Abstract Background Atopic dermatitis (AD) is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP), eosinophil-derived neurotoxin (EDN), eosinophil peroxidase (EPO) and major basic protein (MBP). Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the <it>ECP, EDN, EPO </it>and <it>MBP </it>genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.</p

D Simon

EH Bel

JM Hanifin

Jörg T Epplen

K Breuer

M Bradley

MC Munthe-Kaas

N Morar

N Pucci

Qumar Parwez

R De Marco

S Hoffjan

Sabine Hoffjan

Susanne Stemmler

T Goto

UB Jonsson

W Czech

WO Cookson

YJ Kim

English

PubMed

Springer - Publisher Connector

BioMed Central
Journal of Negative Results in 
BioMedicine
ssOpen AcceResearch
Variation in genes encoding eosinophil granule proteins in atopic 
dermatitis patients from Germany
Qumar Parwez1, Susanne Stemmler*2, Jörg T Epplen2 and Sabine Hoffjan2
Address: 1Private medical practice, Gladbeck, Germany and 2Department of Human Genetics, Ruhr-University, Bochum, Germany
Email: Qumar Parwez - qumar.parwez@t-online.de; Susanne Stemmler* - susanne.stemmler@rub.de; Jörg T Epplen - joerg.t.epplen@rub.de; 
Sabine Hoffjan - Sabine.Hoffjan@ruhr-uni-bochum.de
* Corresponding author 
Abstract
Background: Atopic dermatitis (AD) is believed to result from complex interactions between
genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum
and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins,
including eosinophil cationic protein (ECP), eosinophil-derived neurotoxin (EDN), eosinophil
peroxidase (EPO) and major basic protein (MBP). Recently, variation in genes encoding eosinophil
granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We
therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP
genes in a cohort of 361 German AD patients and 325 healthy controls.
Results: Genotype and allele frequencies did not differ between patients and controls for all
polymorphisms investigated in this study. Haplotype analysis did not reveal any additional
information.
Conclusion: We did not find evidence to support an influence of variation in genes encoding
eosinophil granule proteins for AD pathogenesis in this German cohort.
Background
Atopic dermatitis (AD) is a chronic inflammatory skin dis-
ease believed to arise from complex interactions between
genetic and environmental factors [1]. AD belongs to the
group of allergic disorders, also including allergic asthma,
allergic rhinitis and food allergy. As a main feature of
allergic disorders, AD is often accompanied by eosi-
nophilia [2]. Human eosinophils contain high amounts
of cationic granule proteins, including eosinophil cationic
protein (ECP), eosinophil-derived neurotoxin (EDN),
eosinophil peroxidase (EPO) and major basic protein
(MBP). Eosinophil degranulation with deposition of
these proteins in the skin has been shown to play an
important role in AD [2]. Furthermore, serum and urine
concentrations of eosinophil proteins are indirect meas-
ures of inflammatory activity in AD. For example, several
studies have confirmed that urine EDN (also called EPX)
is a useful in vitro parameter of inflammation in AD [3-5].
Measurement of ECP levels in serum also is a frequently
used tool in monitoring AD activity [4,6].
Recently, variation in genes encoding eosinophil granule
proteins has been suggested as potential factor in the
pathogenesis of allergic disorders. In particular, a non-
synonymous polymorphism in the ECP gene was associ-
ated with allergic symptoms [7], and a polymorphism in
the 3'UTR of this gene showed correlation with the cellu-
lar content of ECP [8]. More recently, ECP haplotypes
Published: 13 November 2008
Journal of Negative Results in BioMedicine 2008, 7:9 doi:10.1186/1477-5751-7-9
Received: 22 January 2008
Accepted: 13 November 2008
This article is available from: http://www.jnrbm.com/content/7/1/9
© 2008 Parwez et al; licensee BioMed Central Ltd. 
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), 
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Page 1 of 5
(page number not for citation purposes)
Journal of Negative Results in BioMedicine 2008, 7:9 http://www.jnrbm.com/content/7/1/9were found associated with asthma and serum ECP levels
[9]. Variation in the EDN gene was evaluated for an asso-
ciation with tropical pulmonary eosinophilia but did not
show an association with this disease in a small cohort
[10].
Since eosinophil degranulation seems to play an impor-
tant role in AD, we speculated that variation in genes
encoding eosinophil granule proteins might show an
association with AD. We therefore genotyped selected sin-
gle nucleotide polymorphisms (SNPs) within the ECP,
EDN, EPO and MBP genes in a cohort of 361 German AD
patients and 325 healthy controls.
Methods
Subjects
361 unrelated patients with AD, including 217 children
and 144 adults, were recruited by a consultant specialist
for AD (Q.P., Gladbeck, Germany). Mean age of the AD
patients was 18 ± 7 years. The AD diagnosis was based on
the criteria developed by Hanifin and Rajka [11]. 325 con-
trol samples from adults of at least 40 years of age without
known allergies, asthma or AD were collected in the same
private practice as the AD patients. Mean age of the con-
trols was 57 ± 13 years. We specifically chose to use non-
allergic adults as controls because the risk remains very
high for primarily asymptomatic children to develop an
allergic disease during childhood or even adulthood
[12,13]. The control subjects underwent clinical examina-
tion in order to exclude symptoms of AD, asthma or aller-
gic rhinitis. They further reported to have no allergic
symptoms and no first degree relatives with known aller-
gic diseases. All patients and control subjects were Ger-
mans of European origin. Informed consent was obtained
from all subjects. The study was approved by the Ethics
Committee of the University of Bochum, and the Declara-
tion of Helsinki protocols were followed.
Genotyping
Genotyping for all polymorphisms was performed by
polymerase chain reaction (PCR) with subsequent restric-
tion enzyme digestion. Details for PCR conditions and
restriction enzymes are summarized in table 1. PCR reac-
tions were performed in a total volume of 10 μl, contain-
ing 45 ng DNA, 2 mM of each dNTP, 1–3 mmol MgCl2, 5
pmol of the respective forward and reverse primer and 0.4
U Taq polymerase (Ares Bioscience, Lüdinghausen, Ger-
many) on a Biometra Thermal Cycler (Göttingen, Ger-
many). The PCR products were digested with the
respective enzyme (table 1, 0.01 U/ng DNA) at 37°C for
three hours. The fragments were subsequently separated
on 2.5–3.5% agarose gels in 1×TBE buffer (30 min, 200 V)
and visualized using ethidium bromide staining.
Table 1: Polymorphisms typed in the EDN, ECP, EPO and MBP genes.
Gene Rs number Location Amino acid Primer Annealing temperature Restriction enzyme
EDN rs2013109 Intron 1 - F: GGGTAAGTCAACGATCCCCAG
R: 
GGTCTTGGTTATGACACACACTGT
AGT
69°C HpyF10VI
EDN rs10132319 Intron 1 - F: GGGTAAGTCAACGATCCCCAG
R: 
GGTCTTGGTTATGACACACACTGT
AGT
65°C AciI
ECP rs17792481 Intron 1 - F: TGAGGGAGAGGTGAGCTGAAGT
R: TGATGTGCTGGATGGCAAAC
58°C MboI
ECP rs2073342 Exon 2 T124R F: TACGCTGCCCTCATAACAGAACT
R: GAACTGGAACCACAGGATACCG
58°C PstI
ECP rs2233860 3' UTR - F: 
GTATGCAGACAGACCAGGAAGGA
R: 
TTGGCAGATGAGTGATGATGAGTA
61°C RsaI
EPO rs11652709 Exon 4 Q122H F: CTACCCTGGCCTGGAGTAGAAG
R: CACGCACTTGTTGTTGCACC
64°C HpyF10VI
EPO rs3785496 Intron 6 - F: ACTGGTTGTCACTTCCCCTCTC
R: 
CAAAACCTTGCTTAAAACTCCCTT
58°C MseI
MBP rs490358 Exon 2 - F: 
GGAAAAAACAGAGAAAGAAAGACT
GAA
R: CACTCCCACGGTCCCCTAAT
58°C BslI
MBP rs3741098 Intron 3 - F: 
TGGTGGACAAAAACCTTACGTGTC
R: ATGCTGGGGGCATATCCGA
58°C BsaHIPage 2 of 5
(page number not for citation purposes)
Journal of Negative Results in BioMedicine 2008, 7:9 http://www.jnrbm.com/content/7/1/9Statistical analyses
Genotype and allele frequencies were ascertained by direct
counting and subsequently analyzed according to the χ2
method. Deviations from Hardy-Weinberg equilibrium
were evaluated using the DeFinetti program [14]. P < 0.05
was considered to be significant. Haplotype frequencies
were estimated using the Haploview software and com-
pared between cases and controls using a contingency χ2
test. We performed power analyses with the Genetic
Power Calculator program [15].
Results
We genotyped a total of nine SNPs in four genes encoding
eosinophil granule proteins (table 1). rs10132319 in
intron 1 of the EDN gene turned out to be monomorphic
in our cohort and thus was excluded from further analysis.
All other SNPs were in Hardy-Weinberg equilibrium in
cases and controls. None of the polymorphisms investi-
gated here showed an association with AD in our cohort
(table 2). Power analyses performed with the Genetic
Power Calculator program [15] revealed, that given a mul-
tiplicative model with a genotypic relative risk of 2 for het-
erozygotes and 4 for homozygotes and a D' of 0.9, we
have 89% power to detect a potential effect. Choosing
more conservative parameters with a genotypic relative
risk of 1.5/2.25 and D' of 0.8, would yield only 33%
power.
Haplotype analyses in the ECP gene revealed four differ-
ent haplotypes with a frequency above 1%: A-G-G, C-G-G,
C-C-C and C-C-G, as described before [9]. Haplotype fre-
quencies did not differ between AD patients and controls
(table 3).
Discussion
In the present study, we did not find evidence to support
an influence of variation in genes encoding eosinophil
granule proteins for AD pathogenesis in a thoroughly
characterized German cohort.
In the ECP gene, the three polymorphisms were evaluated
that had shown association to allergic phenotypes either
Table 2: Genotype frequencies of EDN, ECP, EPO and MBP polymorphisms in AD patients and controls.
Gene Polymorphism Genotypes AD patients controls p-value
EDN rs2013109 C/C 22 (6.1%) 23 (7.1%) 0.66
C/G 148 (41.0%) 123 (37.8%)
G/G 191 (52.9%) 179 (55.1%)
rs10132319 Not polymorphic - - -
ECP rs2073342 A/A 53 (14.7%) 57 (17.6%) 0.45
A/C 185 (51.2%) 152 (47.1%)
C/C 123 (34.1%) 114 (35.3%)
rs2073342 C/C 26 (7.2%) 32 (9.8%) 0.13
C/G 158 (43.9%) 120 (36.9%)
G/G 176 (48.9%) 173 (53.2%)
rs2233860 C/C 15 (4.1%) 19 (5.9%) 0.55
C/G 123 (34.1%) 104 (32.1%)
G/G 223 (61.8%) 201 (62.0%)
EPO rs11652709 C/C 34 (9.4%) 35 (10.8%) 0.42
C/G 170 (47.2%) 137 (42.3%)
G/G 156 (43.3%) 152 (46.9%)
rs3785496 G/G 23 (6.4%) 18 (5.6%) 0.89
G/A 142 (39.4%) 130 (40.1%)
A/A 195 (54.2%) 176 (54.3%)
MBP rs490358 A/A 29 (8.0%) 27 (8.3%) 0.98
A/G 137 (38.0%) 121 (37.2%)
G/G 195 (54.0%) 177 (54.5%)
rs3741089 T/T 99 (27.6%) 99 (30.7%) 0.66
T/C 184 (51.2%) 158 (49.1%)
C/C 76 (21.2%) 65 (20.2%)Page 3 of 5
(page number not for citation purposes)
Journal of Negative Results in BioMedicine 2008, 7:9 http://www.jnrbm.com/content/7/1/9in single SNP [7] or haplotype analysis [9] in previous
studies. Genotype as well as haplotype frequencies in our
cohort were very similar to the frequencies reported in
these other studies, but did not differ between AD patients
and controls. Thus, our results seem to contradict these
earlier reports. Yet, none of the preceding studies specifi-
cally addressed the phenotype AD, but rather allergic
symptoms in general [7] or allergic asthma [9]. Linkage
studies have shown that there is surprisingly little overlap
between the main susceptibility regions for asthma and
AD, even though both diseases belong to the group of
allergic disorders [16]. Thus, it is possible that ECP varia-
tion might influence the development of (allergic) asthma
but have no measurable influence on AD development.
Furthermore, the association of the ECP T124R SNP with
allergic symptoms was demonstrated in a very small
cohort (209 medical students and 76 asthmatic patients)
[7], and it still remains to be investigated whether this
association will hold true in a larger cohort of allergic
patients. Clearly, additional studies in sufficiently large
cohorts of patients with allergy, asthma and AD are
needed to further elucidate the role of variation in this
gene for the various allergic diseases.
For the other three genes evaluated in this study, no asso-
ciation studies for AD or asthma have been published so
far. Only the EDN gene (together with ECP) was evaluated
for an association with tropical pulmonary eosinophilia
but did not show an association with this disease in a
small cohort [10]. We nevertheless speculated that they
might constitute interesting candidate genes for AD since
eosinophil degranulation with deposition of all of these
proteins in the skin has been shown to play an important
role in AD [2]. Furthermore, several studies have con-
firmed that urine EDN is a useful in vitro parameter of
inflammation in AD [3-5]. Interestingly, the EPO gene is
located on chromosome 17q23, close to the regions of
highest linkage to AD or AD severity in two genome-wide
screens [17,18]. Yet, none of the investigated polymor-
phisms in these genes showed differences in allele, geno-
type or haplotype distribution between AD patients and
controls in our cohorts, suggesting that they may probably
not play an important role in AD pathogenesis.
Conclusion
We did not find evidence to support an influence of vari-
ation in genes encoding eosinophil granule proteins for
AD pathogenesis in this German cohort. However, we
cannot exclude a contribution of variation in these genes
entirely. Additional association studies as well as func-
tional assessment of the investigated polymorphisms
might further elucidate their role in allergic diseases.
Abbreviations
AD: atopic dermatitis; ECP: eosinophil cationic protein;
EDN: eosinophil derived neurotoxin; EPO: eosinophil
peroxidase; MBP: major basic protein; PCR: polymerase
chain reaction
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
QP recruited the patients and control subjects, collected
clinical data, performed the experiments and drafted the
manuscript. SS and JTE participated in the design and
coordination of the study. SH was in charge of the design
and coordination of the study as well as the statistical
analyses and finalised the manuscript. All authors read
and approved the final manuscript.
Acknowledgements
We thank Daniela Falkenstein for technical assistance and the patients for 
participating in this study.
References
1. Morar N, Willis-Owen SA, Moffatt MF, Cookson WO: The genetics
of atopic dermatitis. J Allergy Clin Immunol 2006, 118:24-34.
2. Simon D, Braathen LR, Simon HU: Eosinophils and atopic derma-
titis. Allergy 2004, 59:561-570.
3. Breuer K, Kapp A, Werfel T: Urine eosinophil protein X (EPX)
is an in vitro parameter of inflammation in atopic dermatitis
of the adult age. Allergy 2001, 56:780-784.
4. Pucci N, Lombardi E, Novembre E, Farina S, Bernardini R, Rossi E,
Favilli T, Vierucci A: Urinary eosinophil protein X and serum
eosinophil cationic protein in infants and young children with
atopic dermatitis: correlation with disease activity. J Allergy
Clin Immunol 2000, 105:353-357.
5. Goto T, Morioka J, Inamura H, Yano M, Kodaira K, Igarashi Y, Abe S,
Kurosawa M: Urinary Eosinophil-derived Neurotoxin Concen-
trations in Patients with Atopic Dermatitis: A Useful Clinical
Marker for Disease Activity. Allergol Int 2007, 56:433-438.
6. Czech W, Krutmann J, Schopf E, Kapp A: Serum eosinophil cati-
onic protein (ECP) is a sensitive measure for disease activity
in atopic dermatitis. Br J Dermatol 1992, 126:351-355.
Table 3: Frequencies and p-values of ECP haplotypes in AD patients and controls.
Haplotype Frequency in AD patients (n = 361) Frequency in controls (n = 325) p-value
A-G-G 0.401 0.408 0.762
C-G-G 0.305 0.304 0.934
C-C-C 0.209 0.214 0.830
C-C-G 0.080 0.070 0.439Page 4 of 5
(page number not for citation purposes)
Journal of Negative Results in BioMedicine 2008, 7:9 http://www.jnrbm.com/content/7/1/9Publish with BioMed Central and every 
scientist can read your work free of charge
"BioMed Central will be the most significant development for 
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central 
yours — you keep the copyright
Submit your manuscript here:
http://www.biomedcentral.com/info/publishing_adv.asp
BioMedcentral
7. Jonsson UB, Bystrom J, Stalenheim G, Venge P: Polymorphism of
the eosinophil cationic protein-gene is related to the expres-
sion of allergic symptoms. Clin Exp Allergy 2002, 32:1092-1095.
8. Jonsson UB, Bystrom J, Stalenheim G, Venge P: A (G->C) transver-
sion in the 3' UTR of the human ECP (eosinophil cationic
protein) gene correlates to the cellular content of ECP. J Leu-
koc Biol 2006, 79:846-851.
9. Munthe-Kaas MC, Gerritsen J, Carlsen KH, Undlien D, Egeland T,
Skinningsrud B, Torres T, Carlsen KL: Eosinophil cationic protein
(ECP) polymorphisms and association with asthma, s-ECP
levels and related phenotypes. Allergy 2007, 62:429-436.
10. Kim YJ, Kumaraswami V, Choi E, Mu J, Follmann DA, Zimmerman P,
Nutman TB: Genetic polymorphisms of eosinophil-derived
neurotoxin and eosinophil cationic protein in tropical pul-
monary eosinophilia. Am J Trop Med Hyg 2005, 73:125-130.
11. Hanifin JM, Rajka G: Diagnostic features of atopic dermatitis.
Acta Derm Venereol 1980, 92:44-7.
12. Bel EH: Clinical phenotypes of asthma. Curr Opin Pulm Med 2004,
10:44-50.
13. De Marco R, Locatelli F, Cerveri I, Bugiani M, Marinoni A, Giammanco
G: Incidence and remission of asthma: a retrospective study
on the natural history of asthma in Italy. J Allergy Clin Immunol
2002, 110:228-235.
14. DeFinetti program [http://ihg.gsf.de/cgi-bin/hw/hwa1.pl]
15. Genetic Power Calculator [http://pngu.mgh.harvard.edu/~pur
cell/gpc/cc2.html]
16. Hoffjan S, Epplen JT: The genetics of atopic dermatitis: recent
findings and future options. J Mol Med 2005, 83:682-692.
17. Cookson WO, Ubhi B, Lawrence R, Abecasis GR, Walley AJ, Cox HE,
Coleman R, Leaves NI, Trembath RC, Moffatt MF, et al.: Genetic
linkage of childhood atopic dermatitis to psoriasis suscepti-
bility loci. Nat Genet 2001, 27:372-373.
18. Bradley M, Soderhall C, Luthman H, Wahlgren CF, Kockum I, Nor-
denskjold M: Susceptibility loci for atopic dermatitis on chro-
mosomes 3, 13, 15, 17 and 18 in a Swedish population. Hum
Mol Genet 2002, 11:1539-1548.Page 5 of 5
(page number not for citation purposes)

Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

Qumar QumarParwez

Parwez, Qumar

Springer

Para>R: GAACTGGAACCACAGGATACCG</SimplePara></entry><entry align="center" col patients from Germany

Crossref

A: Serum eosinophil cationic protein (ECP) is a sensitive measure for disease activity in atopic dermatitis.

HU: Eosinophils and atopic dermatitis. Allergy

Urinary Eosinophil-derived Neurotoxin Concentrations in Patients with Atopic Dermatitis: A Useful Clinical Marker for Disease Activity. Allergol Int

Vierucci A: Urinary eosinophil protein X and serum eosinophil cationic protein in infants and young children with atopic dermatitis: correlation with disease activity.

Werfel T: Urine eosinophil protein X (EPX) is an in vitro parameter of inflammation in atopic dermatitis of the adult age. Allergy

WO: The genetics of atopic dermatitis.

file:///data/core-remote/dit/data/Springer-OA/pdf/4a0/aHR0cDovL2xpbmsuc3ByaW5nZXIuY29tLzEwLjExODYvMTQ3Ny01NzUxLTctOS5wZGY=.pdf

Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

Abstract

Similar works

Full text

Available Versions

Springer - Publisher Connector

Springer

Crossref

Springer - Publisher Connector