ABUD, S.

ARAGÃO, F. J. L.

RECH, E. L.

SOUZA, P. I. M.

TINOCO, M. L.

VIANNA, G. R.

English

Repository Open Access to Scientific Information from Embrapa

BIOLOGIA PLANTARUM 50 (1): 146-148, 2006 146 BRIEF COMMUNICATION   Radiation as a tool to remove selective marker genes  from transgenic soybean plants   M.L. TINOCO*,***, G.R. VIANNA*, S. ABUD**, P.I.M. SOUZA**, E.L. RECH* and F.J.L. ARAGÃO*1  Embrapa Recursos Genéticos e Biotecnologia, PqEB - W3 Norte, 70770-900, Brasília, DF., Brazil* Embrapa Cerrados, Rod. Brasília-Fortaleza (BR 020), Km 18, 73301-970, Planaltina, DF., Brazil** Universidade de Brasília, Departamento de Biologia Celular, Brasília, 70910-900, DF., Brazil***  Abstract  The present study evaluated the use of γ-radiation to physically remove selective marker genes previously introduced into the soybean genome. Homozygous seeds from a transgenic soybean line carrying the gus and ahas transgenes were irradiated with γ-rays. Six plants presenting a deleted gus gene were analyzed by Southern blot to confirm removal of both ahas and gus genes. Line 1A presented an absence of the gus gene cassette and presence of the ahas gene cassette. Additional key words: γ-radiation, genetically modified plant, Glycine max, mutation.  ⎯⎯⎯⎯  Generation of transgenic plants free of these markers is a current challenge for biotechnology (Aragão and Brasileiro 2002). Consequently, several strategies to remove selective marker genes have been developed, such as co-trans-formation, multi-autotransformation (MAT), intragenomic relocation via transposable elements and site-specific recombination (Aragão et al. 1996, Vergunst and Hooykaas 1999, Ebinuma and Komamine 2001, Pavingerová et al. 2001, Raizada et al. 2001).  Ionizing radiation can generate chromosome breakage whose repair leads to mutations with a large proportion probably involving deletions (Vizir et al. 1996). This technique has been used to induce mutations and improve several seed propagated crops, including soybean (Maluszynski et al. 1991, Tulmann-Neto and Alves 1997, Ahloowalia and Maluszynski 2001). The objective of the present study was to evaluate the effectiveness of  γ-radiation to physically eliminate marker genes introduced into the soybean genome.  Transgenic soybean [Glycine max (L.) Merril],  cv. BR-16 line 8-19, was generated in our laboratory (Aragão et al. 2000), presented a single locus of the plasmid pAG1 containing the ahas gene from Arabidopsis thaliana under control of the ahas promoter and the gus gene (marker gene coding β-glucoronidase) under control of the actin promoter from A. thaliana   (Aragão et al. 2000). Homozygous transgenic seeds (13 % water content) were irradiated with γ-radiation from 60Co at doses of 225, 250, 275, 300 and 350 Gy at room temperature. Seeds were then planted in a greenhouse and allowed to set seed. The M2 generation was analyzed for presence and expression of gus and ahas genes by polymerase chain reaction (PCR). PCR analyses were carried out according to Aragão  et al. (2000). Primers 5’ ACTAGAGATTCCAGCGTCAC 3’ (AHASP within the ahas promoter) and 5’ GTGGCTATACAGATACCTGG 3’ (AHAS500C within the ahas coding sequence) were applied to amplify a 685 bp sequence in transgenic plants containing the foreign ahas gene.  Primers 5’ TTGGGCAGGCCAGCGTATCGT 3’ (GUS251) and 5’ ATCACGCAGTTCAACGCTGAC 3’ (GUS671C) were utilized to amplify a 420 bp sequence within the gus coding sequence. Plants were analyzed for in situ localization of the gus gene expression with a histochemical assay according to Jefferson et al. (1987). In order to determine resistance to the dominant selective ahas gene, all plants were sprayed during the fourth-trifoliate stage with the herbicide Imazapyr (Arsenal®, BASF, Princeston, USA) at 0.01 g m-2. Southern blot analyses were carried out as previously    ⎯⎯⎯⎯  Received 25 April 2004, accepted 11 October 2004. Acknowledgements: We are grateful to Dr. Augusto Tulmann Neto (Centro de Energia Nuclear na Agricultura, CENA/USP) for use of the 60Co source. 1 Corresponding author; fax: (+55) 61 33403658; e-mail: aragao@cenargen.embrapa.br RADIATION REMOVES MARKER GENE 147 described (Sambrook et al. 1989). Genomic DNA  (10 μg), isolated according to Dellaporta et al. (1983), was digested with SpeI, separated on a 1 % agarose gel and transferred to nylon Hybond-N+ membrane. Hybridization was carried out using the ahas and gus cassettes as probes, labeled with α32P dCTP (1.1 × 1014 Bq mol-1) using a random primer DNA labeling kit (Pharmacia Biotech, Piscataway, NJ, USA) according to manufacturer’s instructions. Except for one, all irradiated plants analyzed (7 065) revealed an absence of both genes (0.49 %). Plant 1A from the 275 Gy treatment presented absence of the gus gene and presence of the ahas gene. All 2 499 non-irradiated seeds presented expression of gus gene. Six plants presenting gus gene deletion (8J from treatment 225 Gy; 1A and 5A from treatment 275 Gy; 3E from treatment 300 Gy; 9D and 10E from treatment 350 Gy) were analyzed by Southern blot for presence of both gus and ahas genes integrated into the genome. Results showed an absence of both ahas and gus gene cassettes in the 3E, 5A, 8J, 9D and 10E lines. However, the 1A line presented an absence of the gus gene cassette and a presence of the ahas gene cassette (Fig. 1, lane 1). Since the plasmid pAG1, used to transform the 8-19 line, has a unique SpeI restriction site, Southern blot analysis helped confirm integration of a single copy of the ahas gene and two copies of the gus cassette. DNA isolated from non-transformed plants did not hybridize with the ahas and gus probes (Fig. 1A, lane 2; Fig. 1B, lane 2).   Fig. 1. Southern blot analysis of soybean transgenic line 8-19 (M2 generation) irradiated with γ-rays. DNAs were digestedwith SpeI, transferred to a nylon membrane and probed withgus (A) and ahas (B). Lane 1: transgenic line 8-19 (not treated);lane 2: non-transgenic plant; lanes 3 - 8: plants 1A, 3E, 5A, 8J,9D and 10E, respectively. Size of molecular markers isindicated on the left.   Plants received a treatment of herbicide Imazapyr to evaluate the functionality of the ahas gene. Following the herbicide treatment, no symptoms were observed in plant 1A. As expected, red vein symptoms typically seen in imidazolinone-treated plants were observed in 3E, 5A, 8J, 9D, 10E and control plants (non-transgenic), which died two weeks after herbicide treatment.  The 36 plants analyzed by PCR were allowed to grow to maturity and set pods. Thirty plants, including plant 1A, presented a normal phenotype with normal growth, pods and seed production (Fig. 2A). On the other hand, two plants presented dwarfism as well as wrinkled leaves and pods (Fig. 2B), and four presented a base-branched phenotype.   Fig. 2. Mutated line 1A presenting a normal phenotype (A) and the mutated line 8C (treated with 350 Gy) presenting dwarfism and wrinkled leaves (B).  Results support the hypothesis that γ-radiation can be utilized to physically remove a specific gene (gus) from a transgenic soybean line, that contains other genomically integrated transgene. Reports have demonstrated that soybean seeds have been mutagenized with either ethyl methanesulphonate (EMS), γ-radiation or sodium azide (NaN3) (Carroll et al. 1986, Tulmann-Neto and Alves 1997). EMS is notably recognized as the most utilized and efficient agent in generating soybean non-sense mutant plants. It has been applied to generate plants with a deleted gene that remain integrated in the genome rather than physically removed from it. On the other hand, non-sense mutations could be restored and gene expression spontaneously reverted to normal at a frequency ranging from 10-7 to 10-8 events per base pair (Kovalchuk et al. 2000).  Southern blot analyses revealed that plants presenting gus gene deletion did not contain the gene integrated into the genome. These results have shown that γ-radiation treatments were efficient in physically removing the transgenes.  Since just one line presented the desired genotype (1A) achieved with radiation dosage 275 Gy (frequency of 0.40 %), this treatment can not be recommended as F.J.L. ARAGÃO et al. 148 optimal. On the other hand, treatments 275, 300 and 350 Gy presented 2 (0.13 %), 10 (0.69 %) and 15 (1.16 %) plants with an abnormal phenotype (Fig. 2). Consequently, treatments above 300 Gy should be avoided. The other treatments did not present detectable abnormal phenotypes.  Transgenic plants constitute a useful system to study biochemical modifications of DNA bases and strand breaks that can result in point mutations, insertions, deletions or gross rearrangements.   References  Ahloowalia, B.S., Maluszynski, M.: Induced mutations – A new paradigm in plant breeding. - Euphytica 118: 167-173, 2001.  Aragão, F.J.L., Barros, L.M.G., Brasileiro, A.C.M., Ribeiro, S.G., Smith, F.D., Sanford, J.C., Faria, J.C., Rech, E.L.: Inheritance of foreign genes in transgenic bean (Phaseolus vulgaris L.) co-transformed via particle bombardment. - Theor. appl. Genet. 93: 142-150, 1996. Aragão, F.J.L., Brasileiro, A.C.M.: Positive, negative and marker-free strategies for transgenic plant cell selection. - Braz. J. Plant. Physiol. 14: 1-10, 2002. Aragão, F.J.L., Sarokin, L., Vianna, G.R., Rech, E.L.: Selection of transgenic meristematic cells utilizing a herbicidal molecule results in the recovery of fertile transgenic soybean (Glycine max (L.) Merril) plants at high frequency. - Theor. appl. Genet. 101: 1-6, 2000. Carroll, B.J., McNeil, D.L., Gresshoff, P.M.: Mutagenesis of soybean Glycine max (L.) Merr.) and the isolation of non-nodulating mutants. - Plant Sci. 47: 109-114, 1986. Dellaporta, S.L., Wood, J., Hicks, J.B.: A plant DNA minipreparation: version II. - Plant mol. Biol. Rep. 1: 19-21, 1983. Ebinuma, H., Komamine, A.: MAT (Multi-Auto-Transformation) vector system. The oncogenes of Agrobacterium as positive markers for regeneration and selection of marker-free transgenic plants. - In Vitro cell. dev. Biol. Plant 37: 103-113, 2001. Jefferson, R.A., Kavanagh, T.A., Bevan, M.W.: GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. - EMBO J. 6: 3901-3907, 1987. Kovalchuk, I., Kovalchuk, O., Hohn, B.: Genome-wide variation of the somatic mutation frequency in transgenic plants. - EMBO J. 19: 4431-4438, 2000. Maluszynski, M., Sigurbjornsson, B. Amano, E. Sitch, L., Kamra, O.: Mutant varieties Data Bank. - Mut. Breed. Newslett. 38: 16-49, 1991. Pavingerová, D., Bříza, J., Niedermeierová, H.: Timing of transposition of Ac mobile element in potato. - Biol. Plant. 44: 347-353, 2001. Raizada, M.N., Nan G.L.,, Walbot, V.: Somatic and germinal mobility of the Rescue Mu transposon in transgenic maize. - Plant Cell 13: 1587-1608, 2001.  Sambrook, J., Fritsch, E.F., Maniatis, T.: Molecular Cloning: a Laboratory Manual. - Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989. Tulmann-Neto, A., Alves, M.C.: Induction of mutations for earliness in the soybean cultivar Paraná. - Braz. J. Genet. 20: 45-50, 1997. Vergunst, A.C., Hooykaas, P.J.J.: Recombination in the plant genome and its application in biotechnology. - Crit. Rev. Plant Sci. 18: 1-31, 1999. Vizir, I.Y., Thorlby, G., Mulligan, B.J.: Classical mutagenesis and genetic analysis. - In: Foster, G.D., Twell, D. (ed.): Gene Isolation, Principles and Practice. Pp. 215-245. Wiley, London 1996.  

Radiation as a tool to remove selective marker genes from transgenic soybean plants.

http://www.alice.cnptia.embrapa.br/bitstream/doc/188034/1/ID275331.pdf

Radiation as a tool to remove selective marker genes from transgenic soybean plants.

Abstract

Similar works

Full text

Available Versions

Repository Open Access to Scientific Information from Embrapa