone P., Portolano B., Bonanno A. & Leto G. (1994). Aspettiquantitativi della produzione lattea ed analisi della variabilita`ambientale in caprini di razza Girgentana. Tecnica Agricola 46,3–18.Hall T.A. (1999). BIOEDIT: a user-friendly biological sequencealignment editor and analysis program for Windows 95/98/NT.Nucleic Acids Symposium Series 41, 95–8.Joshi M.B., Rout P.K., Mandal A.K., Tyler-Smith C., Singh L. &Thangaraj K. (2004). Phylogeography and origin of Indiandomestic goats. Molecular Biology and Evolution 21, 454–62.Kumar S., Tamura K. & Nei M. (2004). MEGA3: integrated softwarefor molecular evolutionary genetics analysis and sequencealignment. Briefings in Bioinformatics 5, 150–63.Luikart G., Gielly L., Excoffier L., Vigne J-D., Bouvet J. & Taberlet P.(2001). Multiple maternal origins and weak phylogeographicstructure in domestic goats. Proceedings of the National Academy ofSciences of the United States of America 98, 5927–32.Mannen H., Nagata Y. & Tsuji S. (2001). Mitochondrial DNA revealthat domestic goat (Capra hircus) are genetically affected by twosubspecies of bezoar (Capra aegagrus). Biochemical Genetics 39,145–54.Meadow R.H. (1993). Animal domestication in the Middle East: arevised view from the eastern margin. In: Harappan Civilization(Ed. by G.L. Possehl), pp. 295–320. Oxford and IBH, New Delhi.Porter V. (1996). Goats of the World. Farming Press, Ipswich, UK.Portolano N. (1987). Pecore e Capre Italiane, pp. 249–73. Edagricole,Bologna.Rasero R., Di Stasio L., Facello C., Giaccone P., Berra G.P. (1988).Polimorfismo biochimico del sangue di capra. Atti SISVETMantova, 29 Settembre – 1 Ottobre. 42, 1331–3.Rozas J., Sa´nchez-DelBarrio J.C., Messeguer X. & Rozas R. (2003).DnaSP, DNA polymorphism analyses by the coalescent and othermethods. Bioinformatics 19, 2496–7.Sultana S., Mannen H. & Tsuji S. (2003). Mitochondrial DNAdiversity of Pakistani goats. Animal Genetics 34, 417–21.Thompson J.D., Higgins D.G. & Gibson T.J. (1994). Clustal W: im-proving the sensitivity of progressive multiple sequences align-ment through sequence weighting, position specific gap penaltiesand weight matrix choice. Nucleic Acids Research 22, 4673–80.Zeder M. & Hesse B. (2000). The initial domestication of goat (Caprahircus) in the Zagros Mountain 10,000 years ago. Science 287,2254–7. 2006 The Authors, Journal compilation  2006 International Society for Animal Genetics, Animal Genetics, 37, 376–378Sardina et al.378

Phylogenetic analysis of Sicilian goats reveals a new mtDNA lineage

https://iris.unipa.it/retrieve/handle/10447/13692/150372/Sardina%20et%20al.%2c%202006_Phylogenetic%20analysis%20of%20Sicilian%20goats%20reveals%20a%20new%20mtDNA%20lineage.pdf

Phylogenetic analysis of Sicilian goats reveals a new mtDNA lineage

Abstract

Similar works

Full text

Available Versions

Archivio istituzionale della ricerca - Università di Palermo