ALMEIDA, E. R. P. de

CARVALHO, L. J. C. B.

GANDER, E. S.

SOUZA, C. R. B. de

English

Repository Open Access to Scientific Information from Embrapa

Protein & Peptide Letters, 2006, 13, 653-657 653 0929-8665/06 $50.00+.00 © 2006 Bentham Science Publishers Ltd.A cDNA Sequence Coding for a Glutamic Acid-Rich Protein Is Differen-tially Expressed in Cassava Storage RootsCláudia Regina Batista de Souza1,2, Luiz Joaquim Castelo Branco Carvalho1,Elionor Rita Pereira de Almeida1 and Eugen Silvano Gander1,*1EMBRAPA – Recursos Genéticos e Biotecnologia, Caixa Postal 02372, Brasília-DF, 70770-900, Brazil; 2Current Ad-dress: Universidade Federal do Pará (UFPA), Rua Augusto Correa n. 01, Departamento de Genética, Guamá, Belém-PA, 66075-110, BrazilAbstract: We report the isolation and characterization of a cDNA sequence (Mec1) coding for a glutamic acid-rich pro-tein (Pt2L4) from cassava storage roots. Comparative sequence analysis showed a high identity of Pt2L4 with cassavaprotein C54, which is expressed in vascular tissues of storage roots. Northern blot analysis showed that the Mec1 tran-script expression pattern might be related to the maturation of the storage parenchyma cells.Keywords: Cassava, gene expression, Pt2L4 protein, secondary growth, storage root formation.INTRODUCTIONCassava (Manihot esculenta Crantz) belongs to theEuphorbiaceae and ranks fourth, after rice, sugar cane andmaize [1], as a source of calories and is the major staple foodfor more than 600 million people in Africa, Latin Americaand Asia [2].The cassava storage root (CSR) contains about 85% car-bohydrates, 1% proteins (dry weight) and a few other nutri-ents [2]. The CSR results from the swelling of adventitiousroots through secondary growth. Anatomical studies of theCSR differentiate three major tissue systems [3, 4] and amodel for tissue organization, suitable for gene expressionanalyses, has been proposed [5, 6]. According to this model;tissue system I is composed of phellogen and phelloderm,tissue system II of phloem and vascular cambium, and tissuesystem III of secondary xylem with its highly specializedparenchyma cells packed with starch granules [5, 6]. The fewapproaches to study and/or alter protein content and poly-morphism in CSR have been undertaken either by conven-tional breeding [7, 8] or by biochemical and biotechnologicalmethods [9, 10, 11]. So far, only few investigations bear onthe isolation of proteins and their respective genes in cassavastorage roots [6, 12-15] and in our laboratory two major,alcohol soluble proteins, designated Pt2L4 and Pt3L4, whichare differentially expressed in CSR compartments, were iso-lated and partially characterized [6, 13].In the present communication, we report the isolation andcharacterization of a cDNA sequence (Mec1), coding for thePt2L4 protein. The deduced amino acid sequence shows thatPt2L4 is a glutamic acid rich protein with a molecular weightof 18.8 kDa and a predicted isoelectric point of 3.75. Thehigh identity of Pt2L4 with cassava protein C54 (14), and the*Address correspondence to this author at the EMBRAPA – Recursos Ge-néticos e Biotecnologia, Caixa Postal 02372, Brasília-DF, 70770-900,Brazil; E-mail: egander@cenargen.embrapa.brMec1 expression pattern that is related to the maturation ofthe storage parenchyma cells, indicate a function related tostorage root formation.MATERIALS AND METHODSPlant MaterialPlants of the commercial cultivar IAC 12-829 werepropagated by stem cuttings and planted in field plots ofEMBRAPA – Genetic Resources and Biotechnology andgrown for 10 months. Storage roots were harvested and rootsof uniform 5 cm diameter were sampled to dissect tissuelayers according to our compartmentalization model (Fig. 1).Dissected tissue layers were processed on ice and immedi-ately placed in liquid nitrogen. Young stem, stem peel, fruitswith seeds, leaves, and cotyledons were treated equally andwere used for total RNA extraction. If not immediately proc-essed samples for total RNA and protein extraction werestored at -80°C until use. Young leaves were harvested in thefield, immediately immersed in liquid nitrogen and used forgenomic DNA extraction.Isolation of cDNA and Nucleotide Sequence AnalysisTotal RNA from manually dissected storage root layersL1 to L5, and from cotyledons, young stems, petioles andleaves of cassava plants were extracted as described previ-ously [13].Based on the partial sequence information of the Pt2L4described before [13], specific primers were designed andused in a RACE PCR amplification system (GIBCO BRL).The primers were: Pr1: 5'acagtagagaaaactgaagaa3' (forward),Pr2: 5'cacaacaacggtctctgctgctgg3' (reverse) Pr3: 5’atggctactgctgaggtagta3’ (forward) and Pr4: 5’ctcagtcttctcagcttcaac3’(reverse). PCR products were cloned into the pGEM-T EasyVector System (Promega) and sequenced in an ABI 377automated sequencer (Perkin-Elmer, Foster City, CA). ThecDNA sequence was aligned to the Gene Bank nucleotidesequence databank using the BLAST algorithm [16].654    Protein & Peptide Letters, 2006, Vol. 13, No. 7 de Souza et al.RNA Gel-Blot AnalysisTotal RNA samples from different tissue of roots andfrom cotyledons, young stems, petioles and leaves of cassavaplants were isolated as described above. Northern analysiswith the Mec1 cDNA as probe was performed as describedbefore [13].Genomic DNA Gel-Blot AnalysisGenomic DNA from young cassava leaves was extractedas described by Deblaere et al.  [17]. Samples containing 10µg of DNA were restriction digested with Bgl II, Eco RI,Hind III and Nsi I and separated by electrophoresis on 0.7%agarose gel. The DNA fragments were blotted on a HybondN+ membrane and probed with [32P] labeled Mec1 cDNA.Microscopic AnalysisHand sections of fresh storage root were treated with O-toluidine blue to identify tissue systems and layers as previ-ously described [5]. 200 µm cross sections from storageroots with advanced secondary growth were observed underthe light microscope (magnification: x100) and photo-graphed on an automatic record system on 100ASA colorfilms. Pictures were converted to digital images and proc-essed for area quantification using the dt-Scan software.RESULTSThe Tissue Organization Model of Cassava StorageRootsFig. 1 shows an O-Toluidine Blue stained [5] cross sec-tion through a 5 cm diameter cassava storage root (Fig. 1A).This type of staining permits the histological distinction ofthe five tissue layers L1 to L5 (Fig. 1B), organized into thethree tissue system TS-I , TS-II and TSIII. Tissue System Icomprises the white outer layer composed of phellogen andphelloderm, next follows the dark-red colored Tissue SystemII composed of secondary phloem and vascular cambium andfinally, the second largest white and dark-red central cylinderof Tissue System III of L3 to L5, composed of the secondaryxylem with its array of vessels and parenchyma cells (Fig.1B).The increase in diameter of the storage root is the resultof the secondary growth pattern, occurring mainly in theoutermost part of the root cylinder. Consequently the innercell layers in the central cylinder are older than those in theouter part and results in distinct cell zones with respect toparenchyma maturation and specialization, i.e., to permanentstarch storage cells in the central cylinder. This zoning pat-tern is shown in Fig. 1B and it can be seen that the propor-tion of early developing parenchyma cells corresponds to87% of total cells in tissue layer 3, decreases to 72% in layer4 and reaches a minimum of 42% in tissue layers 5. Thispattern of aging of parenchyma cells has been related to theaccumulation of amylose, a starch granule constituent thataccumulates in later stages of starch granule formation incassava storage roots [18] and a similar pattern of distincttissue composition and parenchyma cell differentiation hasalso been reported by others [3, 4, 5, 19] and has been usedto study sugar and starch accumulation patterns [18, 20]. Thequantitative analysis of tissue system III also clearly demon-strates an increase of the area occupied by vessels from 13%in L3 to 58% in L5 (Fig. 1B).Figure 1. Identification of tissue systems and layers in a cassava storage root.(A) Cross section with O-Toluidine Blue staining.(B). (L): Tissue layers (TS): Tissue systems and (T): Tissue Type). Note that layers L3,L4 and L5 belong to the same tissue system.Phl: phellogen; Phd: phelloderm; Pho: phloem; Cam: cambium; Y. Par: young developing parenchyma; D. Par: intermediately developedparenchyma; M. Par: mature parenchyma; P. Xyl: primary xylem; S. Xyl: secondary xylem; Par. Cell (% area): % parenchyma cells/ tissuelayer; Xyl. Vessels (% area): % xylem vessels / tissue layer.A cDNA Sequence Coding for a Glutamic Acid-Rich Protein Protein & Peptide Letters, 2006, Vol. 13, No. 7    655Isolation and Characterization of Pt2L4 Coding Se-quencesTwo PCR amplification products of 649 and 426 bp ob-tained with 3´and 5´RACE PCR reactions were cloned andsequenced. A fragment of 649 bp, obtained with the primerpair Pr1/primer-T in the 3´direction, and a fragment of 426bp obtained with the primer pair Pr2/poly C in the5´direction, matched the sequence of the 220 bp Pt2L4 frag-ment previously identified [13]. With a 105 bp overlap in thetwo clones it was possible to isolate a full-length cDNA (Fig.2) coined Mec1. This cDNA sequence of about 970 bp’sconsists of a 531 bp open reading frame (ORF), a 66 bp 5'untranslated region and a 368 bp 3'-noncoding region con-taining a polyadenylation signal (Fig. 2). A cDNA clonecorresponding to a 531 bp ORF was obtained by PCR ampli-fication using primes Pr3 and Pr4. The deduced amino acidsequence consists of 177 residues, accounting for a molecu-lar weight of 18.8 kDa and a predicted isoelectric point of3.75. A BLAST search of Pt2L4 showed the highest similar-ity (62%) with cassava protein C54 (AAP57707) as de-scribed previously by Zhang et al. [14] (Fig. 3). The deducedamino acid composition of the Pt2L4 protein shows that themost abundant amino acids are glutamic acid (31.6%),alanine (16.94%), valine (13.55%) and proline (11.29%).Protein P2L4 contains four repeats of an ETPKEE motif(Fig. 3). In one of these repeats the lysine residue issubstituted by alanine, and in another the threonine issubstituted by valine. Only one of these repeats (italic in Fig.3) is conserved in the C54 protein and so far no function hasbeen related to these elements.Gene Expression Analysis and Gene Copy Number De-terminationTotal RNA blots from different root layers, leaves, stempeels, cotyledons and petioles were hybridized with a 531 bpMec1 probe. In leaves and stem peels no signals were de-tected. In the other RNA samples, however, a transcript ofabout 1.0 kb was observed with varying intensities. In coty-ledons the signal was weak, while in young stems and peti-oles the signal was strong and a pattern, suggesting devel-opmentally related expression, was observed in the differentstorage root layers (Fig. 4).To determine the Mec1 copy number in the cassava ge-nome, genomic DNA was digested with restriction enzymesFigure 2. Mec1 nucleotide sequence and deduced amino acid sequence for Pt2L4 protein. Start codon, stop codon and potential poly (A+)site are bold printed.*The nucleotide sequence data reported here appear in the NCBI GenBank under the accession number AY101376 (c1).656    Protein & Peptide Letters, 2006, Vol. 13, No. 7 de Souza et al.Figure 3. Alignment of deduced amino acid sequence of Pt2L4 with the C54 protein. Identical amino acids are indicated by asterisks underthe alignment. ETPKEE repeats are in bold. Dashes represent gaps for alignment optimization. Sequence alignment was performed withBLAST program.Figure 4. Transcript levels for Mec1 in storage root and tissues.Total RNA (10 µg) from: L1 – L5: the five storage root tissue layers; (Ct.): cotyledon; (YS): young stem; (SP): stem peel; (Pt.): petiole and(Lf.): leaf were separated on formaldehyde-agarose gel, transferred to a Hybond-N+ membrane and probed with Mec1 cDNA labeled with[32P] dCTP. Hybridization with ribosomal 28S RNA is included as a standard.that do not cut within the cDNA sequence and hybridized tothe 531 bp Mec1 probe. Our result showed that the Mec1probe hybridized with a single strong band, however, weaksignals were also detected in all samples, suggesting thatthere are at least two homologous genes in cassava. (Fig. 5),as reported for C54 by Zhang et al. [14].DISCUSSIONWe report the characterization of the Pt2L4 protein fromcassava storage root. The Pt2L4 is a highly acidic proteinwith a predicted molecular weight of 18.8 kDa and a pI of3.75. Based on SDS-PAGE analyses [13], we initially esti-mated its molecular weight at 32 kDa. Recent experiments,however, involving MALDI-ToF analyses, confirmed thepredicted molecular weight of 18.8 kDa (data no shown).This difference in size determination using SDS-PAGE ver-sus molecular weight prediction by nucleotide sequence isoften seen with acidic proteins and has been observed byothers [21, 22] and in the Hev b 5 from Hevea brasiliensis[23].Figure 5. Southern blot of cassava genomic DNA.Ten microgram of DNA was digested with four restriction enzymesNsi I, Hind III, EcoRI and BamH I, separated on a 0.7% agarosegel, transferred to a nylon membrane and hybridized with Mec1probe labeled with 32PdCTP.A cDNA Sequence Coding for a Glutamic Acid-Rich Protein Protein & Peptide Letters, 2006, Vol. 13, No. 7    657The elucidation of the function of Pt2L4 was not the goalof the present study, some hypotheses, however, based onthe protein’s physical-chemical characteristics as well as itsexpression pattern in different tissues and tissue layers, canbe proposed and discussed.As shown in Fig. 4, the mec1 gene is differentially tran-scribed within tissues and storage root tissue layers. Strongtranscription signals were detected in RNAs from youngstems and in the different layers of the storage root tran-scripts increased from the outer to the inner layer (Fig. 4).This pattern parallels the increase in tissue age during secon-dary growth of the storage root. In leaves and stem peels thegene is silent, in stems, however, a marked activity can beseen. Taken these facts together, we propose that Pt2L4 is aprotein involved in secondary growth of the undergroundstorage organ and, in addition, also with the secondarygrowth of stems. The absence of transcripts in leaves andbark is consistent with this interpretation since the tissuetypes present in these organs are mainly vascular and pali-sade parenchyma in leaves, and epidermis and phloem in thecase of peels. Combining the histological aspect of layers 3,4 and 5 (Fig. 1) with the increased presence of Mec1 tran-scripts (Fig. 4), one could speculate whether this protein isnot also involved in the increase of the secondary xylem.These interpretations are supported by the findings of Zhanget al. [14], who showed for cassava protein C54, which ishighly similar to Pt2L4, that the gene’s promoter is active inphloem, cambium and xylem.In addition, we have recently shown by comparative geneexpression studies, that the mec1 gene has a higher expres-sion level in storage roots than in adventitious roots, againindicating its importance in storage root formation [15] andexperiments are under way to elucidate, on the molecularlevel, the exact function of Pt2L4.ACKNOWLEDGEMENTSWe thank Dr. Carlos Bloch Jr. for the MALDI-TOFanalysis. Thanks go to the Brazilian National ResearchCouncil (CNPq) for the fellowship grant # 142760/1996-0 toCRBS, to the Inter-American Institute for Agriculture Coop-eration (IICA) for grants # 244/01 and 305/00 (for CRBS)and to EMBRAPA–Genetic Resources and Biotechnology(grant # 03.1998.027 to LJCBC).REFERENCES[1] Puonti-Kaerlas, J. (1998) Biotech. Genet. Engin. Rev., 15, 329–364.[2] Cock, J.H. (1985) In: Cassava research, production and utilization(Cock J.H. and Reyes J.A.) pp. 716-728. Centro Internacional deAgricultura Tropical, Cali, Colombia.[3] Rateaver, B. (1951) In: Anatomy and regeneration in the stem androot of Manihot utilíssima Pohl. Ph.D. Thesis, University of Michi-gan, Ann Arbor, Michigan, USA.[4] Castilloa, J.J., Castilloa, A. and Pino, L.T. (1997) in La yuca frenteal hambre del mundo tropical” pp. 77-100. Universidad Central deVenezuela, Caracas.[5] Cabral, G.B., Carvalho, L.J.C.B. and Schaal, B.A. (2000) In:Cassava Biotechnology IVth International ScientificMeeting–CBN” (Carvalho L.J.C.B, Thro A.M. and VilarinhosA.D.) pp. 345-356. Embrapa-Recursos Genéticos e Biotecnologia,Brasília-DF, Brazil.[6] de Souza, C.R.B. (2001) In: Isolamento e caracterização molecularde genes e proteínas de raiz de reserva de mandioca (Manihot es-culenta Crantz). PhD thesis, Universidade de Brasília (DF), Brazil.[7] Abraham, A. (1957) Indian J. Gen. Plant Breeding, 17, 212-217.[8] Bolhuis, G.G. (1953) Euphytica, 2, 107-112.[9] Clowes, A.E.E., Tatham, A.S., Beeching, J.R., Shewry, P.R. ( 1994)In: Proceedings of the Second International Scientific Meeting ofthe Cassava Biotechnology Network (Roca W.M. and Thro A.M.)pp. 716-728. Centro Internacional de Agricultura Tropical, Cali,Colombia.[10] Maciel, Z.G.Q., Sousa, A.M., Sousa, J.E.A., Campos, F.A.P.(1994) In: Proceedings of the Second International ScientificMeeting of the Cassava Biotechnology Network (Roca W.M. andThro A.M.) pp. 716-728. Centro Internacional de AgriculturaTropical, Cali, Colombia.[11] Gomez, G. and Noma, A.T. (1986) Nutr. Rep. Int., 33, 595-599.[12] Cabral, G.B. and Carvalho, L.J.C.B. (2001) Braz. J. Plant Physiol.,13, 41-48.[13] de Souza, C.R.B., Carvalho, L.J.C.B., de Almeida, E.R.P. andGander, E.S. (2002) Plant Foods Hum. Nutr., 57, 353-363.[14] Zhang, P., Bohl-Zenger, S., Puonti-Kaerlas, J., Potrykus, I., Gruis-sem, W. (2003) Planta, 218, 192-203.[15] de Souza, C.R.B., Carvalho, L.J.C.B., Cascardo J.C.M. (2004)Protein Pept. Lett., 11 (6), 577-582.[16] Altschul, S.F., Madden, T.L., Shaffer, A.A., Zhang, J., Zangh, Z.,Miller, W., Lipman, D.J. (1997) Nucleic Acids Res., 25, 3389-3402.[17] Deblaere, R., Reynaerts, A., Hofte, H., Hernalsteen, J.P., Leemans,J., Van Montagu, M. (1987) Methods Enzymol., 153, 277-292.[18] Daiuto, E.R. (2000) In: Biosintese de amido durante o crescimentosecundario da raiz de reserva da mandioca. MSc Dissertation, Uni-versidade Estadual de Sao Paulo, Botucatu-SP, Brazil.[19] Indira, P. and Kurian, T. (1977) J. Root Crops, 3, 29-32.[20] O’Hair, S.K. (1989) HortScience, 24, 505-506.[21] Rasmussen, H.B. (1993) APMIS Suppl., 39, 1-28.[22] Hames, B.D. (1981) in Gel Electrophoresis of Proteins (HamesB.D. and Rickwood D.) pp. 1-91. Oxford University Press, NewYork.[23] Slater, J.E., Vedvick, T., Arthur-Smith, A., Trybul, D.E., Kekwick,R.G.O. (1996) J. Biol. Chem., 271, 25394-25399.Received: December 7, 2005 Accepted: March 16, 2006

A cDNA sequence coding for a glutamic acid-rich protein is differentially expressed in cassava storage roots.

http://www.alice.cnptia.embrapa.br/bitstream/doc/185991/1/ID273271.pdf

A cDNA sequence coding for a glutamic acid-rich protein is differentially expressed in cassava storage roots.

Abstract

Similar works

Full text

Available Versions

Repository Open Access to Scientific Information from Embrapa