ASSUNÇÃO, M. C.

COSTA, M. G. S.

FAVORETO, L.

MACHADO, A. C. Z.

MUNIZ, M. F. S.

NORONHA, M. de A.

Repository Open Access to Scientific Information from Embrapa

Disease NotesDiseases Caused by NematodesFirst Report of Aphelenchoides besseyi Causing Leaf Spot on Yam(Dioscorea cayenensis) in BrazilM. A. Noronha,1 M. C. Assunção,2,† M. G. S. Costa,3 M. F. S. Muniz,3L. Favoreto,4 B. C. Sercero,5 and A. C. Z. Machado51 Embrapa Tabuleiros Costeiros, Rio Largo, AL, Brazil2 Universidade Federal Rural de Pernambuco, Recife, PE, Brazil3 Universidade Federal de Alagoas/Centro de Ciências Agrárias, Rio Largo,AL, Brazil4 Epamig Oeste, Uberaba, MG, Brazil5 IAPAR, Londrina, PR, BrazilPlant Dis. 104:3 3, 2020; published online as https://doi.org/10.1094/PDIS-03-20-0511-PDN. Accepted for publication 2 June 2020.The main yam (Dioscorea cayenensis) production fields in Brazil arelocated in the northeastern region, particularly in the States of Paraı́ba,Pernambuco, Alagoas, and Bahia. From 2017 to 2019, yam plants showingangular dark brown lesions on leaves, associated with severe defoliation,were observed in a field inspection of yam production in the states of Alagoasand Sergipe. Samples of symptomatic leaf tissue were collected andimmersed in distilled water in Petri dishes for 4 h. Subsequently, an aliquotof water suspension was examined under an inverted light microscope, andnematodes with morphological characters of the genus Aphelenchoides wereobserved. Nematode population densities were up to 113 specimens per gramof tissue. Identification to the species level was based on morphological andmorphometric characteristics according to descriptions by OEPP/EPPO(2017) and through a molecular approach based on sequencing of the D2/D3rDNA region with the universal primers D2A and D2B (Al-Banna et al.1997) and using the species-specific primer pair Abess_11F/Abess_11R(GTATTCAATCCCGCGACACT/CATCCTGTTCGGGCATAGTT) forAphelenchoides besseyi located in the 28S rDNA (Sercero 2020). Anamplicon of 745 bp (accession no. MK880169) showed 99.79% identitywith known sequences of A. besseyi (KX622689, KY123700, andKX356776), and the PCR with the species-specific primer resulted in afragment of 570 bp, characteristic of A. besseyi. Morphologically,females were slender with a short stylet (11.2 µm long), lateral field withfour incisures, and conoid tail with star-shaped mucro. A pathogenicitytest was performed in three plants, and three leaf discs containing infectedtissue were deposited and fixed with adhesive tape on the abaxial surfaceof each of the three healthy leaves of D. cayenensis, which were kept in ahumidity chamber for 72 h. Plants were maintained in a greenhouse, andafter 20 days similar symptoms to those observed under field conditionswere detected. Specimens of A. besseyi were extracted from thegreenhouse-grown plants, fulfilling the modified Koch’s postulates.Control plants did not show any symptoms, and nematodes were notrecovered from them. A. besseyi has been reported in D. trifida inGuadeloupe (Kermarrec and Anais 1973). However, to our knowledge,this is the first report of A. besseyi parasitizing foliage of D. cayenensis inBrazil.References:Al-Banna, L., et al. 1997. Mol. Phyl. Evol. 7:94.Kermarrec, A., and Anais, A. 1973. Turrialba 23:389.OEPP/EPPO. 2017. OEPP/EPPO Bull. 47:384.Sercero, B. C. 2020. Development of a molecular tool for the diagnosis ofAphelenchoides besseyi. Instituto Agronômico do Paraná, Londrina, PR, Brazil.http://200.201.27.34/mestrado-bibpos/The author(s) declare no conflict of interest.e-XtraKeywords: leaf nematode, tuber crop, pathogen detection†Indicates the corresponding author.E-mail: mayara_castroa@hotmail.com (M.C.A.ç.ã.)Plant Disease /November 2020 308308

First Report of Aphelenchoides besseyi Causing Leaf Spot on Yam (Dioscorea cayenensis) in Brazil.

http://www.alice.cnptia.embrapa.br/bitstream/doc/1128708/1/Aphelencoides-em-inhame-marissonia.pdf

First Report of Aphelenchoides besseyi Causing Leaf Spot on Yam (Dioscorea cayenensis) in Brazil.

Abstract

Similar works

Full text

Available Versions

Repository Open Access to Scientific Information from Embrapa