AZEVEDO, V. C. R.

CIAMPI, A. Y.

VINSON, C.

English

Repository Open Access to Scientific Information from Embrapa

 Molecular Ecology Notes (2005)  5 , 13–15 doi: 10.1111/j.1471-8286.2004.00815.x© 2005 Blackwell Publishing Ltd Blackwell Publishing, Ltd. PRIMER NOTE PRIMER NOTETwelve microsatellite loci in  Manilkara huberi  (Ducke) Standl (Sapotaceae), an Amazonian timber species V .  C .  R .  AZEVEDO,*† C .  C .  VINSON*‡ and A.  Y .  CIAMPI** Embrapa Recursos Genéticos e Biotecnologia, PqEB W5 Norte Final, CEP 70770–900, Brasília DF, Brazil,  † Universidade de Brasília, Campus Darcy Ribeiro, Brasília, DF, Brazil,  ‡ Universidade Federal do Pará, Campus de Bragança, PA, Brazil Abstract Manilkara huberi  is a timber species, found and intensely exploited in the Amazonianforest. Twelve highly polymorphic microsatellite loci were developed from a genomic libraryenriched for AG/TC repeats. Levels of polymorphism were evaluated using a total of 12adult trees from a natural population. An average of 6.43 alleles per locus were detected,and expected heterozygosity ranged from 0.721 to 0.862. These loci represent a powerfultool in investigating the mating system, gene flow, parentage and population dynamics innatural populations of  M. huberi , all of which are needed to implement sound management. Keywords :  conservation, genetic diversity, Manilkara huberi, microsatellite, Sapotaceae Received 16 July 2004; revision received 27 August 2004; accepted 27 August 2004 Simple Sequence Repeats (SSR) or microsatellites exhibit highlevels of variability because of differences in the number ofrepeated units. The high allelic diversity and abundance ofmicrosatellites in the eukaryotic genome make these co-dominant molecular markers popular for detailed geneticstudies. The Dendrogene Project ( Genetic Conservation withinManaged Forests in Amazônia ) is interested in the conserva-tion and management strategies of timber trees from theAmazonian forest (Kanashiro  et al . 2001), such as  Manilkarahuberi  (Ducke) Standl (Sapotaceae), a species intensivelyharvested by the timber industry. As part of this project,we report the development of 12 microsatellite markers;the first on microsatellite cloning for  M. huberi .Total genomic DNA was extracted (Ferreira & Grattapaglia1998) from expanded leaves of a single individual of  M. huberi ,and digested with  Tsp 509 I. Fragments were separated on2% agarose gel, and those from 300 to 800 bp were used toconstruct an enriched genomic library, as described byRafalski  et al . (1996). These fragments were ligated into apGEM-T Easy vector (Promega, Madison, WI) and trans-formed in  Escherichia coli  XL1-Blue, which were grownovernight on 1 ×  LB agar containing ampicilin, Xgal andIPTG (Sambrook  et al . 1989). Positive clones were selectedby hybridization with a poly AG/TC probe and sequencedon an ABI 377 Applied Biosystem (Perkin Elmer, CA) auto-matic sequencer. Primers to the flanking regions weredesigned using the  primer  3 Output software (Rozen &Skaletsky 2000). Microsatellite loci were amplified usingpolymerase chain reaction (PCR) in 13  µ L containing: DNA(3  η g), PCR reaction buffer (1 × ), forward primer (0.28  µ m ),and reverse primer (0.28  µ m ), MgCl 2  (1.5 m m ), BSA (0.25 mg/mL), dNTP (0.25 m m ) and  Taq  polymerase (1.3 U). PCRconditions were: denaturation at 94  ° C for 5 min; 30 cyclesof denaturation at 94  ° C for 1 min, annealing at  T a  (Table 1)for 1 min, and extension at 72  ° C for 1 min, and a final exten-sion at 72  ° C for 7 min. Reaction products were separatedon polyacrylamide gel and visualized by silver staining.Polymorphism was evaluated using a total of 12 adult treesfrom a natural population from the National Forest, Tapajós,Pará, Brazil. Alleles were sized relative to a 10 bp ladder.Number of alleles per locus, mean observed and expectedheterosygosities were calculated using  genetic dataanalysis  version 1.0 (GDA) (Lewis & Zaykin 2001). Prob-abilities of paternity exclusion (Slate  et al . 2000) were estimatedusing  cervus  (Marshal, 1998–2001) (Table 1).Twenty nine clones contained both microsatelliteand appropriate flanking regions for primer design. Wesuccessfully amplified 23 primer pairs. Of those, nine weremonomorphic, and 14 were variable. Levels of variabilitydetected in 12 loci were high, with the number of allelesranging from four to eight, selected to be used for geneticanalysis. Ten of the 12 loci had observed heterozygosity Correspondence: Dra. A. Y. Ciampi. Present address: EmbrapaRecursos Genéticos e Biotecnologia, PqEB W5 Norte Final, BrasíliaDF, CEP 70770–900, CP 02372. E-mail: aciampi@cenargen.embrapa.br 14 P R I M E R  N O T E © 2005 Blackwell Publishing Ltd,  Molecular Ecology   Notes , 5, 13–15 greater than 50%. Two loci (Mh06 and Mh24) showed depart-ure from Hardy–Weinberg expectations ( P <  0.005), butno pairwise disequilibrium was detected between the12 loci. The deficits of heterozygous genotypes are consis-tent with the presence of null alleles in these two loci, at afrequency of 0.298 for Mh06 and 0.652 for Mh24. These twoloci with high null allele frequencies should be used onlywith great caution for paternity exclusion analysis becauseof the possibility of excluding the true father or nonexclud-ing a wrong father. The first estimate of paternity exclusionprobability Pr(Ex 1 ), when the offspring is sampled but themother is not, varied from 0.295 to 0.5 (mean = 0.408) forindividual loci and 0.9983 for the combined loci. The secondestimate, Pr(Ex 2 ), when both the mother and the offspring aresampled, varied for individual loci from 0.473 to 0.672 (mean =0.514) and was 0.99998 for the combined loci (Table 1).This study shows that these SSR loci allow very preciseindividual discrimination and paternity testing. The 12microsatellites developed exhibited a large number ofalleles per locus and high heterozygosity. This suggeststhat these loci will be useful for further population geneticstudies of natural populations. As part of the DendrogeneProject, we are currently using these markers to investigatequestions of genetic diversity, paternity, spatial genetic struc-ture, and mating system in a natural population of  M. huberi with the aim of applying scientific knowledge to promotesustainable management in the Brazilian Amazon forest. Acknowledgements The authors thank Valci Pereira da Silva and Tályta Nayza Almeidafor their technical assistance at the laboratory. José Campolina andhis group for their help in collecting samples at the FLONA Tapajós;Dr Milton Kanashiro and Ian Thompson, coordinators of theDendrogene Project (http://www.cpatu.embrapa.br/dendro);DFID, IBAMA and EMBRAPA for their support for the project. References Ferreira ME, Grattapaglia D (1998) Introdução ao uso de marca-dores moleculares em análise genética. 2nd ed Embrapa Cenar-gen, Brasília, DF. p. 220. Kanashiro M, Thompson IS, Yared JAG  et al.  (2001) Improving con-servation values of managed forests: the Dendrogene Project inthe Brazilian Amazon.  Unasylva  209.Lewis PO, Zaykin D (2001)  GENETIC   DATA   ANALYSIS : Computer: Programfor the Analysis of Allelic Data .  Version 1.0 (d16c).  http://lewis.eeb.uconn.edu/lewishome/software.html.Table 1 Information on the 12 microsatellite marker loci of Manilkara huberi. Allele size range (bp), annealing temperature (Ta °C), numberof individuals (N), total number of alleles per locus (A), expected heterozygosity (HE), observed heterozygosity (HO), paternity exclusionprobabilities (Pr(Ex1) and Pr(Ex2)) in 12 individualsLocusRepeatarray Primer sequence (5′–3′)Allele size range bp Ta °C A HE HO Pr(Ex1) Pr(Ex2) Accession no.Mh 03 (CT)17 F: CACTTCTGTCTCTCTCCTCGTR: GGGTGATTGCAGAGACGTA176–204 56 7 0.859 1.000 0.477 0.650 AY514005Mh 04 (CT)12 F: GCACTCTCCATGGTTCCAGTR: AAAGAGTCAATGGCGTGAGC189–209 52 5 0.768 0.583 0.319 0.492 AY514006Mh 06 (GA)14 F: ACACGCACAAAACAAACCAAR: TTCTTGAAGGAGGGTTGCTC162–188 56 7 0.754 0.417 0.325 0.502 AY514007Mh 07 (CT)23 F: ATTGCAGCATATCCACACCAR: GCAAAGGGTGATGGGTTAGA153–187 56 4 0.746 0.750 0.300 0.473 AY514008Mh 08 (CT)11 F: GTAATGGGAGCCGTTTGAGAR: CTGGGTAGCATTTGTTGCAT172–202 56 7 0.862 0.917 0.485 0.659 AY514009Mh 12 (CT)9(AC)6 F: TGCGGAACTGTGGAAAGAGTR: ATCCACAGCAATGACTGACG187–211 56 7 0.859 0.667 0.481 0.655 AY514010Mh 17 (CT)13 F: CACGATGACCTCTCAGTGGAR: CCTGTGTATGCGTTCGATTG240–274 56 6 0.721 0.750 0.295 0.480 AY514011Mh 19 (CT)21 F: AATTACAACCAAAGCTCCACTTR: TGAGAGTCTTTTCGCACTTTCA146–164 56 7 0.862 0.750 0.500 0.672 AY514012Mh 20 (GA)13 F: GAAGTTTTGACCATTTGGGAATR: GACATAACACTAACCCTTCACGA134–166 56 8 0.848 0.833 0.458 0.632 AY514013Mh 22 (CT)15 F: CCCATTATAGCCCTCCACCTR: AGAGAGCACATGCAAGCTCA180–206 56 7 0.841 0.833 0.449 0.627 AY514014Mh 24 (CT)17 F: CCACTTCTGTCTCTCTCCTCGTR: GACATTGTGGGTGATTGCAG181–209 60 7 0.815 0.167 0.404 0.582 AY514015Mh 26 (CT)14 F: TGCTCAGACTGCTTTCTTTTTGR: TGCAATAAGTGTGATTTGGAGAA224–250 58 6 0.819 0.583 0.400 0.579 AY514016Mean 6.43 0.813 0.688 0.408 0.514P R I M E R  N O T E 15© 2005 Blackwell Publishing Ltd, Molecular Ecology Notes, 5, 13–15Marshal T (1998–2001) cervus Version 2.0, University ofEdinburgh.Rafalski JA, Morgante M, Powell W, Vogel JM, Tingey SV (1996)Generating and using DNA markers in plants. In: Analysis of nonMammalian Genomes — a Practical Guide (eds Birren B, Lai E),pp. 75–134. Academic Press, New York.Rozen S, Skaletsky HJ (2000) PRIMER3 on the frodo.wi.mit.edu/cgi-bin/primer3/primer3_http://www.cgi for general usersand for biologist programmers. In: Bioinformatics Methods andProtocols: Methods in Molecular Biology (eds Krawetz S, MisenerS), pp. 365–386. Humana Press, Totowa, NJ.Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: Labor-atory Manual, 2nd edn. CSHL, Cold Spring Harbor, NY.Slate J, Marshall T, Pemberton J (2000) A retrospective assessmentof the accuracy of the paternity inference program cervus.Molecular Ecology, 9, 801–808.

Twelve microsatellite loci in Manilkara huberi (Ducke) Standl (Sapotaceae), an Amazonian timber species.

http://www.alice.cnptia.embrapa.br/bitstream/doc/188260/1/ID278061.pdf

Twelve microsatellite loci in Manilkara huberi (Ducke) Standl (Sapotaceae), an Amazonian timber species.

Abstract

Similar works

Full text

Available Versions

Repository Open Access to Scientific Information from Embrapa