Poster presented at the International Young Researchers in Life Sciences Conference. Pasteur Institute, Paris, France, 26-28 May 2014

Aniceto, N.

Cruz, J. P.

Fernandes, A.

Morais, J. G.

Paixão, P.

Ribeiro, A. C.

Valadas, E.

English

Repositório Comum

Printing: This poster is 48” wide by 36” high. It’s designed to be printed on a large-format printer.  Customizing the Content: The placeholders in this poster are formatted for you. Type in the placeholders to add text, or click an icon to add a table, chart, SmartArt graphic, picture or multimedia file. To add or remove bullet points from text, click the Bullets button on the Home tab. If you need more placeholders for titles, content or body text, make a copy of what you need and drag it into place. PowerPoint’s Smart Guides will help you align it with everything else. Want to use your own pictures instead of ours? No problem! Just click a picture, press the Delete key, then click the icon to add your picture. Searching for the G516T Polymorphism on the CYP2B6 gene in HIV-1Patients  Fernandes A.1,3, Aniceto N.1,2, , Cruz JP.1,2, Paixão P.2, Valadas E.1, Morais JG.2, Ribeiro AC.3 1. Laboratório de Diagnóstico Molecular de Doenças Infecciosas, Faculdade de Medicina da Universidade de Lisboa.2. iMed.UL, Faculdade de Farmácia da Universidade de Lisboa 3. Centro de Investigação Interdisciplinar Egas Moniz (CiiEM),  Gene CYP2B6 The CYP2B6 G516T polymorphism has a major impact on the level of hepatic metabolism. Objectives Identify the G516Tpolymorphism located at exon 4 of the CYP2B6 gene in HIV-1 or HVC/HBV co-infected patients. Review The CYP2B6 gene has been mapped in the context of chromosome 19,  and encodes a member of the enzyme superfamily, cytochrome P450 monooxygenase (CYP450), which is located in the endoplasmic reticulum.  This protein catalyses several reactions involved in drug metabolism. Many genetic disorders have been reporte as having influence on management, metabolism, distribution and elimination of drugs used in HIV/AIDS therapy (1).  The G516T polymorphism in the CYP2B6 gene, present in exon 4, shows a major impact with clinical relevance on the level of hepatic metabolism, with consequently translates into changes in the respective plasmatic concentrations of drugs (2). This genetic variant results in the substitution of a guanine for a thymine at nucleotide 516 of the coding sequence wich leads to the amino acid substitution at position 172,  glutamine for histidine (Q172H) and whose  role in enzyme activity is still not clear.  This has been described as a "non-sense" polymorphism,  affecting  the metabolic activity by alteration of substrate binding or aberrant splicing, leading to a decreased amount of normal mRNA and thus reducing the levels of functional protein (3).   Materials and Methods 1ml blood of 27 patients infected with HIV1 or co-infected with HBV/C Sample PerfectPure DNA Blood Kit (5Prime) Extraction of Genomic DNA • Primer Forward 5´TGTTGTAGTGAGAGTTCTG3´ • Primer Reverse 3´GATAGGGACAGAGATGGCAG5´ PCR Amplification • BLAST (Basic Local Alignment Search Tool)  • BioEdit Sequencing Analyses Results The G516T genetic variant can occur in heterozygosity (GT) or homozygosity (TT). Subjects with homozygous T allele (TT) exhibit enzymatic activity at lower levels when compared to individuals homozygous for the G allele (GG). Individuals heterozygous (GT) have intermediate levels (4). Our results allow us to identify the presence of polymorphic mutation CYP2B6 G516T in 25 patients, 8 of them carry the heterozygous genotype GT and 17 carry homozygous genotype TT.  In the future, therapeutics for HIV can be set in compliance with the patient's genetic information, leading to reduced toxicity levels and improved patient compliance to treatment.  Conclusion References 1. Presence of the CYP2B6 516 G>T polymorphism, increased plasma Efavirenz concentrations and eraly neuropsychiatric side effects in South African HIV – infected patients. Gounden et al, 2010. Aids Research and Therapy 2. Aberrante Splicing Caused by Single Nucleotide Polymorphism c.516G_T [Q172H], a Marker of CYP2B6*6, Is Responsible for Decreased Expression and Activity of CYP2B6 in Liver. Hofmann et al, 2008. The Journal of Pharmacology and Experimental Therapeutics 3. Pharmacogenetics of cytochrome P450 2B6 (CYP2B6): advances on polymorphisms, mechanisms, and clinical relevance. Zanger and Klein, 2013. Frontiers in Genetics. 2013; 4: 24 4. The G516T CYP2B6 Germline Polymorphism Affects the Risk of Acute Myeloid Leukemia and is Associated with Specific Chromosomal Abnormalities. Daraki et al,2014. PLOS ONE Patients CYP2B6 Polymorphism G516T 2 G – G  8 G – T 17 T – T  Fig. 1 - Gene CYP2B6 represented by exons and introns, the red triangle indicates the location of the SNP G516T, the substitution leads to Glu172His. The results of sequence alignment reveal the site of nucleotide substitution.  Fig. 2  - 3D structure of native CYP2B6 protein, the  SNP G516T is illustrated in green. Image acquired by VMD.   25 patients present the G516T polymorphism on the CYP2B6 gene.  

Searching for the G516T Polymorphism on the CYP2B6 gene in HIV-1Patients

https://comum.rcaap.pt/bitstream/10400.26/8782/1/Poster02_ProfACR_2015.pdf

Searching for the G516T Polymorphism on the CYP2B6 gene in HIV-1Patients

Abstract

Similar works

Full text

Available Versions

Repositório Comum