A putative pyridoxal kinase from B. subtilis has been cloned, overexpressed, purified and crystallized and data have been collected to 2.8 Å resolution

Das, Sanjan K.

Newman, Joseph A.

Rice, David W.

Sedelnikova, Svetlana E.

English

PubMed

Pyridoxal kinases (PdxK) are able to catalyse the phosphorylation of three vitamin B6 precursors, pyridoxal, pyridoxine and pyridoxamine, to their 5'-phosphates and play an important role in the vitamin B6 salvage pathway. Recently, the thiD gene of Bacillus subtilis was found to encode an enzyme which has the activity expected of a pyridoxal kinase despite its previous assignment as an HMPP kinase owing to higher sequence similarity. As such, this enzyme would appear to represent a new class of `HMPP kinase-like' pyridoxal kinases. B. subtilis thiD has been cloned and the protein has been overexpressed in Escherichia coli, purified and subsequently crystallized in a binary complex with ADP and Mg2+. X-ray diffraction data have been collected from crystals to 2.8 Å resolution at 100 K. The crystals belong to a primitive tetragonal system, point group 422, and analysis of the systematic absences suggest that they belong to one of the enantiomorphic pair of space groups P41212 or P43212. Consideration of the space-group symmetry and unit-cell parameters (a = b = 102.9, c = 252.6 &#197;, &#945;=&#946;=&#947;= 90&#176;) suggest that the crystals contain between three and six molecules in the asymmetric unit. A full structure determination is under way to provide insights into aspects of the enzyme mechanism and substrate specificity

Newman, J. A.

Das, S. K.

Sedelnikova, S. E.

Rice, D. W.

Publications of the IAS Fellows

Cloning, purification and preliminary crystallographic analysis of a putative pyridoxal kinase from Bacillus 



subtilis

Pyridoxal kinases (PdxK) are able to catalyse the phosphorylation of three vitamin B6 precursors, pyridoxal, pyridoxine and pyridoxamine, to their 5'-­phosphates and play an important role in the vitamin B6 salvage pathway. Recently, the thiD gene of Bacillus subtilis was found to encode an enzyme which has the activity expected of a pyridoxal kinase despite its previous assignment as an HMPP kinase owing to higher sequence similarity. As such, this enzyme would appear to represent a new class of `HMPP kinase-like' pyridoxal kinases. B. subtilis thiD has been cloned and the protein has been overexpressed in Escherichia coli, purified and subsequently crystallized in a binary complex with ADP and Mg2+. X-ray diffraction data have been collected from crystals to 2.8 Å resolution at 100 K. The crystals belong to a primitive tetragonal system, point group 422, and analysis of the systematic absences suggest that they belong to one of the enantiomorphic pair of space groups P41212 or P43212. Consideration of the space-group symmetry and unit-cell parameters (a = b = 102.9, c = 252.6 Å, [alpha] = [beta] = [gamma] = 90°) suggest that the crystals contain between three and six molecules in the asymmetric unit. A full structure determination is under way to provide insights into aspects of the enzyme mechanism and substrate specificity

Newman, J.A.

Das, S.K.

Sedelnikova, S.E.

Rice, D.W.

White Rose Research Online

Cloning, purification and preliminary crystallographic analysis of a putative pyridoxal kinase from Bacillus subtilis

Joseph A. Newman

Sanjan K. Das

Svetlana E. Sedelnikova

David W. Rice

Crossref

crystallization communications
1006 doi:10.1107/S1744309106035779 Acta Cryst. (2006). F62, 1006–1009
Acta Crystallographica Section F
Structural Biology
and Crystallization
Communications
ISSN 1744-3091
Cloning, purification and preliminary
crystallographic analysis of a putative pyridoxal
kinase from Bacillus subtilis
Joseph A. Newman, Sanjan K.
Das, Svetlana E. Sedelnikova and
David W. Rice*
Krebs Institute for Biomolecular Research,
Department of Molecular Biology and
Biotechnology, The University of Sheffield,
Sheffield S10 2TN, England
Correspondence e-mail: d.rice@sheffield.ac.uk
Received 26 May 2006
Accepted 4 September 2006
Pyridoxal kinases (PdxK) are able to catalyse the phosphorylation of three
vitamin B6 precursors, pyridoxal, pyridoxine and pyridoxamine, to their
50-phosphates and play an important role in the vitamin B6 salvage pathway.
Recently, the thiD gene of Bacillus subtilis was found to encode an enzyme
which has the activity expected of a pyridoxal kinase despite its previous
assignment as an HMPP kinase owing to higher sequence similarity. As such,
this enzyme would appear to represent a new class of ‘HMPP kinase-like’
pyridoxal kinases. B. subtilis thiD has been cloned and the protein has been
overexpressed in Escherichia coli, purified and subsequently crystallized in a
binary complex with ADP and Mg2+. X-ray diffraction data have been collected
from crystals to 2.8 A˚ resolution at 100 K. The crystals belong to a primitive
tetragonal system, point group 422, and analysis of the systematic absences
suggest that they belong to one of the enantiomorphic pair of space groups
P41212 or P43212. Consideration of the space-group symmetry and unit-cell
parameters (a = b = 102.9, c = 252.6 A˚,  =  =  = 90) suggest that the crystals
contain between three and six molecules in the asymmetric unit. A full structure
determination is under way to provide insights into aspects of the enzyme
mechanism and substrate specificity.
1. Introduction
Pyridoxal kinase (PdxK) is an enzyme that functions in the salvage
pathway of pyridoxal 50-phosphate (PLP). PdxK catalyses the phos-
phorylation of pyridoxal, pyridoxine and pyridoxamine to their
corresponding 50-phosphates, which are precursors for the active
form of vitamin B6 (Fig. 1). PLP is required by both prokaryotes and
eukaryotes for the synthesis, conversion and catabolism of amino
acids and can be synthesized de novo by many bacteria as well as
salvaged from the growth medium. In Escherichia coli, two pyridoxal
kinase genes have been identified and named PdxY (Yang et al., 1998;
Safo et al., 2004) and PdxK (Yang et al., 1996). PdxY is a pyridoxal
kinase which like PdxK is involved in the PLP-salvage pathway, but is
not able to catalyse the phosphorylation of the additional substrates
pyridoxine and pyridoxamine. PdxK has also been shown to play a
role in the thiamine phosphate-salvage pathway and possesses
4-amino-5-hydroxymethyl-2-methylpyrimidine (HMP) kinase activity
(Begley et al., 1999; Mizote & Nakayama, 1989).
The thiD gene has been previously classified in studies from a
number of different species as encoding a 4-amino-5-hydroxymethyl-
2-methylpyrimidine phosphate kinase (HMPP kinase), which is an
enzyme that functions in the thiamine phosphate (vitamin B1) salvage
pathway and is essential for the survival and virulence of a number of
pathogens (Hava & Camilli, 2002; Akerley et al., 2002). HMPP
kinases are able to catalyse the phosphorylation of the hydroxy-
methyl group on HMP and also the subsequent phosphorylation of a
phosphomethyl group on HMPP, but do not have any known activity
for phosphorylating pyridoxal, pyridoxine or pyridoxamine. The
product of the Bacillus subtilis thiD gene comprises a 29 kDa protein
of 271 amino acids which is unable to catalyse the phosphorylation of
HMPP as suggested by its genome annotation, but instead possesses
the enzyme activity of a pyridoxal kinase (Park et al., 2004). This
confusion arose as a result of its higher sequence identities to HMPP
kinases than to pyridoxal kinases (35 and 25%, respectively, for the
# 2006 International Union of Crystallography
All rights reserved
E. coli enzymes). The B. subtilis thiD gene product will therefore be
referred to as PdxK for the remainder of this paper.
Analysis of the amino-acid sequence of PdxK has suggested that it
is a member of the ribokinase superfamily and this has been
confirmed by the determination of the structure of PdxKs from sheep
brain (Li et al., 2002, 2004), human (PDB code 2ajp) and E. coli (Safo
et al., 2006) and the PdxY gene product in E. coli (Safo et al., 2004).
However, comparing the sequences of these enzymes to that of
B. subtilis PdxK, the well aligned regions flanking the substrate-
binding site reveal that few of the key residues involved in substrate
recognition or catalysis are conserved (Fig. 2). Specifically, three
residues involved in forming interactions with the substrate (Ser12,
Thr47 and Tyr84 in the sheep brain enzyme) are completely
conserved in all PdxKs studied to date but are not present in
B. subtilis PdxK (Gly11, Pro46, Met82). Furthermore, the catalytic
machinery of these enzymes is also different, with the sheep, human
and E. coli enzymes having a catalytic Asp, whereas the B. subtilis
enzyme has a Cys at this position. Interestingly, at each of these
positions the sequence of B. subtilis PdxK is very similar to that found
in the family of HMPP kinases (for example, E. coli ThiD). This
suggests that B. subtilis PdxK may be a representative member of a
new class of ‘HMPP kinase-like’ pyridoxal kinases for which no
structural data currently exists. The closer sequence similarities found
between B. subtilis PdxK and other HMPP kinases may indicate that
pyridoxal kinase activity has evolved independently on multiple
occasions during evolution.
To date, there is no structural data on the mode of nucleotide
binding to any HMPP kinase and analysis of the apoenzyme struc-
tures [from Salmonella typhimurium (Cheng et al., 2002) and
Thermus thermophilus (PDB code 1ub0)] has revealed that two loops
which lie close to the nucleotide-binding site are disordered. The
structure of a nucleotide complex may shed light on the role of these
loops, which are thought to become ordered upon nucleotide binding
and play a role in nucleotide recognition.
crystallization communications
Acta Cryst. (2006). F62, 1006–1009 Newman et al.  Putative pyridoxal kinase 1007
Figure 1
The four kinase reactions catalysed by PdxK.
Figure 2
Multiple sequence alignment showing the sequence conservation in four different regions for PdxK from sheep, E. coli and B. subtilis and E. coli ThiD. Identical residues
across all sequences are shown in reverse type on a dark background. Strongly conserved residues are shown in bold. Residues that have been identified from previous
structural studies on sheep and E. coli PdxK to form interactions with the substrate are highlighted by grey boxes and can be seen to be different in B. subtilis PdxK, where
they are more similar to E. coli ThiD. The sequences were aligned using ClustalW (Thompson et al., 1994) and the figure was prepared using ESPript (Gouet et al., 1999).
As a contribution towards understanding the structure–function
relationship of the enzyme and the molecular basis of substrate
specificity, we have initiated the structure determination of B. subtilis
PdxK. In this paper, we describe the cloning, overexpression, puri-
fication, crystallization and preliminary X-ray analysis of this enzyme
in the presence of ADP and Mg2+.
2. Cloning, overexpression and purification of B. subtilis
PdxK
The B. subtilis thiD gene was PCR-amplified directly from the
genomic DNA of B. subtilis strain 168 with the primers TCG-
GCGGCATATGTCTATGCATAAAGCACT (forward) and ACA-
CAGALTCTTATGATTGTTGATTCAGGCG (reverse). The PCR
product (813 bp) was purified (Quiagen) and a parallel restriction
digest (310 K overnight) of the PCR product and plasmid vector
pTB361 was performed to produce linear fragments with sticky ends
suitable for ligation. The restriction products were ligated together
using a gene:plasmid DNA ratio of 2:1 at 287 K and subsequently
transformed into E. coli DH5 for verification by PCR screening and
restriction-enzyme digestion. For overexpression, the plasmid was
transformed into E. coli strain BL21 (DE3). A 250 ml flask containing
50 ml LB medium with 50 mg ml1 tetracycline was inoculated with a
single colony of the transformed strain and grown overnight at 310 K
on a shaking tray at 250 rev min1. 10 ml of this culture was used to
inoculate five 2 l flasks each containing 450 ml of LB medium
supplemented with tetracycline as above. Cultures were grown until
the absorbance at 600 nm reached 0.6, at which point overexpression
was induced by the addition of 0.1 mM IPTG. Cultures were
harvested after a further 5 h by centrifugation at 5000g for 20 min at
277 K and the pellets were frozen immediately. Analysis of the
soluble fraction by SDS–PAGE showed a large overexpression band
corresponding to the expected molecular weight of the enzyme
(30 kDa).
Cells containing overexpressed PdxK were thawed on ice,
suspended in 50 mM Tris–HCl pH 8.0 and disrupted by ultrasonica-
tion (3  20 s pulses). Cell debris was removed by centrifugation at
20 000g for 20 min. The supernatant fraction was applied onto a
column packed with DEAE-Sepharose Fast Flow (Amersham Bios-
ciences) and proteins were eluted with a linear gradient of NaCl from
0 to 1 M in 50 mM Tris–HCl pH 8.0. Fractions containing PdxK were
combined and 4.0 M NH4SO4 was added to give a final concentration
of 1.5 M. Precipitated proteins were removed by ultracentrifugation
at 20 000 g for 5 min. The supernatant fraction was then loaded onto a
column packed with Phenyl ToyoPearl 650S (Tosoh) and eluted with
a linear gradient of NH4SO4 from 1.5 to 0 M in 50 mM Tris–HCl pH
8.0 and 200 mM NaCl. Fractions containing PdxK were pooled and
concentrated using a VivaSpin 10 000 kDa molecular-weight cutoff
concentrator to a final volume of 0.5 ml and a protein concentration
of 13 mg ml1. The sample was then loaded onto a Hi-Load Superdex
200 column (Amersham Biosciences) equilibrated with 200 mM NaCl
in 50 mM Tris–HCl pH 8.0 and eluted with the same buffer. The
elution volume was compared to a standard curve and PdxK ran with
an approximate molecular weight of 40 kDa. Peak fractions
containing PdxK were collected and concentrated to 10–15 mg ml1
as above, exchanging to buffer containing 10 mM Tris–HCl pH 8.0
and 50 mM NaCl. The purity of the final preparation was estimated to
be over 90% by SDS–PAGE, with a yield of approximately 20 mg per
gram of cell paste.
3. Crystallization and preliminary X-ray analysis
An initial crystallization screen was attempted using the hanging-
drop vapour-diffusion method at 290 K and crystallization kits from
Hampton Research in the presence and absence of the nucleotides
ADP, ATP, AMP-PNP and ATPS with and without Mg2+. Initial rod-
like crystals of the free enzyme with approximate dimensions 5  5 
50 mm were observed to have grown in 30% PEG 4000, 0.2 M sodium
acetate trihydrate, 0.1 M Tris–HCl pH 8.0. Crystals of the PdxK–
ADP–Mg2+ complex were grown using 28% PEG 4000, 0.17 M
sodium acetate trihydrate, 0.1 M Tris–HCl pH 8.5 as the precipitant
with the addition of 10 mM ADP, 10 mM MgCl2. Crystals from the
latter condition were bipyramidal with approximate dimensions 60 
25  25 mm.
Single crystals of both the free enzyme and the PdxK–ADP–Mg2+
complex were loop-mounted and placed into a cryosolution
containing 27% PEG 4000, 0.17 M sodium acetate trihydrate, 0.08 M
Tris–HCl pH 8.0, 23% glycerol for approximately 2 min. Diffraction
images were collected at 100 K with 0.5 rotations using a Rigaku
MM007 rotating-anode generator with a MAR Research image-plate
detector. Preliminary analysis of the X-ray diffraction data using
MOSFLM (Leslie, 1992) indicated that the free-enzyme crystals
belong to a primitive trigonal system, point group 312 (either P3212
orP3112), with unit-cell parameters a = b = 50.4, c= 177.9 A˚, = = 90,
 = 120. However, the highly anisotropic nature of the diffraction
and the poor resolution limit (3.5 A˚) made these crystals unsuitable
for detailed structural analysis.
Crystals of the PdxK–ADP–Mg2+ complex diffracted to 2.8 A˚
(Fig. 3). Processing of the X-ray diffraction data using MOSFLM and
SCALA (Evans, 1997) from the CCP4 suite of programs (Colla-
borative Computational Project, Number 4, 1994) and analysis of the
merging statistics indicated that the crystals belong the a primitive
tetragonal space group, point group 422. Further analysis of the
pattern of systematic absences suggest that the crystals belong to one
of the enantiomorphic pair of space groups P41212 or P43212, with
crystallization communications
1008 Newman et al.  Putative pyridoxal kinase Acta Cryst. (2006). F62, 1006–1009
Figure 3
0.5 oscillation diffraction image of crystals of the PdxK–ADP–Mg2+ complex. The
edge of the plate is set at 3.0 A˚ resolution.
unit-cell parameters a = b = 102.9, c = 252.6 A˚,  =  =  = 90 (data-
collection statistics are shown in Table 1). Consideration of the unit-
cell volume and space-group symmetry suggests that the crystal
contains between three and six monomers in the asymmetric unit,
with a corresponding VM range of 1.8–3.8 A˚
3 Da1 (Matthews, 1977).
A full structure determination is under way in order to provide
insights into the catalytic activity, substrate specificity and evolution
of this enzyme.
This work was supported by the BBSRC. The Krebs Institute is a
designated BBSRC Biomolecular Sciences Centre and a member of
the North of England Structural Biology Centre.
References
Akerley, B. J., Rubin, E. J., Novick, V. L., Amaya, K., Judson, N. & Mekalanos,
J. J. (2002). Proc. Natl Acad. Sci. USA, 99, 966–971.
Begley, T. P., Downs, D. M., Ealick, S. E., McLafferty, F., Van Loon, D., Taylor,
S., Chiu, H., Kinsland, C., Reddick, J., Xi, J. & Campobasso, N. (1999). Arch.
Microbiol. 171, 293–300.
Cheng, G., Bennett, E. M., Begley, T. P. & Ealick, S. E. (2002). Structure, 10,
225–235.
Collaborative Computational Project, Number 4 (1994). Acta Cryst. D50,
760–763.
Evans, P. R. (1997). Jnt CCP4/ESF–EACBM Newsl. Protein Crystallogr. 33,
22–24.
Gouet, P., Courcelle, E., Stuart, D. I. & Metoz, F. (1999). Bioinformatics, 15,
305–308.
Hava, D. L. & Camilli, A. (2002). Mol. Microbiol. 45, 1389–1405.
Leslie, A. G. W. (1992). Jnt CCP4/ESF–EAMCBNewsl. Protein Crystallogr. 26.
Li, M. H., Kwok, F., Chang, W. R., Lau, C. K., Zhang, J. P., Lo, S. C., Jiang, T. &
Liang, D. C. (2002). J. Biol. Chem. 277, 46385–46390.
Li, M. H., Kwok, F., Chang, W. R., Liu, S. Q., Lo, S. C. L., Zhang, J. P., Jiang, T.
& Liang, D. C. (2004). J. Biol. Chem. 279, 17459–17465.
Matthews, B. W. (1977). The Proteins, 3rd ed., edited by H. Neurath & R. L.
Hill,Vol. 3, pp. 468–477. New York: Academic Press.
Mizote, T. & Nakayama, H. (1989). Biochim. Biophys. Acta, 991, 109–
113.
Park, J. H., Burns, K., Kinsland, C. & Begley, T. P. (2004). J. Bacteriol. 186,
1571–1573.
Safo, M. K., Musayev, F. N., di Salvo, M. L., Hunt, S., Claude, J. B. & Schirch, V.
(2006). J. Bacteriol. 188, 4542–4552.
Safo, M. K., Musayev, F. N., Hunt, S., di Salvo, M. L., Scarsdale, N. & Schirch,
V. (2004). J. Bacteriol. 186, 8074–8082.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). Nucleic Acids Res. 22,
4673-4680.
Yang, Y., Tsui, H. T., Man, T. K. & Winkler, M. E. (1998). J. Bacteriol. 180,
1814–1821.
Yang, Y., Zhao, G. & Winkler, M. E. (1996). FEMS Microbiol. Lett. 141, 89–
95.
crystallization communications
Acta Cryst. (2006). F62, 1006–1009 Newman et al.  Putative pyridoxal kinase 1009
Table 1
Data-processing statistics for B. subtilis PdxK–ADP–Mg2+ complex.
Values in parentheses are for data in the highest resolution shell.
Resolution 20–2.8 (2.95–2.8)
Independent reflections 33604 (4844)
Completeness 99.4 (99.9)
Multiplicity 3.7 (3.8)
I/(I) 9.3 (2.4)
Rmerge† 0.131 (0.475)
† Rmerge =
P jI  hIij=P I, where I is the integrated intensity of a given reflection.


Cloning, purification and preliminary crystallographic analysis of a putative pyridoxal kinase from
                    Bacillus subtilis

Pyridoxal kinases (PdxK) are able to catalyse the phosphorylation of three vitamin B6 precursors, pyridoxal, pyridoxine and pyridoxamine, to their 5'-phosphates and play an important role in the vitamin B6 salvage pathway. Recently, the thiD gene of Bacillus subtilis was found to encode an enzyme which has the activity expected of a pyridoxal kinase despite its previous assignment as an HMPP kinase owing to higher sequence similarity. As such, this enzyme would appear to represent a new class of `HMPP kinase-like' pyridoxal kinases. B. subtilis thiD has been cloned and the protein has been overexpressed in Escherichia coli, purified and subsequently crystallized in a binary complex with ADP and Mg2+. X-ray diffraction data have been collected from crystals to 2.8 Å resolution at 100 K. The crystals belong to a primitive tetragonal system, point group 422, and analysis of the systematic absences suggest that they belong to one of the enantiomorphic pair of space groups P41212 or P43212. Consideration of the space-group symmetry and unit-cell parameters (a = b = 102.9, c = 252.6 &#197;, &#945;=&#946;=&#947;= 90&#176;) suggest that the crystals contain between three and six molecules in the asymmetric unit. A full structure determination is under way to provide insights into aspects of the enzyme mechanism and substrate specificity

Indian Academy of Sciences

95. crystallization communications Acta Cryst.

The Proteins,

https://eprints.whiterose.ac.uk/108133/1/Cloning%2C%20purification%20and%20preliminary%20crystallographic%20analysis%20of%20a%20putative%20pyridoxal%20kinase%20from%20Bacillus%20subtilis.pdf

Cloning, purification and preliminary crystallographic analysis of a putative pyridoxal kinase from Bacillus subtilis

Abstract

Similar works

Full text

Available Versions

Publications of the IAS Fellows

White Rose Research Online

White Rose Research Online

Crossref

Indian Academy of Sciences