FACULTAD DE CIENCIAS Departamento de Biología Molecular p38α MAPK in inflammation‐associated colorectal cancer Doctoral Thesis Jalaj Gupta Madrid, 2013 FACULTAD DE CIENCIAS Departamento de Biología Molecular p38α MAPK in inflammation‐associated colorectal cancer Doctoral thesis submitted to the Autonomous University of Madrid for the degree of Doctor of Philosophy by Jalaj Gupta Thesis Director: Dr. Ángel Rodríguez Nebreda Centro Nacional de Investigaciones Oncológicas (CNIO), Madrid Institut de Recerca Biomèdica (IRB Barcelona), Barcelona This thesis work was carried out at the Spanish National Cancer Research Centre (CNIO) in Madrid and at the Institute for Research in Biomedicine (IRB) in Barcelona under the supervision of Dr. Ángel Rodríguez Nebreda. 1 Index INDEX 3ABBREVIATIONS 7 ABSTRACT 13 INTRODUCTION 17 The mitogen‐activated protein kinase (MAPK) family 19 p38 MAPKs 21 Upstream activators of p38 MAPKs 22 Downstream targets of p38 MAPKs 24 Cancer 27 p38 MAPKs in cancer 28 Tumor suppressing roles of p38 signaling 30 Tumor promoting roles of p38 signaling 32 Colorectal Cancer 35 Hereditary colorectal cancer 36 Sporadic colorectal cancer 37 Inflammation‐associated colorectal cancer 38 Mouse model of colitis and colitis‐associated cancer 42 Azoxymethane 43 Dextran sodium sulfate model of colitis 44 Azoxymethane/ Dextran sodium sulfate model 44 p38 in inflammatory bowel disease and colorectal cancer 45 AIM OF THE WORK 47 MATERIALS & METHODS 51 Buffers and solutions 53 Commercial Reagents and Kits 55 Mice 57 Generation of conditional mice 57 Isolation of genomic DNA from mouse tail for genotyping 57 Dextran sulfate sodium (DSS)‐induced colitis 58 AOM/DSS‐induced colorectal cancer protocol 59 Sacrifice of mice 59 Analysis of intestinal permeability in mice 59 Transmission electron microscopy 60 Inhibition of p38 MAPK in mice 60 INDEX 4 Bromodeoxyuridine incorporation 60 TUNEL assay 61 Histological analysis for colon 61 Sample preparation 61 Hematoxylin & Eosin staining 61 Immunohistochemistry 62 Isolation of colon epithelial cells 63 Isolation of peritoneal macrophages 63 Preparation of protein extracts from isolated cells and tissue 64 Determination of protein concentration 64 Western blotting 64 IL‐6 in blood and colon tissue 66 Analysis of epithelial cells and leukocytes from colon 66 RNA extraction from isolated cells and tissues 67 cDNA synthesis 68 Quantitative real‐time PCR 68 Analysis of apoptosis in human cancer cell lines 70 Statistical methods 70 RESULTS 71 Downregulation of p38 in IECs 73 Downregulation of p38 in IECs increases CAC 74 Early AOM response is not affected in p38‐IEC mice 77 p38‐IEC mice are more susceptible to DSS‐induced colitis 78 Increased immune cell infiltration in p38‐IEC mice treated with DSS 80 Increased inflammatory mediators in p38‐IEC mice treated with DSS 82 Increased apoptosis in p38‐IEC mice treated with DSS 84 p38downregulation induces hyperproliferation of IECs treated with DSS 86 DSS‐treatment suffices to induce colon tumors in p38‐IEC mice 87 AOM and one cycle of DSS induce aberrant crypt foci and hyperplasia in p38‐IEC mice 89 p38 regulates intestinal homeostasis 90 Increased intestinal permeability in p38‐IEC mice 92 INDEX 5Inducible downregulation of p38 in IECs sensitizes to AOM/DSS induced colon tumorigenesis 93 Downregulation of p38 in tumor epithelial cells reduces tumor burden 95 Downregulation of p38 reduces proliferation and increases apoptosis in colon tumor cells 97 Systemic inhibition of p38 reduces colon tumor burden 100 Downregulation of p38 in myeloid cells 102 Downregulation of p38 in myeloid cells does not affect DSS‐induced colitis 103 Downregulation of p38 in myeloid cells does not affect CAC 106 DISCUSSION 109 1. p38 signaling in normal IECs suppresses CAC 111 2. p38 regulates colon epithelial cells homeostasis 115 3. p38signaling in transformed IECs supports colorectal tumorigenesis 117 4. Role of p38 in myeloid cells during DSS‐induced colitis and CAC 119 5. p38 as a potential therapeutic target for colon cancer? 120 CONCLUSIONS 123 BIBLIOGRAPHY 127 RESUMEN EN CASTELLANO 151 Resumen 153 Introducción 154 Resultados 156 Discusión 163 Conclusiones 168 7 Abbreviations ABBREVIATIONS 94‐OHT 4‐hydroxy tamoxifen a.u. Arbitrary units ACF Aberrant crypt foci AOM Azoxymethane APC Adenomatous polyposis coli APS Ammonium persulfate ASK1 Apoptosis signal‐regulating kinase 1 BrdU Bromodeoxyuridine BSA Bovine serum albumin CAC Colitis‐associated colorectal tumorigenesis CD Crohn’s disease cDNA Complementary DNA CIN Chromosomal instability COX‐2 Cyclooxygenase 2 CRC Colorectal cancer DAB 3,3‐di‐amino‐benzidine DAPI 4ʹ,6‐diamidino‐2‐phenylindole DMBA 7,12‐dimethylbenzanthracen DMEM Dulbeccoʹs Modified Eagle Medium dNTPs Deoxyribonucleotides triphosphate DSS Dextran sodium sulfate DTT DL‐dithiothreitol or Clelandʹs reagent EDTA Ethylenediamine tetraacetic acid EGTA Ethylene glycol tetraacetic acid EMT Epithelial‐mesenchymal transition ERKs Extracellular signal‐regulated kinases FACS Fluorescence‐activated cell sorting FAP Familial adenomatous polyposis FBS Fetal bovine serum ABBREVIATIONS 10 FITC Fluorescein isothiocyanate GAPDH Glyceraldehyde 3‐phosphate dehydrogenase H&E Hematoxylin & Eosin HIF‐1 Hypoxia‐inducible factor 1HNPCC Hereditary nonpolyposis colorectal cancer HRP Horseradish peroxidase IBD Inflammatory bowel disease IEC Intestinal epithelial cells IHC Immunohistochemistry iNOS Inducible nitric oxide synthase JNK Jun N‐terminal kinase KO Knockout LPS Lipopolysaccharide MAP2K Mitogen‐activated protein kinase kinase MAP3K Mitogen‐activated protein kinase kinase kinase MAPK Mitogen‐activated protein kinase MK‐2 Mitogen‐activated protein kinase‐activated protein kinase ‐2 MMP Metalloproteinase mRNA Messenger RNA MSI Microsatellite instability NFkB Nuclear factor kappa‐light‐chain‐enhancer of activated B cells PAS Periodic acid‐Schiff PBS Phosphate buffer solution PCR Polymerase chain reaction PMSF Phenylmethanesulfonyl fluoride PRAK p38‐regulated/activated protein kinase qRT‐PCR Quantitative real time PCR ROS Reactive oxygen species SDS Sodium dodecyl sulfate ABBREVIATIONS 11SPF Specific pathogen free STAT Signal transducer and activator of transcription TEMED N,N,N´,N´‐tetramethylethylenediamine TGF  Transforming growth factor  TNF‐ Tumor necrosis factor‐TPA Tetradecanoyl phorbol 12‐acetate TUNEL Terminal deoxynucleotidyl transferase dUTP nick‐end labeling UC Ulcerative colitis VEGF Vascular endothelial growth factor WT Wild type 13 Abstract ABSTRACT 15p38 is a mitogen‐activated protein kinase (MAPK) that is very important for the cellular responses to stress, but also has crucial roles in inflammation and tissue homeostasis. Genetic inactivation of p38 in myeloid cells has provided evidence for the importance of this signaling pathway in cytokine production and inflammatory responses in vivo. Recent studies have shown that p38 can suppress initiation of lung and liver tumors in vivo. However, there is little evidence for p38 inactivating mutations in tumors, suggesting that cancer cells might use this signaling pathway to control multiple cellular processes. In line with this idea, the use of chemical inhibitors has provided evidence that p38 might positively regulate proliferation in some human cancer cell lines. Given the role of p38 in orchestrating inflammatory responses while negatively regulating epithelial cell transformation, we have investigated how these two functions are balanced during colitis‐associated colorectal tumorigenesis (CAC). We found that downregulation of p38 in intestinal epithelial cells (IECs) increases colitis‐associated tumorigenesis in mice without affecting tumor size, suggesting that epithelial p38 signaling suppresses tumor initiation. Accordingly, downregulation of p38 in IEC results in enhanced colitis‐associated epithelial damage and inflammation, which may be accounted for by increased paracellular permeability and altered colonic homeostasis observed in p38 deficient IEC. However, we found no differences in colitis‐associated epithelial damage, inflammation or tumorigenesis when p38 was specifically downregulated in myeloid cells. Interestingly, p38 downregulation in the tumor epithelial cells impairs proliferation and enhances apoptosis reducing tumor burden. Our results indicate that p38 signaling plays a dual role in IECs during tumorigenesis, suppressing the initial stages that lead to cell transformation but contributing to colorectal tumor maintenance. Moreover, pharmacological inhibition of p38reduced colon tumor burden suggesting that inhibitors of this pathway might be therapeutically useful for colon cancer. 17 Introduction INTRODUCTION 19The mitogen‐activated protein kinase (MAPK) family The cellular responses to different stimuli involve the activation of signaling pathways that integrate the external signals and coordinate the activation of specific intracellular programs. In response to extracellular stimuli, the mitogen‐activated protein kinase (MAPK) family regulates many cellular processes such as proliferation, differentiation and survival, as well as specialized cellular functions that depend on the cell type (Roux and Blenis, 2004). MAPKs are proline‐directed Ser/Thr protein kinases that play key role in signal transduction in eukaryotic cells. Activation of MAPKs can be induced by an ample variety of different stimuli such as hormones, growth factors, cytokines and environmental stresses (Kyriakis and Avruch, 2001). In mammals, at least eight different MAPKs have been identified (Bogoyevitch and Court, 2004). These MAPKs include the extracellular signal‐regulated kinases (ERKs): ERK1 and ERK2; the Jun‐N‐terminal kinases (JNKs): JNK1, JNK2 and JNK3; the p38 MAPKs: p38, p38, p38, p38; as well as ERK3, ERK4, ERK5, ERK7 and ERK8 (Sebolt‐Leopold and Herrera, 2004; Wagner and Nebreda, 2009). These MAPKs can be classified into conventional (ERKs, JNKs, p38 MAPKs and ERK5) or atypical (ERK3, ERK4, ERK5, ERK7 and ERK8) based on their ability to get phosphorylated and activated by MAP kinase kinases (MAPKKs) (Figure 1) (Coulombe and Meloche, 2007). Conventional MAPKs are catalytically inactive without any stimuli and in order to be fully active, require dual Thr and Tyr phosphorylation in their activation loop (Thr‐Xaa‐Tyr motif). Dual phosphorylation and activation of conventional MAPKs is achieved via a set of evolutionarily conserved signaling cascade involving a MAPKK (or MAP2K) that is responsible for phosphorylation of MAPK, and a MAPKK kinase (MAPKKK or MAP3K) that phosphorylates and activates MAP2K (Roux and Blenis, 2004). There are in total seven MAP2Ks in mammals, which have some specificity towards MAPKs (Figure 1). For example, MEK1 and MEK2 activate ERK 1 and ERK2, MEK5 activates ERK5, MKK4 and MKK7 activate JNKs, and MKK3, MKK6 and MKK4 can activate p38 MAPKs. Of note, there are about INTRODUCTION 20 twenty MAP3Ks in mammals, with each of them receives and integrates specific upstream signals (Cuevas et al., 2007; Huang et al., 2009). Interestingly, only six of the twenty MAP3Ks regulate the ERK1/2 pathway, twelve MAP3Ks regulate the JNK pathway and ten MAP3Ks regulate the p38 MAPK pathway. Regulation and activation of ERK5 by MAP3Ks is more restricted as only two MAP3Ks can activate ERK5 (Cuevas et al., 2007). The large number of MAP3Ks and their restricted activation pattern in response to specific stimuli probably determines which MAPKs will be activated and consequently what will be the cellular response to each particular stimulus (Ichijo, 1999; Stalheim and Johnson, 2008). Among conventional MAPKs, the ERK1/2 pathway is known to be preferentially activated by mitogens (Cobb et al., 1994), whereas JNK and p38 MAPKs are activated by stress and pro‐inflammatory cytokines (Figure 1) (Kyriakis and Avruch, 2012). Figure 1. Schematic overview of MAPK pathways. MAPK family can be divided into two subfamilies, the conventional MAPKs (ERKs, JNKs, p38 MAPKs and ERK5) and the atypical MAPKs (ERK3, ERK4, ERK5, ERK7 and ERK8). See text for details. (taken from (Dhillon et al., 2007)) INTRODUCTION 21Once activated, MAPKs phosphorylate downstream targets including transcription factors, protein kinases and many other proteins (Kyriakis and Avruch, 2012; Ono and Han, 2000; Trempolec et al., 2013a). Since a given stimulus can activate different MAPKs as well as different isoforms within each MAPK pathway, it is possible that cross‐talk among different MAPKs contributes the final response. Noteworthy, much less is known about the activation and regulation of atypical MAPKs (Figure 1). No upstream MAP2Ks or MAP3Ks have been identified so far for atypical MAPKs (Bogoyevitch and Court, 2004) suggesting that these MAPKs might not be activated in the conventional and evolutionarily conserved fashion described above. p38 MAPKs p38 MAPKs are strongly activated in response to stress stimuli. The family consists of four members: p38, p38β, p38δ and p38γ, which are approximately 60% identical in their amino acid sequence. The four p38 MAPKs are encoded by different genes and also have different tissue expression patterns. p38 has been considered the dominant isoform within p38 MAPKs based on its significant level of expression in most cell types. p38 is also known as MAPK14 and is the homologue of Hog1 in Saccharomyces cerevisiae. Other family members seem to be expressed in a tissue‐specific manner; for example, p38β in brain, p38γ in skeletal muscle and p38δ in endocrine glands (Cuadrado and Nebreda, 2010). Of note, p38 knock‐out mice are embryonic lethal (Adams et al., 2000; Allen et al., 2000; Mudgett et al., 2000; Tamura et al., 2000) while deficiency of p38β, p38δ and p38γ does not affect normal development in mice (Beardmore et al., 2005; Sabio et al., 2005). Functional redundancy has been demonstrated in the case of p38 and p38, where specific deletion of both genes in the epiblast derivatives of both genes results in additional phenotypes compared with the single knockouts (del Barco Barrantes et al., 2011). INTRODUCTION 22 Upstream activators of p38 MAPKs Like other MAPKs, p38 family members are activated by dual phosphorylation catalyzed by MAP2Ks. In response to appropriate signals, threonine and tyrosine residues in the activation loop (Thr‐Gly‐Tyr) of p38 MAPKs can be phosphorylated by three different MAP2Ks (Figure 2). MKK6 is a potent activator of all four p38 MAPK family members, whereas MKK3 is unable to activate p38 (Cuadrado and Nebreda, 2010; Enslen et al., 1998; Zarubin and Han, 2005). It is noteworthy that MKK6 and MKK3 share 80% amino acid sequence homology (Stein et al., 1996) and both are highly selective for p38 MAPKs but do not activate JNKs and ERK1/2 (Cuenda and Rousseau, 2007). In addition to MKK3 and MKK6, MKK4 (an upstream activator of the JNKs) can also activate p38α (Brancho et al., 2003; Doza et al., 1995). The relative contribution of each MAP2K to p38 activation is stimulus and cell type dependent as MAP2Ks expression levels vary among cell types (Brancho et al., 2003; Otto et al., 2012). For example, MKK3 has been shown to be the main p38 activator in transforming growth factor b1 (TGF‐1) stimulated mesangial cells (Wang et al., 2002a) whereas MKK6 seems to play a major role in thymocytes (Tanaka et al., 2002) . In addition to the canonical activation of p38 by upstream kinases, MAP2K‐independent alternative mechanisms have been reported. For example, in some cases p38 seems to be activated by autophosphorylation after interaction with TAB1 (transforming growth factor‐β‐activated protein kinase 1 (TAK1)‐binding protein) (Ge et al., 2002). An additional alternative mechanism of p38 activation in T‐lymphocytes involves phosphorylation of p38 on Tyr 323 by T cell receptor‐proximal tyrosine kinases ZAP70 and p56lck, which leads to p38 autophosphorylation in its activation loop (Salvador et al., 2005). INTRODUCTION 23 Figure 2. The p38 MAPK pathway. Different stimuli such as growth factors, inflammatory signals or environmental stresses result in the activation of MAPKKKs. MAPKKKs activate MAPKKs, which in turn activate downstream p38 MAPKs. Activated p38 MAPKs then phosphorylate several downstream targets including protein kinases and transcription factors. (taken from (Cuadrado and Nebreda, 2010)) MAP2Ks are in turn activated by phosphorylation by a MAP3Ks. In mammals, twenty MAP3Ks have been identified so far. About ten MAP3Ks have been shown to elicit p38 MAPK activation (Cuadrado and Nebreda, 2010; Stalheim and Johnson, 2008). MAP3Ks that can activate p38 MAPKs include TAK1 (TGF ‐activated kinase 1), ASK1 (apoptosis signal‐regulating kinase 1), DLK1 (dual‐leucine‐zipper‐bearing kinase 1), TAO (thousand‐and‐one amino acid) 1 and 2, TPL2 (tumor progression loci 2), MLK3 (mixed‐lineage kinase 3), MEKK (MAPK/ERK kinase kinase) 3 and 4, and ZAK1 (leucine zipper and sterile‐a motif kinase 1) (Figure2). Interestingly, some MAP3Ks have been shown to be preferentially activated by specific stimuli, thus integrating particular signals with INTRODUCTION 24 specific MAPK pathways. For example, TAK1 has been shown to be preferentially activated by pro‐inflammatory cytokines (Stalheim and Johnson, 2008), whereas ASK1 plays a role in the activation of p38 by oxidative stress (Dolado et al., 2007). Some of the MAP3Ks that activate p38 MAPKs can also activate other MAPKs. The diversity of MAP3Ks and their ability to integrate many different stimuli to p38 MAPKs and other signaling pathways provides great versatility to this signaling pathway (Cuevas et al., 2007; Kyriakis and Avruch, 2012). Downstream targets of p38 MAPKs Once activated, p38 MAPKs can regulate and phosphorylate many substrates ranging from protein kinases to transcription factors. Many p38 MAPK substrates have been identified based on the use of pyridinyl imidazole inhibitors, such as SB203580 and SB202190, which specifically inhibit p38 and p38 at low concentrations (Eyers et al., 1998; Goedert et al., 1997). Moreover substrate specificity has been sometimes confirmed using cells derived from mice with targeted deletion of each p38 MAPKs (Beardmore et al., 2005; Heinrichsdorff et al., 2008; Sabio et al., 2005). Protein kinases Several protein kinases have been identified to be phosphorylated by p38 MAPKs such as MAPK‐activated protein kinase 2 (MAPKAPK2 or MK2), MK3, MK5, MAPK‐integrating kinase (MNK) 1 and 2, mitogen and stress‐activated protein kinase (MSK) 1 and 2 (Cuadrado and Nebreda, 2010; Kyriakis and Avruch, 2012; Zarubin and Han, 2005). Once activated, these protein kinases can phosphorylate various proteins involved in transcriptional regulation (Perdiguero and Muñoz‐Cánoves, 2008; Roux and Blenis, 2004) (Figure 3). For example, MSK1 and MSK2 can directly phosphorylate and activate transcription factors such as ATF1, CREB, NFkB isoform p65 and STAT (signal transducer and activator of transcription) 1 and 3 (Arthur, 2008). MK2 and MK3 can control gene expression mainly at post‐transcriptional level by phosphorylating tristetraprolin (TTP) and HuR, which in INTRODUCTION 25turn regulate mRNA stability (Kotlyarov and Gaestel, 2008; Rodriguez‐Gabriel and Russell, 2008). Lastly, MNK1 and MNK2 can phosphorylate the initiation factor elF4E (eukaryotic initiation factor 4E) to regulate protein synthesis (Mahalingam and Cooper, 2001; Waskiewicz et al., 1999). Interestingly, among these protein kinases MK2/3 are preferentially activated by p38 MAPKs whereas MSKs and MNKs can be phosphorylated and activated by both p38 MAPKs and ERKs. Similarly, MK5 can be also activated by atypical MAPKs ERK3 and ERK4 (Kotlyarov and Gaestel, 2008). Figure 3. Downstream targets of p38 MAPKs. After activation by upstream kinases, p38 MAPKs phosphorylate Ser/Thr residues of their substrates, which include transcription‐associated proteins and protein kinases. In turn, protein kinases phosphorylate additional transcription‐associated proteins to regulate gene expression. (taken from (Perdiguero and Muñoz‐Cánoves, 2008)) INTRODUCTION 26 Transcription factors A major group of substrates that are phosphorylated by p38 MAPKs include transcription factors, such as ATF (activating transcription factor) 1, 2 and 6, p53, C/EBP, myocyte enhance factor MEF2A, MEF2C, NFAT, c‐FOS, CREB and SRF accessory protein (Sap1) (Perdiguero and Muñoz‐Cánoves, 2008). These transcriptional factors regulate gene expression in a variety of cell processes. For example, p53 induces expression of proteins involved in cell cycle arrest (i.e. p21Cip1, 14‐3‐3) and apoptosis (i.e. Apaf‐1, Noxa) (Bensaad and Vousden, 2005). MEF2 transcription factor regulate the expression of muscle‐specific genes which are required for muscle differentiation (Lluis et al., 2006), and NFkB induces expression of many pro‐inflammatory and pro‐survival proteins (Karin, 2006). Additionally, p38 MAPK signaling can sometimes repress gene transcription. For example, p38 can phosphorylate the transcriptional repressor HBP1 (HMG‐box protein), which in turn block the expression of various genes including cyclin D1 and c‐myc (Yee et al., 2004). As mentioned above, other transcriptional factors can be regulated indirectly through downstream kinases (Figure 3). In addition to direct or indirect regulation of transcription factors, p38 MAPKs can also regulate gene expression in a transcription factor‐independent manner. For example, phosphorylation and activation of TATA‐binding protein (TBP) by p38 MAPK at NFB and AP‐1 dependent promoters induces higher affinity TBP‐TATA box interaction, which in turn enhances the frequency of transcriptional initiation (Carter et al., 1999; Carter et al., 2001; Crump et al., 2008). In total, about 96 proteins including not only transcription factors and protein kinases but also DNA‐ and RNA‐binding proteins as well as membrane, mitochondrial and structural proteins have been described to be directly phosphorylated by p38 (Trempolec et al., 2013b). Given the number and type of substrates that can be regulated by p38, it is not surprising that the p38 MAPK pathway has a key role not only in the stress response but also in many other INTRODUCTION 27functions such as proliferation, apoptosis and differentiation. In normal conditions, MAPKs including p38 should be tightly regulated. Mis‐regulation of p38 signaling can lead to diseases such as cancer. Cancer Cancer is a complex disease that arises through a multistep, mutagenic process. During malignant transformation, normal cells acquire some key features such as unlimited proliferation, self‐sufficiency in growth signals, insensitivity to antigrowth signals and evasion of apoptosis (Figure 4). Furthermore, tumors evolve to gather support from surrounding stromal cells and to attract new blood vessels to bring nutrients and oxygen (Hanahan and Weinberg, 2000). Many of these features can be brought about by genetic alterations in key oncogenes (gain‐of‐function mutations, amplification, and/or overexpression) and tumor suppressors (loss‐of‐function mutations, deletion, and/or epigenetic silencing) (Hahn and Weinberg, 2002). Figure 4. Acquired features during transformation of normal cells to malignant transformation. (taken from (Hanahan and Weinberg, 2011)) INTRODUCTION 28 To acquire these features, cancer cells force rewiring and reactivation of existing cellular pathways that are tightly regulated in normal circumstances to control processes such as proliferation, survival and differentiation and to maintain tissue homeostasis (Luo et al., 2009). As mentioned above, p38 MAPK has many potential substrates and can regulate diverse cellular processes such as proliferation, survival, differentiation and inflammation. Accordingly, this signaling pathway has been shown to be important in many pathological conditions including cancer (Coulthard et al., 2009; Wagner and Nebreda, 2009). p38 MAPKs in cancer p38 MAPK was originally identified as a protein kinase involved in inflammatory and stress responses (Freshney et al., 1994; Lee et al., 1994; Rouse et al., 1994). Since then p38 has emerged as a key signaling pathway involved in many inflammatory diseases (asthma, rheumatoid arthritis, inflammatory bowel diseases and brain inflammation), cancer and others (Coulthard et al., 2009; Cuenda and Rousseau, 2007; Kumar et al., 2003; Yong et al., 2009). In recent years, extensive work has been done to expose the roles of p38 signaling in cancer. Although the majority of research on p38 suggests tumor suppressive functions of this pathway, there are also some reports suggesting potential pro‐oncogenic functions for p38. Some of the in vivo phenotypes of p38 MAPK signaling pathway related to inflammatory responses and cancer are summarized in Table 1, which illustrates a dual role of p38 signaling in cancer. INTRODUCTION 29Mouse line Phenotype Model Referencesp38α (F/F) × RERTn‐Cre Lung hyperplasia Lung cancer increased (Kras G12V)Ventura et al., 2007p38α (F/F) × Alb‐Cre; Mx‐CreErythroid proliferation defect Liver cancer increased (DEN & Pb)Hui et al., 2007p38α (F/F) × Alb‐Cre; Mx‐CreIncreased ROS & hepatocyte proliferationLiver cancer increased (DEN)Sakurai et al., 2008p38α (F/F) × LysM‐Cre Reduced cytokine production Sepsis (LPS) Kang et al., 2008p38α (F/F) × LysM‐Cre; K14‐CreReduced inflammatory responseSkin injuy (SDS & UVB) Kim et al., 2008p38α (F/F) × LysM‐Cre; TieERT2‐CreNo phenotype ApoE‐/‐ model of AtherosclerosisKardakaris et al., 2011p38α (F/F) × LysM‐Cre Enhanced macrophage apoptosis & plaque necrosisApoE‐/‐ model of AtherosclerosisSeimon et al., 2009MK‐2 ‐/‐ Reduced cytokine production Sepsis (LPS) Kotlyarov et al., 1999MK‐2 ‐/‐ Reduced cytokine production Collagen‐induced arthritis Hegen et al., 2006MK‐2 ‐/‐ Reduced severity to atherosclerosisLdlr‐/‐ model of AtherosclerosisJagavelu et al., 2007MK‐5 ‐/‐ (PRAK) Impaired ras‐induced scenescenceSkin cancer increased (DMBA)Sun et al., 2007MK‐5 ‐/‐ (PRAK) Impaired tumor growth & angiogenesisSkin cancer progression reduced (DMBA/TPA)Yoshizuka et al., 2012ASK1 ‐/‐ Enhanced inflammatory responseColorectal cancer increased (AOM/DSS)Hayakawa et al., 2010Dual function; ASK1 alone‐ tumor promoting roleASK1 in coopration with ASK2‐ tumor suppressive rolep38α DN (transgenic) Reduced edema & inflammationSkin cancer reduced (solar UV)Liu et al., 2013p38α DN (transgenic) Reduced COX‐2 expression Skin cancer reduced (UVB) Dickinson et al., 2011p38α (F/F) × LysM‐Cre Reduced colitisp38α (F/F) × Villin‐Cre Enhanced colitisSkin cancer (DMBA/TPA)Colitis model (DSS)ASK1 ‐/‐; ASK2 ‐/‐ Iriyama et al., 2009Otsuka et al., 2010 Table 1. In vivo roles of the p38 signaling pathway in mouse models of inflammatory diseases and cancer. Targeted cells/tissue by the Cre lines: RERTn‐Cre (variety of cells/tissues); Alb‐Cre (hepatocytes); Mx‐Cre (liver and lymphocytes); LysM‐Cre (myeloid cells); K14‐Cre (ectoderm and its derivatives); TieERT2‐Cre (endothelial cells); Villin‐Cre (Intestinal epithelial cells). MK‐2 and MK‐5 are downstream targets of p38; ASK‐1 and ASK‐2 are MAP3Ks that can activate both JNK and p38 MAPKs. INTRODUCTION 30 Tumor suppressing roles of p38 signaling Proliferation The first evidence in support of a tumor suppressive function for p38 was based on the observation that p38 signaling negatively regulates oncogenic Ras‐induced cell proliferation (Chen et al., 2000; Wang et al., 2002b). Accordingly p38 can negatively regulate cell cycle progression both at the G1/S and the G2/M phases of the cell cycle by several mechanisms (Bulavin and Fornace, 2004). For example, p38 has been shown to induce G1/S cell cycle arrest in response to stimuli such as osmotic stress, reactive oxygen species (ROS) and inducers of cellular senescence (Thornton and Rincon, 2009). p38can activate the G1/S checkpoint through the tumor suppressor p53 and subsequent transcriptional activation of the cell cycle inhibitor p21 (Kishi et al., 2001), by HuR dependent stabilization of p21 mRNA (Lafarga et al., 2009) or by negatively regulating the expression of cyclin D1 directly or through stabilization of cyclin D1 transcriptional repressor, HBP1 (Casanovas et al., 2000; Lavoie et al., 1996; Yee et al., 2004). Moreover, p38 can induce G1/S checkpoint by other mechanisms (Thornton and Rincon, 2009). Apart from the G1/S checkpoint, p38 has been also associated with the G2/M phase of cell cycle (Bulavin et al., 2002; Diehl et al., 2000; Garner et al., 2002; Mikhailov et al., 2005). The p38 substrate MK‐2 can mediate G2/M arrest by phosphorylation of Cdc25B and Cdc25C in response to UV irradiation (Manke et al., 2005). Independently of the stress response, p38 has been also shown to negatively regulate proliferation of various types of primary cells, including cardiomyocytes, hepatocytes, fibroblasts, haematopoietic cells and lung cells (Wagner and Nebreda, 2009). Apoptosis Another tumor suppressive function of p38 involves apoptosis induction. Activation of p38 has been shown to mediate apoptosis in various types of cells such as cardiomyocytes, thymocytes, keratinocytes and melanocytes (Chen et al., INTRODUCTION 312005; Kim et al., 2003; Purcell et al., 2001; Van Laethem et al., 2004) following different stimuli including chemotherapeutic drugs, UV irradiation, oxidative stress and serum starvation (Brozovic and Osmak, 2007; Bulavin et al., 1999; Dolado et al., 2007; Fassetta et al., 2006; Olson and Hallahan, 2004; Porras et al., 2004). p38 induces apoptosis by both transcriptional and post‐translational mechanisms, which affect death receptors, survival pathways or Bcl‐2 family proteins. The mechanisms through which p38 induces apoptosis seem to be stimulus and cell type dependent (Dolado and Nebreda, 2008). Differentiation In addition to the anti‐proliferative and apoptotic activities, p38 can also regulate differentiation of many cell types (Cuenda and Rousseau, 2007; Oeztuerk‐Winder and Ventura, 2012). In several cancer cell lines activation of p38 seems to elicit more differentiated and less transformed phenotypes (Finn et al., 2004; Puri et al., 2000). Mechanistically, p38 can directly phosphorylate several transcriptional factors involved in tissue specific differentiation (Cuenda and Rousseau, 2007; Wagner and Nebreda, 2009). In vivo studies in mice have also revealed the importance of p38 in myoblast differentiation (Perdiguero et al., 2007), intestinal epithelial cell differentiation (Otsuka et al., 2010) and in adult cardiomyocytes (Engel et al., 2005). The importance of the differentiation inducing activity of p38 in tumor suppression was illustrated in recent reports using mouse models. Thus, p38‐deficient mice are more susceptible to K‐ras induced lung tumorigenesis, and hepatocyte‐specific deletion of p38 promotes DEN/Pb‐induced liver cancer. In the case of K‐ras induced lung tumorigenesis, the tumor suppressor activity of p38 was attributed to deregulated proliferation and impaired differentiation of the lung stem and progenitor cells (Ventura et al., 2007) while in the case of hepatocellular cancer deficiency of p38 induces hyperproliferation of hepatocytes INTRODUCTION 32 and liver cancer cells (Hui et al., 2007). In line with these results, reduced expression of the p38 protein or reduced phosphorylation of p38 MAPK was found in human lung tumors and hepatocellular carcinoma compared with normal tissues (Iyoda et al., 2003; Ventura et al., 2007). Altogether, these observations strongly suggest that p38 functions as a tumor suppressor. Tumor promoting roles of p38 signaling Proliferation/ apoptosis In contrast to the tumor suppressor function of p38, several reports indicate pro‐survival roles of p38. As described above, p38 negatively regulates proliferation in some cell lines but there are also reports indicating that p38 can sometimes positively regulate proliferation in hematopoietic cells and in several human cancer cell lines (Comes et al., 2007; Halawani et al., 2004; Neve et al., 2002; Platanias, 2003; Recio and Merlino, 2002; Ricote et al., 2006; Wang et al., 2010). One of the early example came by the observation that proliferation of PC12 and Swiss 3T3 cells, induced by the growth factor FGF‐2, requires p38 MAPK activation as it is blocked by the chemical inhibitor SB203580 (Maher, 1999). p38 has also been implicated in establishing the G2/M checkpoint in response to various cytotoxic agents such as etoposide and doxorubicin. Inhibition of p38 after treatment with these cytotoxic agents increases apoptosis (Cappellini et al., 2005; Kurosu et al., 2005; Reinhardt et al., 2007). The survival effect of p38 MAPK in response to DNA damage could be explained by its role inducing cell cycle arrest and facilitating DNA repair prior to mitosis entry, helping tumor cells to escape mitotic catastrophe. In non‐small cell lung cancer cells, p38 mediates cell survival after ‐irradiation by increasing the expression and activity of DNA‐repair proteins (Cosaceanu et al., 2007). In some cases p38 plays a prosurvival role in G2 arrested cells through the coordinated downregulation of proapoptotic genes and upregulation of prosurvival genes (Phong et al., 2010). In the case of brain and INTRODUCTION 33thymocytes, it has been shown that p38 can phosphorylate and inactivate GSK3 and as a consequence ‐catenin is accumulated and provides survival signals (Thornton et al., 2008). However, implication of this mechanism in cancer has not been reported. Inflammation p38 was discovered as a kinase that regulates the inflammatory response. The importance of inflammation in cancer initiation and progression has been extensively reviewed (Balkwill and Mantovani, 2001; Hussain and Harris, 2007; Mantovani et al., 2008). p38 plays an important role in the production of inflammatory mediators and several pro‐inflammatory cytokines. For example, p38 regulates the induction of the pro‐inflammatory protein cyclooxygenase 2 (COX2) (Gauthier et al., 2005). COX‐2 is overexpressed in several malignancies (Subbaramaiah and Dannenberg, 2003) and has been correlated with bad prognosis and poor survival in breast and colon cancer (Hoellen et al., 2011; Wang and Dubois, 2010). Furthermore, p38 regulates the pro‐inflammatory cytokines TNF‐, IL‐1 and IL‐6 (Kumar et al., 2003; Wagner and Nebreda, 2009). p38 can also control cytokine expression by regulating NFkB (Saccani et al., 2002). Genetic inactivation of p38 in myeloid cells has also provided evidence of p38 importance in cytokine production and inflammatory responses in vivo, including models of LPS‐induced sepsis, SDS and UVB‐induced skin injury and DSS‐induced colitis (Kang et al., 2008; Kim et al., 2008a; Otsuka et al., 2010). Invasion and angiogenesis Invasion and angiogenesis are two processes that play important roles in tumor progression and metastasis. p38 regulates these two processes and thus can have a direct role in tumor progression (del Barco Barrantes and Nebreda, 2012). For example, p38 can enhance Twist1 protein stability by phosphorylation, which in turn induces epithelial‐mesenchymal transition (EMT) and invasiveness of INTRODUCTION 34 mammary epithelial cells (Hong et al., 2011). Furthermore, p38 can also regulate the expression of matrix metalloproteinases (MMPs) such as MMP‐1, MMP‐2, MMP‐9 and MMP‐13 in several human cancer cell lines (Hsieh et al., 2010; Johansson et al., 2000; Kumar et al., 2010; Park et al., 2011; Xu et al., 2006). MMPs play key role in extracellular matrix remodeling and degradation by metastatic cells (Coussens et al., 2002). Inhibition of p38 in cancer cell lines results in reduced cell invasion. Angiogenesis is also very important for tumor progression and metastasis. Vascular endothelial growth factor (VEGF), an inducer of tumor survival and angiogenesis (Carmeliet, 2005), has been shown to be regulated by p38 (Yoshino et al., 2006). Moreover, p38 can activate hypoxia‐inducible factor 1 (HIF‐1) through the stabilization of its ‐subunit (Emerling et al., 2005). HIF‐1 is a transcription factor that regulates the expression of angiogenic growth factors and cytokines such as VEGF and TGF. A recent report has also suggested an in vivo role of p38 signaling in tumor promotion (Yoshizuka et al., 2012). This study shows that p38‐regulated/activated protein kinase (PRAK) is activated in host endothelial cells and mediates tumor angiogenesis for sustained growth and malignant progression of the skin tumors induced by 7,12‐dimethylbenzanthracene (DMBA)/ tetradecanoyl phorbol 12‐acetate (TPA). Of note, PRAK deficiency enhances one stage skin carcinogenesis induced by DMBA by preventing senescence and thus promoting oncogenic transformation (Sun et al., 2007). Another recent paper has also described a pro‐tumorigenic role of p38 by using p38 dominant negative (p38‐DN)‐expressing transgenic mice in UVB‐induced skin carcinogenesis, expression of p38‐DN results in decreased epidermal proliferation, in part through inhibition of AP‐1 activity, and a reduction in COX‐2 protein levels (Dickinson et al., 2011). Additionally, increased phosphorylation of p38has been correlated with several human malignancies such as follicular lymphoma (Elenitoba‐Johnson et al., 2003), non‐small cell lung cancer (Greenberg et al., 2002), breast carcinomas (Esteva et al., INTRODUCTION 352004), gliomas (Demuth et al., 2007), head and neck squamous cell carcinomas (Junttila et al., 2007) and hepatocellular carcinomas (Wang et al., 2012). All this evidence suggests that p38 signaling might have a dual role in tumor initiation and progression. From the tumorigenesis experiments in mice, it seems that p38 has a tumor suppressive function during tumor initiation while its tumor promoting function could be mainly confined to tumor progression. Noteworthy, in tumor initiation and progression many signaling pathways including p38 MAPKs are involved, which may be regulated in a different way depending on the cell type, stimuli and stage of tumorigenesis. Thus, further work including the use of specific mouse models to modulate the p38 signaling pathway in a time and tissue specific manner should help to define better the roles of p38 in tumor initiation and progression. Colorectal Cancer More than 1 million new cases of colorectal cancer (CRC) are diagnosed worldwide each year (Tenesa and Dunlop, 2009). Colorectal cancer is the third most common form of cancer and the fourth common cause of death from cancer worldwide. The frequency of CRC shows a considerable geographical variation with highest incidences in developed countries, lowest in Africa and South‐Central Asia, and intermediate in Latin America (IARC 2008). Many agents contribute to CRC development including diet and lifestyle as well as inherited and somatic mutations. Among the dietary and lifestyle risk factors for CRC are a diet rich in unsaturated fats, a high intake of red meat and a low intake of vegetables, excessive alcohol consumption, cigarette smoking and overweight and lack of exercise (Chao et al., 2000; Huxley et al., 2009; Potter, 1999; Slattery, 2000). In CRC, carcinogenesis is a multistep process from the normal epithelium to dysplastic precursor lesions and to carcinoma (Figure 5), regardless of the underlying etiology (Fearon and Vogelstein, 1990; Ullman and Itzkowitz, 2011). INTRODUCTION 36 CRC can be divided into three main types according to the way that it has developed, which are hereditary, sporadic and inflammatory (Ishikawa and Herschman, 2010). Figure 5. Multistep genetic model of colorectal tumorigenesis (taken from (Pino and Chung, 2010)) Hereditary colorectal cancer This group can be further divided into two major subgroups; hereditary nonpolyposis colorectal cancer (HNPCC) and familial adenomatous polyposis (FAP), based on the presence of polyposis. Both HNPCC and FAP are characterized by an early age (approximately 45 years) of CRC appearance with predominance of right‐sided colorectal cancer (Lynch and de la Chapelle, 2003). Hereditary nonpolyposis colorectal cancer HNPCC is also known as Lynch syndrome and cancer family syndrome. Among all CRC cases, about 1‐6% are related to HNPCC (Lynch and de la Chapelle, 2003). HNPCC is an autosomal dominant condition caused by a germline mutation in DNA mismatch‐repair (MMR) genes which results in microsatellite instability (MSI). Furthermore, resulting MSI promotes mutations in other genes that contribute to colon tumorigenesis (Kwak and Chung, 2007). Mutations in beta‐catenin, TGFRII, Bax, APC, p53 and K‐ras genes have been also identified in HNPCC tumors, which might be due to MSI (Fearon, 2011; Lynch and de la Chapelle, 2003). INTRODUCTION 37Familial adenomatous polyposis FAP is a rare autosomal dominant disease with almost 100% penetrance and characterized by presence of hundreds to thousands of colorectal adenomas. FAP accounts for approximately 1% of all CRC (Kwak and Chung, 2007). FAP is caused by mutations in tumor suppressor gene adenomatous polyposis coli (APC) (Groden et al., 1991; Kinzler et al., 1991). However, inactivation of APC also occurs in sporadic colorectal cancer (see below). APC regulates the degradation of ‐catenin and inactivation of APC leads to accumulation of ‐catenin, which activates the transcription of growth‐promoting genes such as cyclin‐D1 and c‐myc (Chung, 2000). Sporadic colorectal cancer Colorectal tumors that are not associated with hereditary cancer syndromes are defined as sporadic colorectal cancer. The lifetime risk of developing sporadic colorectal cancer is approximately 5% (Jemal et al., 2002). The development of CRC typically follows several consecutive steps (Fearon and Vogelstein, 1990). Genomic destabilization is an early step in sporadic tumor development. Loss of APC function is among the earliest molecular events in colorectal cancer, leading to activation of Wnt/‐catenin signaling pathway and subsequent transcription of target genes (Chung, 2000; Morin et al., 1997). Furthermore, mutations in the K‐ras oncogene have been found in 15‐68% of sporadic colorectal adenomas and in 40‐50% of cancers (Takayama et al., 2006). Loss of p53 tumor suppressor function has been also identified in 40‐50% of sporadic colorectal cancers which believed to occur at the time of transition from adenoma to carcinoma (Itzkowitz and Yio, 2004). However, the somatic mutation spectrum in the colon cancer seems to be more extensive. Approximately 90 mutant genes were identified in a systematic sequencing analysis of colorectal cancers, of which 69 genes were considered related to the pathogenesis of CRC (Sjoblom et al., 2006). Moreover, epigenetic factors such as promoters of CpG island methylation also contribute to colon INTRODUCTION 38 cancer carcinogenesis by silencing promoters of tumor suppressors (Draht et al., 2012; Santini et al., 2001; Toyota et al., 1999). Inflammation‐associated colorectal cancer Inflammation and cancer The connection between inflammation and cancer is not new. In 1863, Rudolf Virchow noted that inflammatory cells are present in tumors and proposed that inflammation contribute to the development of cancer (Balkwill and Mantovani, 2001). It is estimated that about 15‐20% of all cancer related deaths are linked to infections and inflammation (Mantovani and Pierotti, 2008). Tumor development involves two main steps: initiation and promotion. In the initiation, somatic cells accumulate irreversible DNA sequence alterations (mutation of oncogenes, tumor suppressor genes and other key regulators of cell proliferation). The promotion step is associated with continuous or repeated stimuli which lead to induction of cellular proliferation and changes in the cellular microenvironment that promote tumor formation. It is now widely accepted that chronic inflammation plays an instrumental role in the promotion step of tumor development (Coussens and Werb, 2002; DiDonato et al., 2012). Recent epidemiological studies have identified inflammation and infections as major risk factors for many kinds of cancer, such as infection of hepatitis B and liver cancer (Table 2). Both exogenous (infections and toxic compounds) and endogenous (inherited diseases and obesity) inducers of inflammation can contribute to chronic inflammation induced cancer (Medzhitov, 2008). INTRODUCTION 39 Table 2.Chronic inflammation or infection increases cancer risk. (taken from (Schetter et al., 2010)) Increased risk is expressed by the odds ratio or relative risk. Inflammatory bowel disease and colorectal cancer Inflammatory bowel diseases (IBD) including crohn’s disease (CD) and ulcerative colitis (UC) are characterized by chronic, progressive and relapsing inflammatory INTRODUCTION 40 disorders mainly in the large bowel. Genetic, environmental and intestinal microbial factors seem to be important contributors in the etiology and pathogenesis of IBD (Schirbel and Fiocchi, 2010). Existing evidence indicate that IBD patients are associated with higher risk of development of colitis‐associated colon cancer (CAC) (Ekbom et al., 1990a; Ekbom et al., 1990b; Gillen et al., 1994). However, UC patients have higher risk for CAC than CD patients (Grivennikov and Karin, 2010; Schetter et al., 2010). The risk of developing CRC is directly related to the duration and extent of colitis. CRC is rarely detected in patients who have had colitis for less than 7 years but afterward the risk increases at a rate of 0.5%‐1% per year (Ullman and Itzkowitz, 2011). The extent of colitis (severity of inflammation) is the second important factor related to CAC risk; the more colonic surface that is affected by colitis, the greater the risk of CAC (Rutter et al., 2004). Compared to sporadic colorectal cancer, CAC has distinctive clinical features. Regardless of the underlying condition, most CRCs develop from a dysplastic precursor lesions (Fearon and Vogelstein, 1990; Ullman and Itzkowitz, 2011). In sporadic CRC, the dysplastic precursor is usually the adenomatous polyp (adenoma). In contrast, CAC typically arises from dysplastic precursor that can be nonpolypoid, flat, localized or multifocal dysplasia. Moreover, CAC affects individuals at a younger age (Xie and Itzkowitz, 2008). Microscopically, dysplasia in IBD are divided into five categories: negative for dysplasia, indefinite dysplasia (dysplasia not yet detectable), low‐grade dysplasia (LGD, nuclei confined to the basal half of the cells), high‐grade dysplasia (HGD, nuclei restricted more to apical side), and CAC (Riddell et al., 1983). Finally, the sequence of molecular events that lead from dysplasia to invasive adenocarcinoma is different in CAC from sporadic CRC (see below). INTRODUCTION 41From Inflammatory bowel disease to Colitis‐associated colon cancer CAC develops in chronically inflamed mucosa and are believed to develop in a sequence of no dysplasia‐indefinite dysplasia‐LGD‐HGD‐carcinoma. Tumor progression can skip one or more of these steps (Farraye et al., 2010). As in sporadic CRC, CAC also occurs through sequential events such as somatic mutation and their clonal expansion (Itzkowitz and Yio, 2004). Also similar is the frequency of occurrence of two main types of genomic instability that contribute to colon carcinogenesis. It is estimated that chromosomal instability (CIN) and microsatellite instability (MSI) account for 85% and 15% of colon carcinogenesis, respectively (Xie and Itzkowitz, 2008). However, the timing and frequency of molecular alterations is different in CAC when compared to sporadic CRC (Figure 6). For example, APC loss of function is considered to be a very common early event at a frequency of around 85% in sporadic CAC. However APC loss is rare and usually occurs late in the transition to CAC (Aust et al., 2002; Tarmin et al., 1995; Xie and Itzkowitz, 2008). Loss of p53 function is another important step which occurs late during adenoma to carcinoma transition in sporadic CRC, whereas in patients with colitis, p53 mutations and allelic loss are more frequent (50‐85%), occur early and can be detected in mucosa that is either non‐dysplastic or indefinite for dysplasia (Brentnall et al., 1994; Burmer et al., 1992; Yin et al., 1993). In fact, p53 mutations were detected in inflamed mucosa of more than 50% UC patients who did not have any tumors, suggesting that chronic inflammation might facilitate these mutations (Hussain et al., 2000). Similar to sporadic CRC, epigenetic alterations such as methylation of CpG islands have been detected throughout the mucosa of UC patients (Hartnett and Egan, 2012; Issa et al., 2001). INTRODUCTION 42 Figure 6. Comparison between colitis‐associated colon cancer (CAC) and sporadic colon cancer (CRC). During the sporadic and colitis‐associated colon cancer, there are many similarities including chromosomal instability, DNA methylation, activation of COX2 and oncogene k‐ras and mutation and eventual loss of hetrozygosity of p53 and APC. However, the frequency and sequence of these molecular events differ between the two types of colon cancer. (taken from (Ullman and Itzkowitz, 2011)) Mouse model of colitis and colitis‐associated cancer Experimental animal models are essential tools to understand pathogenesis and for preclinical testing of new therapeutic options. To study the hereditary CRC, APC mutant mice was developed and successfully used in many studies (Moser et al., 1990). To study sporadic CRC and CAC experimental models based on chemical carcinogens or pro‐inflammatory reagents have been developed. These models are reliable, reproducible and highly efficient in induction of colon tumors in mice (Neufert et al., 2007). INTRODUCTION 43Azoxymethane Azoxymethane (AOM) and its derivatives have been used successfully in experimental models of CRC. AOM is a chemical agent that can initiate colon cancer by alkylation of DNA (Neufert et al., 2007; Papanikolaou et al., 1998). AOM is a downstream metabolite of dimethylhydrezine (DMH), which was frequently used in the past. In recent years, AOM is widely used because of higher potency and stability in solution (Papanikolaou et al., 1998). Repeated intraperitoneal injections of AOM induces colon tumor within 30 weeks (Neufert et al., 2007). Tumors induced by AOM resemble human CRC in many ways. AOM‐induced tumors are frequently located in the distal part of the colon, start with polypoid growth similar to spontaneous CRC in human. They show similar histopathological features, but AOM‐induced tumors often lack mucosal invasiveness and metastasis (Boivin et al., 2003; Nambiar et al., 2003; Shamsuddin, 1984). At the molecular level, AOM‐induced tumors are also similar to human CRC. For example, AOM‐induced tumors show aberrant expression of APC as well as mutations and altered localization of ‐catenin (Maltzman et al., 1997; Takahashi et al., 2000b). Altered expression of cyclin D1 and cyclin‐dependent kinase 4 (CDK4) have been also reported (Wang et al., 1998). Moreover, AOM‐induced tumors also have mutations in K‐ras and elevated levels of COX‐2 and inducible nitric oxide synthase (iNOS‐2) similar to human CRC (Takahashi et al., 2000a). It has been reported that the genetic background is an important factor in AOM‐induced tumorigenesis. Strains of high to moderate susceptibility are A/J, SWR/J or FVB/N (Bissahoyo et al., 2005; Neufert et al., 2007; Papanikolaou et al., 2000). In addition to the genetic background, differences in the intestinal microflora between animal facilities as well as variability of AOM preparations might also affect susceptibility. As spontaneous colon tumorigenesis induced by AOM alone needs at least 30 weeks, this model is used to study the pathogenesis of sporadic CRC. INTRODUCTION 44 Dextran sodium sulfate model of colitis Dextran sodium sulfate (DSS) is a pro‐inflammatory reagent that has been used extensively to induce colitis in experimental models. DSS acts as an irritant to the epithelial lining of colon, resulting in bloody diarrhea (Okayasu et al., 1990; Seril et al., 2003). Colitis induced by DSS has many characteristics similar to human UC, such as signs of diarrhea, shortening of colon, multiple erosions and inflammatory mucosal changes, loss of crypts and ulcerations. Moreover, administration of DSS induces inflammation with high levels of COX‐2, iNOS and high intensity staining of ‐catenin. To induce chronic inflammation, repeated cycles of DSS can be used. It is widely believed that chronic inflammation is a driving force in the CAC (Clapper et al., 2007). Typically 1‐3 % DSS (wt/vol) in drinking water is given to mice for 3‐5 days to induce colitis. Of note, different mouse strains show different susceptibility to DSS (Mahler et al., 1998; Stevceva et al., 1999). Moreover, colon tumorigenesis induced by DSS alone requires a long treatment period with repeated administration of DSS. Additionally, low tumor incidence and multiplicity is also a drawback of this model (Cooper et al., 2000; Okayasu et al., 2002; Tamaru et al., 1993; Yamada et al., 1992). Azoxymethane/ Dextran sodium sulfate model To investigate colitis‐associated tumor development in more rapid and reliable manner, a two‐stage model has been proposed. This includes the combination of a single injection of AOM followed by administration of the pro‐inflammatory reagent DSS (Neufert et al., 2007; Okayasu et al., 1996; Tanaka et al., 2003). With this model, different mouse strains develop multiple colon tumors within a period of 20 weeks (Suzuki et al., 2006; Tanaka et al., 2003). Different susceptibility to AOM/DSS is also reported in different mouse strains. For example, incidence of colonic tumors was 100% in Balb/c mice and 50% in C57BL/6N mice; whereas only adenomas developed in 29% C3H/HeN mice (Suzuki et al., 2006). Furthermore, INTRODUCTION 45repeated DSS administration after AOM injection enhances tumor growth resulting in multiple large colon tumors already after 10 weeks (Becker et al., 2005). When comparing this two‐stage model of tumorigenesis with studies using AOM alone, DSS displays a strong tumor promoting activity in this model (Suzuki et al., 2004; Tanaka et al., 2003). The flat and polypoid lesions developed by AOM/DSS treatment are positive for nuclear ‐catenin. This finding is consistent with the presence of ‐catenin mutations in AOM‐induced colon tumors and the altered localization of ‐catenin in human CAC (Aust et al., 2002; Takahashi et al., 2000b; Tanaka et al., 2005). Moreover, tumors are also positive for COX‐2 and iNOS but not for p53 (Tanaka et al., 2003). Further studies showed that blocking tumor necrosis factor alpha (TNF‐) or interleukin‐6 (IL‐6), two NF‐B regulated cytokines that are important for CAC in human and mice, results in reduced tumor burden and size (Becker et al., 2004; Greten et al., 2004; Grivennikov et al., 2009; Popivanova et al., 2008). These studies support the strong role of inflammation in AOM/DSS model as these two cytokines are mainly produced by inflammatory cells. Due to the highly reliable and reproducible, cost and time effective experimental protocol that also mimics human IBD and CAC, the AOM/DSS model is one of the most widely used experimental system to investigate CAC in mice. p38 in inflammatory bowel disease and colorectal cancer IBD is a disorder that arises from chronic relapsing inflammation. Patients with IBD are associated with higher risk of development of CAC. The duration and extent of colitis (severity of inflammation) are important risk factors to develop colon cancer. Given the role of p38 in inflammatory responses, activation of the p38 MAPK pathway has been evaluated in IBD patients and yielded contradicting results. Some studies report levels of phosphorylated p38 MAPK in IBD patients (Docena et al., 2010; Waetzig et al., 2002), while in other studies p38 MAPK phosphorylation levels were similar in IBD patients compared to controls INTRODUCTION 46 (Malamut et al., 2006). Similar contradicting results were obtained from mouse model of colitis. Some groups reported that p38 MAPK inhibition improves the clinical symptoms (Hollenbach et al., 2004), while others reported deteriorating effects (Malamut et al., 2006; ten Hove et al., 2002). In clinical trials, p38 MAPK inhibitors have not shown promising results. In patients with Crohn’s disease, the p38 and JNK inhibitor CNI‐1493 has shown some clinical improvement (Hommes et al., 2002), while the p38 inhibitor BIRB796 did not show any improvement (Schreiber et al., 2006). Nevertheless, a recent study using specific downregulation of p38 in myeloid cells and intestinal epithelial cells showed opposite function in DSS‐model of colitis which could be a possible explanation for the controversial effects reported upon p38 MAPK inhibition. Downregulation of p38 in myeloid cells reduces colitis whereas in IEC promotes colitis. (Otsuka et al., 2010). However, the role of p38 in these studies was not explored in CAC. A study using the p38/ inhibitor SB2021890 has shown impaired tumor growth in the APCmin /AOM model of CRC (Chiacchiera et al., 2009), but the precise contribution of p38 was not characterized. In this thesis genetic mouse models have been used to inactivate p38 in myeloid cells or IECs combined with the DSS model of colitis or the AOM/DSS model of CAC. 47 Aim of the work AIM OF THE WORK 49In recent years, p38 MAPK has been established as a negative regulator of epithelial cell proliferation both in cell cultures and in mouse models, supporting a putative tumor suppressor role. Surprisingly, few reports suggest p38 in some cancer cell lines can positively regulate proliferation and thus argue against the tumor suppressive function of p38. In addition, p38 has been shown to regulate inflammatory responses by controlling inflammatory mediators. Considering this information, this thesis investigates how p38 regulates colitis‐associated colorectal tumorigenesis with the following specific aims: 1. Impact of p38 downregulation in IECs using the AOM/DSS model of colorectal tumorigenesis. 2. Impact of p38 downregulation in epithelial cells of colorectal tumors induced by AOM/DSS. 3. Impact of p38 downregulation in myeloid cells using the AOM/DSS model of colorectal tumorigenesis. 51 Materials & Methods MATERIALS & METHODS 53Buffers and solutions Laboratory stock solutions and common buffers were prepared as described in Current Protocols in Cell Biology (2001) under the section Laboratory stock solutions and equipment (web link: http://onlinelibrary.wiley.com/doi/10.1002/0471143030.cba02as00/abstract.) Tail Buffer for mice genotyping 100 mM NaCl, 50 mM Tris‐HCl (pH 8), 10m M EDTA (pH 8), 1% SDS in sterile water Cell/tissue lysis buffer 1% NP40, 150 mM NaCl, 50 mM Tris HCl pH 7.5, 2 mM EDTA, 2 mM EGTA, 20 mM sodium fluoride, 2 mM PMSF, 2 M microcystin, 2 mM Sodium orthovanadate, 1 mM DTT and 1x EDTA‐free complete protease inhibitor cocktail (Roche, #11873580001) Laemmli‐SDS‐PAGE gels Resolving gels, Volume (for 10ml) 10% 12% 40% Acrylamyde/Bis (29:1) 2.5 ml 3 ml 1M Tris‐HCl pH 8.8 2.5 ml 2.5 ml 10% SDS 100 l 100 l Water 4.792 ml 4.292 ml 10% APS 100 l 100 l TEMED 8l 8l Stacking gels (4%), Volume 5 ml 10 ml 40% Acrylamyde/Bis (29:1) 0.5 ml 1 ml 1M Tris‐HCl pH 6.8 1.25 ml 0.625 ml 10% SDS 100 l 50 l MATERIALS & METHODS 54 Water 7.54 ml 3.77 ml 10% APS 100 l 50 l TEMED 10l 5l Electrophoresis buffer (10X) 30 g of Tris base 10 g of SDS 144 g of Glycine Dissolved in distilled water and bring volume up to 1 L. Transfer buffer (10X) 30.3 g of Tris base 1 g of SDS 144 g of Glycine Dissolved in distilled water and bring volume up to 1 L. 20% methanol was added to 1X transfer buffer before use. Ponceau Red staining solution (0.1% w/v) in 5% (v/v) acetic acid 0.3 g of Panceau Red 10 ml Acetic acid Dissolved in distilled water, and bring volume up to 200 ml. Laemmli sample loading buffer (5X) For 20 ml, 4.5 ml of 1 M Tris pH 6.8 11.5 ml of 87% glycerol 1 g of SDS 1.5 ml of 1% Bromophenol blue 0.8 g of DTT (154.25 g.mol‐1) Add up to 20 ml water and rotate on a wheel for 30 min. Store in aliquots at ‐20ºC. MATERIALS & METHODS 55Antigen retrieval buffers ‐ Tris‐EDTA buffer pH 9 (for 2 L): 2.4 g Tris, 0.74 g EDTA to 2 L water. Adjust pH to 9. Antigen unmasking was done at 97ºC for 20 min. ‐ Citrate buffer pH 6 (for 200 ml): 0.58 g Sodium citrate in water. Adjust pH to 6 with 1 M citric acid. Antigen unmasking was done at 97ºC for 20 min, except for p38 which was carried at 120ºC for 20 min. ‐ Proteinase K: Ready to use Proteinase K solution from Dako (#S3020) was used. Antigen unmasking was done at room temperature (RT) for 5 min. 0.1 M Phosphate buffer (pH 7.4) for electron microscopy 3.1 g of NaH2PO4.H2O 10.9 g of Na2HPO4 (anhydrous) Dissolved in distilled water and bring volume up to 1 L. The resulting final solution will be of pH 7.4 and can be stored at 4ºC up to 1 month. Commercial Reagents and Kits Product Company Reference 40% Acrylamide/Bis (29:1) Bio‐Rad 161‐0146 APS Sigma A3678 Bromophenol blue Sigma B8026 BSA Sigma A7906 ‐mercaptoethanol Sigma M7154 Citric acid Sigma 251275 DAPI (for TUNEL) Invitrogen MP‐36930 DMEM Sigma D5796 DMSO (for cell culture) Sigma 276855 DNase I Roche 4716728a dNTPs mix (10 mM) Fermentas R0192 DTT GE healthcare 17‐1318‐02 MATERIALS & METHODS 56 FBS Thermo Scientific E6541L Formalin (10%, buffered) Sigma HT501128 Glycerol Sigma 49782 Glycine Sigma G7126 Microcystin‐LR Enzo Life Sciences ALX350012 Nitrocellulose membrane 0.2 m WhatmanTM 10401396 NP‐40 AppliChem A1694,0250 PBS 10x Sigma D1408 Penicillin/Streptomycin (100x) LabClinics P11‐010 Peroxidase Dako S2023 Phenol:chloroform Sigma P2069 PMSF Sigma P7626 Ponceau red Sigma P3504 Primers for PCR and qRT‐PCR Sigma ‐ Propidium iodide Sigma P4864 RNA mini Kit (Pure Link) Ambion 12183‐018A SB203580 Axon MedChem 1363 Sodium citrate Sigma 71497 Sodium dodecyl sulfate Sigma 71725 Sodium fluoride Sigma S7920 Sodium orthovanadate Sigma S6508 SuperScript II reverse transcriptase Invitrogen 18064‐022 Sybr Green supermix Bio‐Rad 1708886 Taq polymerase (Biotaq) Ecogen 21060 TEMED Sigma T9281 Triton X‐100 Sigma T9284 TRIZMA‐HCl Sigma T3253 TRIZMA‐base Sigma T6066 Trypsin‐EDTA Sigma T3924 MATERIALS & METHODS 57TUNEL Roche 11684795910 Tween‐20 Sigma P7949 Mice Mice were housed in the specific pathogen free (SPF) mouse facilities of CNIO (Madrid) and IRB (Barcelona). Mice had free access to regular chow diet and autoclaved sterile water. The animal facility provided a controlled 12 hour light‐dark cycle. For breeding, male and female mice were set together at a minimum age of 6 weeks. Litters were weaned at 4 weeks of age and marked with an eartag. All animal procedures were conducted according to national and EU regulations and protocols were approved by the corresponding Ethics committees. Generation of conditional mice p38lox/lox mice were described previously (Heinrichsdorff et al., 2008; Ventura et al., 2007). p38‐IEC mice and p38‐IEC‐ERT2 were generated by crossing p38lox/lox mice with Villin‐Cre and Villin‐CreERT2 mice, respectively (el Marjou et al., 2004; Madison et al., 2002). To activate the tamoxifen‐inducible Cre‐ERT2 recombinase, mice were injected intraperitoneally for 5 consecutive days with 1 mg/day of 4‐hydroxy tamoxifen (4‐OHT) (Sigma, H6278) dissolved in corn oil (Sigma, #C8267). Three days after the last 4‐OHT injection, p38 downregulation was confirmed by Western blotting. Littermate controls were used in all experiments. To generate p38‐MC mice, p38lox/lox mice were crossed with LysM‐Cre (Clausen et al., 1999). To check efficiency of p38 deletion, peritoneal macrophages were tested for genomic exon‐2 deletion efficiency and western blotting. Isolation of genomic DNA from mouse tail for genotyping Mouse tails were digested in 750 l of Tail buffer with Proteinase K at 56ºC overnight. After overnight digestion, 250 l of saturated NaCl was added, mixed for 5 min and centrifuged at full speed for 10 min at RT. The supernatant was carefully MATERIALS & METHODS 58 taken into a new tube containing 500 l of isopropanol. Tubes were then kept in an eppendorf mixer for 2 min and centrifuged at full speed for 5 min at RT. The supernatant was discarded carefully without disturbing the DNA pellet. Pellet was washed in 70% ethanol and after drying pellet was resuspended in 100 l of autoclaved milliQ water. DNA concentrations were measured in a NanoDrop 2000 spectrophotometer. Mice genotyping was performed by PCR using 25 ng of tail genomic DNA and the following primers and conditions: Primers for CRE: (amplicon size 520 bp) Fw: ACGAGTGATGAGGTTCGCAAG RV: CCCACCGTCAGTACGTGAGAT Primers for flox‐p38: (amplicon sizes are 121 bp for the WT and 188 bp for the floxed alleles). Fw: ATGCTACTGTCTGCGCCTCTCT Rv: CAGCTTCTTAACTGCCACACGA PCR conditions: 94ºC for 5 min, 94ºC for 30 sec, 55ºC for 45 sec, 72ºC for 30 sec, step 2‐4 for 35 cycles, 72ºC for 10 min and 4ºC forever. PCR products were resolved by agarose gel electrophoresis. Dextran sulfate sodium (DSS)‐induced colitis In order to induce colonic inflammation that resembles UC in human IBD patients, mice were fed for 5 days with 2% DSS (w/v) (MW 36‐50 kDa, MP biomedicals, #160110) ad libidum in drinking water. DSS is toxic to the colon epithelium and causes colitis (Okayasu et al., 1990). After DSS treatment, mice were sacrificed at indicated time points and samples were collected for histological and biochemical analysis. During and after the DSS treatment body weight changes were recorded. Body weight loss can be used as an indicator for the severity of DSS‐induced colitis. MATERIALS & METHODS 59AOM/DSS‐induced colorectal cancer protocol To induce colon tumors, mice were subjected to a well‐established, chemically induced inflammation dependent colon cancer protocol (Neufert et al., 2007; Tanaka et al., 2003). According to this protocol, mice (8‐10 weeks old) were injected intraperitoneally with a single dose of AOM (10 mg/kg, Sigma, #A2853) diluted in PBS. After 5 days, 2% DSS was given in the drinking water for 5 days, followed by 14 days of regular drinking water. The DSS treatment was repeated for two additional cycles and mice were sacrificed 100 days after the AOM injection. Colons were removed from animals, flushed with cold PBS, opened longitudinally and fixed as ‘Swiss‐rolls’ in 10% formalin solution (Sigma, #HT‐501128) at room temperature overnight before paraffin‐embedding. Before fixing the colons, tumor counting and size measurements were performed using a digital caliper in a blinded fashion. Sacrifice of mice Mice were euthanized by cervical dislocation. Analysis of intestinal permeability in mice In vivo intestinal permeability was determined in 8‐10 months old mice by measuring the appearance of FITC‐dextran in the blood. Mice were starved overnight and then FITC‐dextran (MW 3000‐5000; Sigma #FD4) was administered by oral gavage (44 mg/100 g body weight). After 4 h, mice were anesthetized, blood was collected by cardiac puncture and mice were sacrificed. Serum was separated from whole blood using SST tubes (BD #365968). Serum samples were diluted with an equal volume of PBS (pH 7.4) and 100 l of diluted serum was added to a 96‐well microplate. The concentration of FITC in serum was determined by spectrophotofluorometry (BioTek) with an excitation of 485 nm (20 nm band width) and an emission wavelength of 528 nm (20 nm band width) using serially diluted FITC‐dextran as standard. MATERIALS & METHODS 60 Transmission electron microscopy Colon pieces were removed from the anesthetized animals and were fixed in a mixture of 2% paraformaldehyde and 2.5% glutaraldehyde in phosphate buffer (PB) 0.1M pH 7.4 at 4ºC overnight. After four washes with PB, the intestine pieces were postfixed with OsO4 (2 %) for 2 h and washed again with MQ water and PB (10 min each wash). Pieces were dehydrated at 4ºC through a series of acetone concentrations (50, 70, 90, 96, and 100%), prior to being progressively (25, 50, 75 and 100%) embedded in Epon 812 epoxy resin. After cell embedment and resin polymerization (60 ºC, 48 h), sections with a thickness of 50 nm were cut with an ultramicrotome UCT6 (Leica Microsystems, Vienna) and placed on TEM grids (Formvar carbon‐coated Cu grids). Finally, the grids were further contrasted with uranyl acetate and lead citrate. All electron micrographs were obtained with a Jeol JEM 1010 MT electron microscope (Jeol, Japan) operating at 80 kV. Images were recorded with AnalySIS (SIS, Munster, Germany) on a Megaview III CCD camera. Inhibition of p38 MAPK in mice The p38 inhibitor PH797804 (Hope et al., 2009) was obtained from Selleckchem (#S2726) and was dissolved in 0.5% Methyl cellulose (Sigma #M7140) and 0.025% Tween 20 (Sigma #P1379) at a concentration of 1 mg/ml. From this stock solution, a dose of 10 mg/kg body weight was administered daily to mice by oral gavage for 12 consecutive days. Control mice were similarly administered with vehicle (0.5% Methyl cellulose and 0.025% Tween 20). Bromodeoxyuridine incorporation Bromodeoxyuridine (BrdU) is a thymidine analogue which is incorporated into newly synthesized DNA of replicating cells during S‐phase of cell cycle. To detect proliferation in tissues, BrdU (Roche #10280879001) was injected intraperitoneally (1 mg /10 g body weight) 2 h before killing the mice. Incorporated BrdU was detected by immunostaining using anti‐BrdU antibody, thus indicating cells that were actively replicating their DNA. MATERIALS & METHODS 61TUNEL assay Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) is a common method to detect DNA fragmentation that results from apoptosis by labeling the terminal end of nucleic acids. To detect apoptosis in paraffin‐embedded samples from DSS treated mice, the Fluorescein In situ cell death detection kit (Roche) was used according to manufacturer’s instructions. Images were taken in Nikon E800 upright microscope using appropriate fluorescence filters. Histological analysis for colon Sample preparation For histological analysis colon tissue was fixed in 10% formalin solution at RT overnight. The samples were then washed with PBS and kept in a Leica tissue processor for tissue dehydration. After tissue dehydration samples were embedded in paraffin blocks using the Paraffin embedding module from Leica. Colon tissues were sectioned with a microtome at 4‐6 m thickness and stained with hematoxylin and eosin (H&E) or used for immune‐staining. Hematoxylin & Eosin staining For histological analysis, formalin‐fixed and paraffin‐embedded colon sections of 5 m thickness were de‐wax in xylol for 10‐15 min and then rehydrated in descending series of ethanol solutions (100%, 95%, 75%, 50% and then in water) . The de‐wax, rehydrated colon sections were stained with H&E using standard protocol and analyzed by pathologists in blinded fashion. Epithelial damage and inflammation was determined using the following scoring systems. For epithelial damage: 1‐ intact crypts, 2‐ basal one‐third damaged, 3‐ basal two‐thirds damaged, 4‐ damaged surface epithelium. For severity of inflammation: 1‐ rare cells in mucosa, 2‐ increased cells in lamina propria, 3‐ confluence of cells in the submucosa, 4‐ transmural inflammation. MATERIALS & METHODS 62 Immunohistochemistry For immunohistochemical (IHC) staining, tissue sections on slides were de‐waxed and re‐hydrated as described above. After washing with tap water for 5 min, endogenous peroxidase activity was blocked for 15 min at RT in peroxidase blocking buffer. Thereafter slides were washed in tap water and antigen unmasking was performed. After antigen retrieval, slides were washed with PBS and unspecific background was blocked with blocking buffer (10% normal goat serum and 0.3% Triton x‐100 in PBS). Diluted primary antibodies were added as indicated in Table 3. After washing the primary antibody, HRP conjugated secondary antibodies were added (Table 4) to the samples and then signals were visualized with DAB (3,3‐diaminobenzidine), using hematoxylin as a counterstaining. To detect goblet cells, colon sections were stained with Periodic acid‐Schiff (PAS) reagent. Tissue was mounted with DPX mounting medium after washing with PBS or dehydrated in descending series of ethanol solutions, cleared in xylol. Table 3: Primary antibodies and conditions for immunostainings. Antibody Company Dilution/ Antigen Incubation retrieval Ki67 Novocastra (NCL‐Ki67‐P) 1:500, 1h RT Citrate Buffer Cleaved casp‐3 Cell signaling (9661) 1:200, 1h RT Citrate Buffer F4/80 eBiosciences (14‐4801) 1:50, 2h RT Proteinase‐K ‐H2AX Millipore (05‐636) 1:600, 2h RT Citrate Buffer Chg‐A Abcam (151601) 1:1000 o/n 4ºC Tris‐EDTA p38  Cell Signaling (9218) 1:50, 2h RT Citrate Buffer anti‐BrdU BD Biosciences (347580) 1:100 1h RT Citrate Buffer MATERIALS & METHODS 63Table 4: HRP conjugate secondary antibodies and conditions for immunostainings. Antibody Company Reference Dilution/incubation anti‐rabbit IgG ImmunoLogic DPVR110HRP 45 min at RT anti‐mouse IgG Dako P0447 1:100, 30 min at RT anti‐rat IgG Dako P0450 1:75, 30 min at RT Isolation of colon epithelial cells Mice were sacrificed and colons were dissected, opened longitudinally and washed extensively in cold PBS. Colons were then cut into 3‐4 pieces and incubated in 8 mM EDTA in PBS at 37ºC. After 15 min, EDTA solution was replaced with cold PBS and shacked vigorously for 45 sec to 1 min. This process was repeated once. Supernatants from both incubations were combined, centrifuged at 1200 rpm for 5 min at 4ºC, and pelleted cells were resuspended in 5 ml of cold PBS and centrifuged at 12000 rpm for 5 min. Pellets contain mainly IECs and were frozen or processed for protein extraction. Isolation of peritoneal macrophages Mice were sacrificed and a small incision was made in abdominal skin of the mouse. Carefully skin was pulled down with both hands without breaking peritoneum. Once peritoneum is visible, 5 ml cold PBS was injected into peritoneal cavity. Mouse was then swish around to wash peritoneal cavity with the injected PBS. PBS containing macrophages was then recovered from peritoneal cavity using syringe. This process was repeated once. Macrophages were pelleted at 1200 rpm for 5 min, resuspended in 3 ml DMEM containing 10% FBS and 1% penicillin‐streptomycin and plated in 6 cm tissue culture plate. Next day, cells were washed 2‐3 times with cold PBS to remove all dead and non‐adherent cells. Adherent cells are mainly macrophages and were used for protein extraction. MATERIALS & METHODS 64 Preparation of protein extracts from isolated cells and tissue Isolated IECs or macrophages were lysed in lysis buffer for 30 min on ice. Lysed cells were centrifuged at 13000 rpm for 10 min at 4ºC and the supernatant was collected in new tube. Protein extracts from tissues were prepared in the same lysis buffer using the Precellys homogenization and lysis instrument (Bertin technologies). After homogenization, protein extracts were recovered by centrifugation at full speed for 10 min at 4ºC. Determination of protein concentration Total protein was quantified using the DCTM protein assay (Bio‐Rad) according to manufacturer instructions. Protein concentrations were measured with a spectrophotometer at an absorbance of 750 nm. For the calculation of protein concentrations a BSA‐standard curve was used. Western blotting After protein concentration quantification, 40 g of total protein was boiled in 1x Laemmli sample loading buffer for 5 min and separated by electrophoresis on 10% or 12% SDS‐PAGE depending on the molecular weight of the proteins of interest. After the electrophoresis, separated proteins in the gel were transferred to nitrocellulose membrane (Whatman #10401396) using a wet‐blotting transfer system (Bio Rad). Ponceau red staining was used to confirm the efficiency of transfer. Ponceau red was washed with PBS and the nitrocellulose membrane was blocked, in 5% non‐fat milk and 1% BSA in PBS for 1 h at RT, to reduce the unspecific binding of antibodies. After washing with PBS, membranes were incubated at 4ºC overnight with the primary antibodies, washed again with PBS and incubated with Alexa Fluro 680 or 800‐conjugated secondary antibodies for 1 h at RT before visualization using the Odyssey Infrared Imaging System (Li‐Cor, Biosciences). Anti‐tubulin was used as a loading control. The primary and secondary antibodies and the dilutions used are listed in Tables 5 and 6. MATERIALS & METHODS 65Table 5: List of primary antibodies and dilutions used for western blotting. Antibody Company Reference Dilutions p38 Cell Signaling 9218 1:1000 p38   Santa Cruz sc‐535 1:1000p38 Homemade* ‐ 1:500 p38 Homemade* ‐ 1:500 phospho‐p38 Cell Signaling 9211 1:600 phospho‐HSP27 Cell Signaling 2401 1:600 HSP27 Santa Cruz sc‐1049 1:1000 phospho‐Stat3 Cell Signaling 9145 1:600 Stat3 Cell Signaling 9132 1:1000 phospho‐IKB  Cell Signaling 9246 1:600 IKB   Cell Signaling 4812 1:1000 Mcl‐1   Cell Signaling 5453 1:1000 Bcl‐2   Cell Signaling 2870 1:1000 Bak   Cell Signaling 3814 1:1000 Bax   Cell Signaling 2772 1:1000 Bcl‐XL Santa Cruz sc‐8392 1:1000 phospho‐AKT Cell Signaling 9271 1:1000 phospho‐ERK1/2 Cell Signaling 9101 1:1000 phospho‐JNK BD Biosciences 612541 1:600 JNK Santa Cruz sc‐571 1:1000 phospho‐p53 Ser‐15 Cell Signaling 9284 1:1000 p53 Cell Signaling 2524 1:1000 p85 PARP Promega G734 1:500 Caspase 3 Cell Signaling 9665 1:1000 COX‐2 Santa Cruz sc‐19999 1:1000 NFB p65 Santa Cruz sc‐372 1:1000 MATERIALS & METHODS 66 PCNA Santa Cruz sc‐9857 1:1000 ‐H2AX Millipore 05‐636 1:1000 ZO‐1 Invitrogen 40‐2200 1:1000 Claudin‐1 Invitrogen 374900 1:500 Tubulin Sigma T9026 1:5000 *p38 and p38 sheep antibodies were kindly provided by Dr. Ana Cuenda, CNB‐CSIC, Madrid. Table 6: List of secondary antibodies and dilutions used for western blotting. Antibody Company Reference Dilutions Goat IgG (Alexa Fluor 680) Invitrogen A21084 1:5000 Mouse IgG (Alexa Fluor 680) Invitrogen A21057 1:5000 Mouse IgG (Alexa Fluor 800) Rockland 610‐731‐124 1:5000 Rabbit IgG (Alexa Fluor 680) Invitrogen A21076 1:5000 Rabbit IgG (Alexa Fluor 800) Rockland 611‐131‐122 1:5000 Sheep IgG (Alexa Fluor 680) Invitrogen A‐21102 1:5000 IL‐6 in blood and colon tissue Blood was collected by cardiac puncture and serum samples were obtained using SST tubes (BD #365968). IL‐6 concentrations in serum were determined by the CBA mouse IL‐6 flex set (BD #558301) according to manufacturer’s instructions. To determine IL‐6 levels in colonic tissue, 100 g of freshly lysed colon tissue were analyzed by ELISA using anti‐mouse IL‐6 purified capture antibody (eBioscience #14‐7060‐81) and anti‐mouse IL‐6 biotin detection antibody (eBioscience #13‐7062‐81). Mouse IL‐6 recombinant protein (eBioscience #14‐8061‐62) was used to make standard curve. Analysis of epithelial cells and leukocytes from colon Acute colitis was induced by treating mice with 2% DSS for 5 days. One day after termination of the DSS treatment, mice were sacrificed and colons were dissected, MATERIALS & METHODS 67opened longitudinally and washed extensively in cold PBS. Colons were then cut into 3‐4 pieces and incubated in 8 mM EDTA solution in PBS at 37ºC for 15 min. After 15 min, EDTA solution was replaced with cold PBS and shacked vigorously for 45 sec. This process was repeated once. Supernatants from both incubations were combined, centrifuged at 1200 rpm for 5 min at 4ºC, and pelleted cells were digested with Dispase II (0.5 mg/ml, Roche #04942078001) at 37ºC for 25 min. After the incubation, the digested cell suspension was gently syringed with a 18G needle in order to get enriched single cell population and sequentially passed through 100, 70 and 40 m mesh filters (BD Biosciences). Filtered cells contain epithelial cells and intra‐epithelial leukocytes. To obtain lamina propria leukocytes, colon pieces were collected after EDTA incubations, cut into small pieces (2‐3 mm) and digested with a mix of collagenase A (1.75 mg/ml, Roche #10103586001) and DNase I (0.05 mg/ml, Sigma #D4263) at 37ºC for 45 min. After digestion, the cell suspension was filtered as above to get a single cell suspension containing lamina propria leukocytes. To quantify immune cell populations, single cell suspensions from both purifications were co‐stained with pan‐leukocyte antigen CD45 and with specific leukocyte population markers (CD11b, Gr1 and CD19) and analyzed on FACS Aria 2.0 (BD Biosciences). FITC‐EpCAM (Santa Cruz #sc‐53532) staining was used to discard epithelial cells by negative selection. To get epithelial cells and total leukocytes from the colon, after induction of acute colitis whole colon tissue was digested in a mix of collagenase and DNase I, syringed and sequentially filtered as described above. Then cells were co‐stained with FITC‐EpCAM and APC‐CD45 (BD #559864). Stained cells were analyzed and sorted for EpCAM+ epithelial cells and CD45+ leukocytes. RNA was isolated from sorted cells using standard TRIzol method for RT‐PCR analysis. RNA extraction from isolated cells and tissues Total RNA was extracted from distal colon segments or isolated cells using TRIzol (Invitrogen) or Purelink RNA minikit (Ambion #12183018A) following the manufacturer’s instructions. After extraction total RNA was treated with DNase I MATERIALS & METHODS 68 (Roche #04716728001) to eliminate DNA contamination and RNA was repurified by the standard Phenol/Chloroform method. RNA concentration and purity was determined by measuring the absorbance (optical density, OD) at 260 nm in relation to the absorbance at 280 nm (OD260/OD280 ratio) using NanoDrop 2000 spectrophotometer (Thermo Scientific). cDNA synthesis Total RNA (1‐2 g) was reverse transcribed using a Super script II Reverse Transcriptase (Invitrogen #18064‐014) and Random primers (Invitrogen #48190‐011) in a final volume of 20 l according to the manufacturer’s instructions. Quantitative real‐time PCR The cDNA was diluted 1/12 and 4 l diluted cDNA was used in triplicate for the real‐time PCR using SYBR green (Bio‐Rad #1708886) in 20 l total volume on a Bio‐Rad C1000 thermal cycler machine. Each primer (Table 7) was used at final concentration of 0.25 M. PCR conditions are as follows: 50ºC for 2 min, 95ºC for 10 min, 40 cycles of denaturation at 95ºC for 15 s, annealing at 56ºC for 15 s, elongation at 72ºC for 60 s, and three final steps of 95ºC for 15 s, 60ºC for 2 min and 95ºC for 15 s. Relative quantities ( cycle threshold values) were obtained by normalizing against GAPDH. Table 7: Primers used in quantitative RT‐PCR Gene (mouse) Sequence (5’‐3’) GAPDH FW: CTTCACCACCATGGAGGAGGC RV: GGCATGGACTGTGGTCATGAG IL‐6 FW: AGTTGCCTTCTTGGGACTGA RV: CAGAATTGCCATTGCACAAC IL‐1 FW: GAGAGCCGGGTGACAGTATC RV: TGACAAACTTCTGCCTGACG MATERIALS & METHODS 69TNF‐ FW: CGTCAGCCGATTTGCTATCT RV: CGGACTCCGCAAAGTCTAAG COX2 FW: AAAAGCTGGGAAGCCTTCTC RV: AAGTGCTGGGCAAAGAATGC p38(exon‐2) FW: GCATCGTGTGGCAGTTAAGA RV: GTCCTTTTGGCGTGAATGAT p38(exon‐12) FW: GCCCTCCCTCACTTCAGGAG RV: TGTGCTCGGCACTGGAGACC p38 FW: CTGACCGACGACCACGTTC RV: CTTCGTTCACAGCTAGGTTGC p38 FW: TACCATGACCCTGACGATGA RV: TCCTTGGCCTCAACACTTTC p38 FW: GTCTGTTGGTTGCATCATGG RV: TCCTTGCCCTTGAAGAGTGT p38 FW: TGAGTTTGTTCAGAAGCTACAGAGT RV: ACAGCCTGAGGGCTTGCGTT Chg A FW: AAGTGCGTCCTGGAAGTCATCTC RV: GCTTGGCTTTTCTGGCTTGC Ki67 FW: GTGCTGACCCTGATGGGGAAGG RV: GCTCTTGCCCTGCCTGACACC CyclinD1 FW: CTGCAAATGGAACTGCTTCTGGTGA RV: AGCAGGAGAGGAAGTTGTTGGGGCT Muc2 FW: GCCCGTGGAGTCGTACGTGC RV: TTGGGGCAGAGTGAGGCGGT Tff3 FW: TAATGCTGTTGGTGGTCCTG RV: CAGCCACGGTTGTTACACTG TGFβ1 FW: GGAGGTACCGCCCGGCCCGC RV: GACAGCAATGGGGGTTCGGG IL‐10 FW: CCAAGCCTTATCGGAAATGA MATERIALS & METHODS 70 RV: TTTTCACAGGGGAGAAATCG IL‐12p40 FW: AGGTCACACTGGACCAAAGG RV: TGGTTTGATGATGTCCCTGA ZO‐1 FW: GCCGCTAAGAGCACAGCAA RV: GCCCTCCTTTTAACACATCAGA Occludin FW: TTGAAAGTCCACCTCCTTACAGA RV: CCGGATAAAAAGAGTACGCTGG Analysis of apoptosis in human cancer cell lines Human colon cancer cell lines SW‐620 and Caco‐2 were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% heat‐inactivated fetal bovine serum, 1% l‐glutamine, and 1% penicillin‐streptomycin. The p38 MAPK inhibitors SB203580 (10 M), PH797804 (1 M) and Birb0796 (200 nM) were added every 48 h to the cell cultures. After 96 h, all the cells (including floating cells in the medium) were collected and lysed. Cell lysates were analyzed by western blotting using p85 PARP antibody (Promega) as an apoptosis marker. Statistical methods Data are presented as mean ± SEM. Statistical significance was determined by Student’s t test using GraphPad Prism 4 software. P values less than 0.05 were considered statistically significant. 71 Results RESULTS 73Downregulation of p38 in IECs In order to study the role of p38 in colitis and CAC, we generated mice lacking p38 in IECs by crossing p38 (lox/lox) mice (Heinrichsdorff et al., 2008) with Villin‐Cre mice (el Marjou et al., 2004), which express Cre recombinase under the control of the promoter for the IEC‐specific gene villin. We confirmed the efficiency of p38 deletion in the whole colon lysates and in isolated colon epithelial cells by western blotting. The remaining p38 expression in whole colon lysates may be due to the presence of non‐epithelial cells in colon. The downregulation of p38 was more evident in isolated colon epithelial cells (Figure 7A). p38 downregulation in IECs did not affect the expression of other p38 MAPKs as determined by western blotting and by quantitative real‐time PCR (Figure 7B and 7C). Mice deficient of p38 in IEC (p38‐IEC) appeared healthy and showed no obvious phenotype. Figure 7. Analysis of p38 downregulation in IECs. (A) Western blotting of p38 in whole colon lysates and in isolated IECs (colon crypts) from non‐treated WT and p38‐IEC mice. (B) Western blotting of p38 MAPKs in the whole colon lysates from WT and p38‐IEC mice. Tubulin was used as a loading control. (C) Relative mRNA expression levels of p38 MAPKs in the distal colon of non‐treated WT and p38‐IEC mice were determined by qRT‐PCR and normalized to GAPDH mRNA. Data are means ± SEM (n = 4) ∗, p<0.05. RESULTS 74 Downregulation of p38 in IECs increases CAC To investigate the role of p38 in CAC, we used a protocol that combines the carcinogen AOM with DSS‐induced colitis. When we applied this protocol to p38‐IEC mice or to their wild‐type (WT) littermates (Figure 8A), all mice developed colon tumors 100 days after the AOM injection. We confirmed that p38 expression was significantly downregulated in the colon lysates from AOM/DSS‐treated p38‐IEC mice (Figure 8B). The tumors were mainly distributed in the distal to middle colon (Figure 8C), which is the predominant localization of colorectal human tumors (Neufert et al., 2007). No tumors were found in the proximal part of the colon in either group of animals. We noticed that p38‐IEC mice had more macroscopic tumors than WT mice, but the average tumor size was not significantly changed (Figure 8D). On the other hand, the average tumor load, calculated by adding up the diameters of all the tumors in a given mouse, was also significantly higher in p38‐IEC mice (Figure 8D). Figure 8. Downregulation of p38 in IECs increases susceptibility to AOM/DSS‐induced colon tumorigenesis. (A) Schematic representation of the AOM/DSS protocol for colorectal tumorigenesis. (B) Western blotting of p38 in colon lysates from AOM/DSS‐treated WT and p38‐IEC mice. Tubulin was used as a loading control. (C) Representative images of colons from WT and p38‐IEC mice showing tumors in the distal/middle region. RESULTS 75(D) Average number and size of tumors formed in WT and p38‐IEC mice at the end of the AOM/DSS protocol. Average tumor load was determined by adding all tumor diameters for a given animal. Data represent means ± SEM (n ≥ 7). ∗, p<0.05. Next we histologically analyzed the tumors developed in WT and p38‐IEC mice upon AOM/DSS treatment. Colon sections were H&E stained and microscopic tumors were counted and graded into low‐ and high‐ grade tumors. We found more tumors of both low‐grade (13 vs. 7 in WT, n=8) and high‐grade (29 vs. 18 in WT, n=8) in p38 IEC mice (Figure 9A), but the relative proportion of low and high‐grade tumors detected by microscopy in p38‐IEC versus WT mice was similar as in the macroscopic analysis. These observations indicate that p38 may play a role in colon tumor initiation. We also analyzed the levels of cell proliferation and apoptosis in the colon tumors from WT and p38‐IEC mice at day 100 after AOM injection. Colonic sections were stained with antibodies against BrdU or cleaved Caspase 3. Quantification of BrdU positive proliferative cells and Cleaved caspase 3 positive apoptotic cells revealed no differences in the tumors from WT and p38 IEC mice (Figure 9B). Chronic inflammation induced by repeated cycles of DSS is a main contributor of colon tumorigenesis induced by AOM/DSS, and inflammatory mediators such as COX‐2, IL‐6, IL‐1 and TNF‐ are upregulated in these tumors. We found no significant differences in the basal mRNA expression levels of inflammatory mediators between WT and p38‐IEC mice before treatment (see below Figure 14A). However, the colon from p38‐IEC mice treated with AOM/DSS showed higher COX‐2 and IL‐6 mRNA levels than the colon from treated WT mice (Figure 10A). Interestingly, circulating IL‐6 levels were also higher in serum from p38‐IEC mice than in WT mice at the end of the AOM/DSS protocol (Figure 10B). This is consistent with the known importance of IL‐6 for colon tumor development. RESULTS 76 Figure 9. Downregulation of p38 in IECs does not affect proliferation and apoptosis within tumors induced by AOM/DSS. (A) Representative images of H&E stained colon tumors at the end of the AOM/DSS protocol. Tumors were microscopically analyzed and classified into low or high grade (n=8). (B) Colon sections from WT and p38‐IEC mice were stained with BrdU or Cleaved Caspase 3 to determine cell proliferation and apoptosis, respectively. Histograms show average numbers of BrdU+ cells or Cleaved caspase 3+ cells per field. Data represent means ± SEM (n = 4). Bars = 50 m Taking together, this data indicate that p38 in IECs suppresses CAC. Since tumor growth was not affected, we hypothesized that p38 signaling in IECs regulates tumor initiation. RESULTS 77 Figure 10: Expression of inflammatory mediators in AOM/DSS‐treated mice. (A) Analysis by real‐time qPCR of mRNA expression levels for the indicated pro‐inflammatory mediators in colon from WT and p38‐IEC mice at the end of the AOM/DSS protocol. Data are means ± SEM (n = 4). (B) IL‐6 protein levels in blood serum from mice after the AOM/DSS protocol. Data are means ± SEM (n = 4). Early AOM response is not affected in p38‐IEC mice We investigated if the differences in tumorigenesis between WT and p38‐IEC mice were due to differences in the initial response to AOM. However, AOM‐induced DNA damage, as measured by ‐H2AX levels, was very similar in colon sections and colon lysates from WT and p38‐IEC mice (Figure 11A and 11B). Alkylating agents such as AOM induce rapid p53‐dependent apoptosis of IECs at the crypt base (Toft et al., 1999), but we observed no differences in apoptosis between colons from WT and p38‐IEC mice after AOM injection (Figure 11C). Consistent with this, we observed no differences in the phosphorylation of p53 at Ser‐15 (Figure 11B). This phosphorylation is induced in response to DNA damage and leads to cell cycle arrest or apoptosis (Al Rashid et al., 2005; Long et al., 2007; Takeba et al., 2007). Altogether, these results indicate that p38 downregulation in IECs does not affect the initial response to AOM. RESULTS 78 Figure 11. Downregulation of p38 in IECs does not affect AOM‐induced DNA damage. WT and p38‐IEC mice were intraperitoneally injected with AOM or PBS and killed 7 h later. (A). Colon sections from WT and p38‐IEC mice were stained with ‐H2AX antibody to detect AOM‐induced DNA damage. Bars = 100 m. (B) Colon lysates from AOM‐treated WT and p38‐IEC mice were analyzed by western blotting using the indicated antibodies. (C). Colon sections from WT and p38‐IEC mice were stained with cleaved caspase 3 antibody to detect apoptosis. Bars = 100 m. The average number of apoptotic cells (Cleaved caspase 3+) at the base of crypts in AOM‐treated mice was quantified. Data represent means ± SEM (n =3). p38‐IEC mice are more susceptible to DSS‐induced colitis The AOM/DSS tumorigenesis protocol is strongly dependent on the inflammation caused by repeated cycles of DSS (Neufert et al., 2007). Moreover, it is well established that inflammation is a critical contributor to tumorigenesis (Hussain RESULTS 79and Harris, 2007). Since we did not detect differences in the initial response to AOM, we investigated if the enhanced tumorigenesis in p38‐IEC mice was due to differences in inflammation and epithelial damage caused by DSS. To test this, mice were administered 2% DSS for 5 days to induces acute colitis and body weight changes were recorded. Loss of body weight can be used as an indicator for the severity of DSS‐induced colitis. We found that p38‐IEC mice lost significantly more body weight than WT mice (Figure 12A). This suggested that p38‐IEC mice probably had enhanced inflammation and intestinal damage. To confirm this possibility, mice were given DSS for 5 days and then were sacrificed at days 6 and 9 (one and four days after termination of the DSS treatment) to histologically analyze colon sections (Figure 12B). Histological analysis revealed that DSS‐treated p38‐IEC mice had significantly more epithelial damage in the distal‐middle part of the colon at both day 6 and day 9 than DSS‐treated WT mice (Figure 12C). At day 6, WT colon tissues showed minimal to mild inflammation while colon tissues from p38‐IEC mice showed moderate to severe inflammation with many areas of complete crypt loss and erosions (Figure 12B). At day 9, WT mice had moderate inflammation with some regenerative crypts, whereas p38‐IEC mice showed moderate to severe inflammation (Figure 12B). These results indicate more epithelial damage and inflammation in p38‐IEC mice upon acute DSS‐ administration. RESULTS 80 Figure 12. Downregulation of p38 in IECs increases susceptibility to DSS‐induced colitis and epithelial damage. (A) Body weight loss induced by 2% DSS in WT and p38‐IEC mice was recorded every other day after DSS administration. Data are means ± SEM (n ≥ 8) ∗, p<0.05 . (B) Representative H&E‐stained colon sections from WT and p38‐IEC mice that were either untreated or treated with 2% DSS for 5 days and analyzed at days 6 and 9. Bars = 100 m. (C) Quantification of epithelial damage induced by DSS treatment. Data represent means ± SEM (n =4) ∗, p<0.05 Increased immune cell infiltration in p38‐IEC mice treated with DSS Since p38‐IEC mice showed higher epithelial damage and inflammation, we characterized the immune cell infiltration in the colon of DSS‐treated WT and p38‐IEC mice. Quantification of infiltrating cells in H&E stained tissues at day 6 (one day after termination of the DSS treatment) revealed higher infiltration in the colon of p38‐IEC mice (Figure 13A). RESULTS 81 Figure 13. Increased immune cell infiltration in p38‐IEC mice treated with DSS. (A) Quantification of infiltrating immune cells in H&E‐stained colon sections of mice that were either untreated or treated with 2% DSS for 5 days and analyzed at day 6. Data represent means ± SEM (n =4) ∗, p<0.05. (B) CD45+ leukocytes, CD19+ B‐cells and Gr1+ neutrophils in colon lamina propria and intraepithelial compartments of mice treated with 2% DSS for 5 days and analyzed at day 6. Histograms show numbers of the indicated cells per 103 total cells. Data represent means ± SEM. (C) Colon sections from WT and p38‐IEC mice treated with DSS as in (A) were stained with F4/80 antibody to identify macrophages. To characterize infiltrating immune cell populations, mice were treated with DSS for 5 days and one day later the epithelial/intraepithelial cells and lamina propria cells of the colon were separated by enzymatic digestion. Isolated cells were stained with the common leukocyte marker CD45, neutrophil‐specific marker Gr1 or B cell‐specific marker CD19 and quantified by flow cytometry analysis. We found significantly more CD45+ cells in both epithelial/intraepithelial and lamina propria fractions from p38‐IEC mice compared to WT mice, and B cells (CD45+CD19+) also RESULTS 82 accumulated more in the lamina propria of p38‐IEC mice subjected to DSS‐induced colitis (Figure 13B). However, there were no differences in neutrophil infiltration (CD45+CD11b+Gr1+) between the colons from WT and p38‐IEC mice (Figure 13B). Macrophages are important components of the immune infiltrates in DSS‐treated mice and we found more macrophages in the colon of p38‐IEC mice compared to WT mice at day 6 (Figure 13C). No differences in macrophage infiltration were observed between non DSS‐treated WT and p38‐IEC mice. Increased inflammatory mediators in p38‐IEC mice treated with DSS Infiltrating immune cells produce cytokines and chemokines that modulate the inflammation process. We analyzed the expression levels of inflammatory mediators and found that IL‐6 and COX‐2 mRNAs were both significantly upregulated in the colon of DSS‐treated p38‐IEC mice compared to WT animals, whereas IL‐1 and TNF mRNAs were comparable in WT and p38‐IEC mice (Figure 14A). Increased IL‐6 mRNA levels in DSS‐treated p38‐IEC mice prompted us to check IL‐6 protein levels in blood serum and colon lysates from these mice. We found that the IL‐6 protein concentration was significantly higher in colon from p38‐IEC mice compared to WT animals after DSS treatment (Figure 14B). IL‐6 levels were also reproducibly higher in blood from p38‐IEC mice (Figure 14B). The increased IL‐6 levels found in p38‐IEC mice were unexpected, since the p38 pathway is known to positively regulate IL‐6 expression in several cell types (Cuenda and Rousseau, 2007). This could be due to the presence in the p38‐deficient colon of more infiltrating immune cells, which are an important source of IL‐6. Alternatively, p38 could negatively regulate IL‐6 production in the IECs. To test this possibility, IECs and total leukocyte populations were isolated from DSS‐treated animals by FACS sorting and the expression levels for inflammatory mediators were analyzed. We found that IL‐6, IL‐1 and COX‐2 mRNAs were all upregulated in the IECs from RESULTS 83DSS‐treated p38‐IEC mice compared to WT animals (Figure 14C), whereas TNF mRNA levels did not change. In contrast, the mRNA levels for IL‐6, IL‐1 COX‐2 and TNF were similar in the leukocytes from colon of WT and p38‐IEC mice (Figure 14C), which is consistent with the leukocytes being WT in both cases. Thus, the upregulation of IL‐6 and COX‐2 can be probably accounted for by both the presence of more infiltrating cells in the colon of p38‐IEC mice and the enhanced expression of these genes in p38‐deficient IECs Figure 14. Elevated inflammatory mediators in p38‐IEC mice after DSS‐induced colitis. (A) Expression of inflammatory mediators in the distal colon of non‐treated and DSS‐treated WT and p38‐IEC mice. Relative mRNA expression levels for the indicated genes were determined by real‐time qPCR and were normalized to GAPDH mRNA. Expression levels in non‐treated WT and p38‐IEC mice were the same and were given the value of 1. Data are means ± SEM (n = 4) ∗, p<0.05. (B) IL‐6 protein levels in blood serum and whole colon lysates of DSS‐treated WT and p38‐IEC mice were determined. Data are means ± SEM (n = 5). (C) Expression of inflammatory mediators in Epcam+ epithelial cells and CD45+ leukocyte populations from DSS‐treated WT and p38‐IEC mice. Relative mRNA expression for the indicated genes was determined by real‐time qPCR and normalized to GAPDH mRNA. RESULTS 84 Consistent with the increased IL‐6 expression levels observed in the colon of p38‐IEC mice after 5 days of DSS treatment, we also detected phosphorylation and degradation of IkB, suggesting activation of the NFkB pathway, as well as enhanced phosphorylation of STAT3, a downstream target of IL‐6 family receptors. Inflammatory mediator COX‐2 protein level was also elevated p38‐IEC mice after 5 days of DSS treatment (Figure 15). Figure 15. Elevated inflammatory mediators in p38‐IEC mice after DSS‐treatment. Western blotting with the indicated antibodies and whole colon lysates prepared from DSS‐treated WT and p38‐IEC mice. Colon lysates from 2 different mice were individually analyzed in each case (one per lane). Increased apoptosis in p38‐IEC mice treated with DSS DSS is believed to induce colonic inflammation through physical disruption of the mucosal barrier, inducing epithelial cell apoptosis and thus exposing inflammatory cells of the lamina propria to lumen bacteria and bacterial products (Okayasu et al., 1990). Epithelial apoptosis was also reported in UC patients, which leads to colonic inflammation (Iwamoto et al., 1996). As we detected more inflammatory cells in the colon of DSS‐treated p38‐IEC mice, we hypothesized that the increased inflammation in these mice could be due to enhanced epithelial cell apoptosis. To test this, we treated mice with 3% DSS for 3 days and then apoptosis was detected using TUNEL staining. Apoptosis was RESULTS 85detected in both WT and p38‐IEC mice after DSS treatment, but p38‐IEC mice showed more apoptosis compared to WT mice (Figure 16 A & B). Figure 16. Downregulation of p38 in IECs results in enhanced apoptosis after DSS‐induced colitis. (A) Representative TUNEL staining of colon sections from WT and p38‐IEC mice 3 days after DSS treatment. (B) Quantification of TUNEL+ apoptotic cells. Data represent means ± SEM (n =3) ∗, p<0.05. (C) Western blotting with the indicated antibodies and colon epithelial cells obtained from DSS‐treated WT and p38‐IEC mice. Colon lysates from 3 different mice were individually analyzed in each case (one per lane). Asterisk shows non‐specific bands. (D) Densitometric quantification of Bak normalized to tubulin in western blot. Data represent means ± SEM (n =3) ∗, p<0.05. RESULTS 86 Biochemical analysis of colon epithelial cells isolated three days after DSS treatment confirmed that p38 was efficiently downregulated in p38‐IEC mice. Western blot analysis of Bcl‐2 family proteins showed 1.5 fold induction of the pro‐apoptotic protein Bak in p38‐IEC mice, whereas expression of Bax and the anti‐apoptotic proteins Mcl‐1, Bcl‐2 and Bcl‐XL were similar in WT and p38‐IEC mice (Figure 16C). The increased expression of the pro‐apoptotic protein Bak could account for the increased apoptosis observed in the p38‐IEC mice upon DSS treatment. Neither upregulation of p53 nor change in JNK phosphorylation was detected in p38‐IEC mice. These results suggest that the p53 and JNK pathways do not contribute to the increased apoptosis induced by DSS in p38‐IEC mice. p38downregulation induces hyperproliferation of IECs treated with DSS IL‐6 is an important regulator of the proliferation and survival of IECs (Bollrath et al., 2009; Grivennikov et al., 2009). Since we detected more IL‐6 both in the whole colon and in IECs isolated from p38‐IEC mice, we analyzed cell proliferation by Ki67 immunostaining in the colon from DSS‐treated WT and p38‐IEC mice. We treated mice for 5 days with 2% DSS and collected samples at day 6, day 9 and day 13. At day 6 (one day after DSS termination), we observed no differences in proliferation between the areas of intact crypts in WT and p38‐IEC mice (Figure 17). In fact, proliferation was significantly decreased in both cases when compared to untreated animals, in agreement with previous reports (Boismenu et al., 2002). Interestingly, we found more proliferative cells in p38‐IEC than in WT mice in the areas of complete crypt loss at day 6, which probably represents a mixture of IECs and inflammatory cells (Figure 17). RESULTS 87 Figure 17. Loss of p38 induces hyperproliferation of IECs upon DSS treatment. Sections from the distal colon of WT and p38‐IEC mice treated with 2% DSS for 5 days were stained with Ki67 antibody to detect proliferation at days 6, 9 and 13. Day 6: left panel shows an area with intact crypt architecture; right panel is an area with damage and crypt loss. Day 9: shows regenerating epithelia. DSS is toxic to intestinal epithelial cells causing epithelial damage and inflammation. After DSS removal, damaged IECs start the repair and regeneration process. Consistent with this, we observed a higher proliferation rate in IECs at days 9 and 13 (4 and 8 days after termination of the DSS treatment) in WT and p38‐IEC mice compared to non‐treated animals. Surprisingly, proliferation was much higher in p38‐IEC mice than in WT mice during the regeneration of the intestinal epithelia (Figure 17). These data suggest that p38downregulation results in the hyperproliferation of IECs after DSS‐induced injury and colitis. DSS‐treatment suffices to induce colon tumors in p38‐IEC mice Inflammatory cytokines are important for tissue repair, but when tissue injury and inflammation cannot be resolved due to repetitive damage, the resulting process of unchecked compensatory proliferation and regeneration can promote tumorigenesis (Kuraishy et al., 2011). To test this possibility, we treated mice with three cycles of DSS, to induce repeated injury/inflammation, but in the absence of RESULTS 88 the AOM carcinogen (Figure 18A). Macroscopic examination revealed that WT mice did not develop any tumors in the absence of AOM treatment as expected. However, about 60% of the p38‐IEC mice developed at least 1 tumor (Figure 18A). Microscopic examination of H&E stained colon sections confirmed the presence of tumors in p38‐IEC mice, which also contained more aberrant crypt foci with hyperchromatism of nuclei as well as dysplastic and hyperplastic crypts compared to WT mice (Figure 18). Figure 18. DSS alone suffices to induce colon tumors in p38‐IEC mice. (A) Schematic representation of the DSS protocol used to induce chronic colitis. Mice were killed at day 120 for analysis. Table shows the incidence of tumors per mouse. (B) Representative images of H&E stained colon tumors at the end of the DSS treatment. Next, we analyzed macrophage infiltration in the colon sections and found that WT mice had low to moderate infiltration whereas in p38‐IEC mice macrophage infiltration was medium to high (Figure 19A). Expression levels of the inflammatory mediators COX‐2, IL‐6, TNF‐, and IL‐12p40 were also higher in the colon of DSS‐treated p38‐IEC mice compared to WT mice (Figure 19B). Taking together, these data suggest that repeated epithelial damage and inflammation induced by DSS in the absence of p38, results in uncontrolled RESULTS 89hyperproliferation of IECs and a pro‐tumorigenic environment that ultimately induces colon hyperplasia and tumor formation. Figure 19. Increased inflammatory mediators in p38‐IEC mice after chronic colitis induced by DSS. (A) Colon sections from WT and p38‐IEC mice treated with 3 cycles of DSS were stained with F4/80 antibody to detect macrophages. (B) Relative mRNA expression levels of the indicated genes in the colon of WT and p38‐IEC mice were determined by qRT‐PCR and normalized to GAPDH mRNA. Data are means ± SEM (n = 4) ∗, p<0.05. AOM and one cycle of DSS induce aberrant crypt foci and hyperplasia in p38‐IEC mice Early response to AOM alone was not very different in WT and p38‐IEC mice (Figure 11), whereas treatment with DSS alone induced hyperproliferation of IECs in the p38‐IEC mice (Figure 17). Moreover, we detected colon tumors in p38‐IEC mice after repetitive DSS‐induced injury (Figure 18). Therefore, we investigated if the combined treatment of AOM withy one cycle of DSS would result in more aberrant crypt foci (ACF) formation in p38‐IEC mice due to increased proliferation and inflammation caused by DSS. ACF are believed to be the earliest preneoplastic change that can be seen in the colonic mucosa (Pretlow et al., 1991; Pretlow et al., 1992; Takayama et al., 1998). Mice were treated with AOM and one cycle of DSS RESULTS 90 and were killed 2 weeks after the removal of DSS, the time when the second cycle of DSS usually starts in the full AOM/DSS protocol. Analysis of H&E stained colonic sections on revealed more hyperplastic and dysplastic ACFs in p38‐IEC mice (Figure 20). These results are in agreement with the higher number of colon tumors developed in p38‐IEC mice after the full AOM/DSS protocol. Figure 20. p38deficiency in IEC increases susceptibility to AOM and one cycle of DSS. Representative H&E‐stained colon sections from WT and p38‐IEC mice that were treated with AOM and 2% DSS for 5 days and analyzed after 2 weeks of DSS termination. Numbers of microscopic lesions were quantified. Data represent means ± SEM (n ≥4). p38 regulates intestinal homeostasis Altered epithelial barrier function has been associated with IBD and intestinal inflammation in humans (Westbrook et al., 2010). Since p38‐IEC mice show more body weight loss, epithelial damage, inflammation and infiltration after DSS induced acute colitis in comparison to their WT littermates, we hypothesized that p38‐IEC mice could have altered intestinal homeostasis. As in other epithelial tissues, intestinal homeostasis is the result of a fine balance between cell proliferation and differentiation. We analyzed the effect of p38 downregulation in IEC proliferation and differentiation. In agreement with a recent report (Otsuka et al., 2010), we found that p38 downregulation in IECs had no effect on gross morphology of the H&E stained colon tissue. However, p38‐IEC mice had more Ki67+ proliferative cells in the distal colon than the WT littermates (Figure 21A). We analyzed the two main types of differentiated cells in the colon by RESULTS 91IHC and found significantly less chromogranin A+ (ChgA+) enteroendocrine cells in p38‐IEC mice compared to WT littermates, while the number of periodic acid schiff+ (PAS+) goblet cells was also reduced in p38‐IEC mice but did not reach a statistically significant value (Figure 21A). Mucins produced by goblet cells, form a protective mucous layer, which serves as a first barrier to pathogens and chemically induced injury. Figure 21. Downregulation of p38 in IECs affects intestinal homeostasis. (A) Colon sections from WT and p38‐IEC mice were stained with H&E, Ki67 antibody for proliferation, Periodic acid‐Schiff (PAS) reagent for goblet cells and Chromogranin A (ChgA) antibody for enteroendocrine cells. Quantifications were performed by counting more than 100 correctly‐oriented crypts from a minimum of 5 distal colon fields. Data are means ± SEM (n = 4) ∗, p<0.05. (B) Relative mRNA expression levels for the indicated genes in the distal colon of non‐treated WT and p38‐IEC mice was determined by qRT‐PCR and normalized to GAPDH mRNA. Data are means ± SEM (n = 4) ∗, p<0.05 RESULTS 92 Analysis of the expression of genes involved in cell proliferation showed that Ki67 and cyclin D1 mRNA levels were significantly higher in p38‐IEC mice, while the expression of mRNAs related to goblet cell differentiation, such as Mucin 2(MUC2) and Trefoil factor 3 (TFF3), or the enteroendocrine‐specific gene ChgA was significantly lower in p38‐IEC mice (Figure 21B). These results indicate that p38signaling can regulate both proliferation and differentiation of IECs. Increased intestinal permeability in p38‐IEC mice We also investigated the effect of p38 downregulation on the intestinal permeability. Using FITC‐dextran, we found that in vivo intestinal permeability was notably increased in p38‐IEC mice compared to WT mice (Figure 22A). We then analyzed the morphology of epithelial tight junctions by electron microscopy. Tight junctions are intercellular junctional complexes that regulate the paracellular permeability and are important for integrity of the epithelial barrier. On ultrathin sections analyzed by electron microscopy, each tight junction contain a series of apparent fusions called kissing points where the intercellular space is completely obliterated (Tsukita et al., 2001). We found that epithelial tight junctions in colon from p38‐IEC mice were morphologically disrupted and had fewer kissing points compared to tight junctions in colon from WT mice (Figure 22B, arrowheads). ZO‐1 is a key component of tight junctions, which helps other proteins like claudins and occludin to assemble at tight junction. Expression of ZO‐1 was reduced in p38‐IEC mice, while expression of Claudin‐1 and occludin did not seem to be significantly changed in p38‐IEC mice compared to WT mice (Figure 22C and 22D). Taken together, the altered intestinal homeostasis and epithelial barrier function observed in p38‐IEC mice probably account for their enhanced susceptibility to DSS‐induced colitis and epithelial damage as well as to CAC. RESULTS 93 Figure 22. Downregulation of p38 in IECs affects intestinal permeability and tight junctions. (A) Intestinal permeability was measured by determining the concentration in blood serum of FITC‐dextran that was orally administered to mice. Data are means ± SEM (n = 4). (B) Representative electron microscope images showing tight‐junctions in colon epithelia from WT and p38‐IEC mice. At least 25 tight junctions were analyzed. Histogram shows the quantification of the number of kissing points per tight junction. Data are means ± SEM. (C) Whole colon lysates were prepared from WT and p38‐IEC mice and were analyzed by western blotting with the indicated antibodies. (D) Relative mRNA expression levels of the indicated genes in the colon of WT and p38‐IEC mice were determined by qRT‐PCR and normalized to GAPDH mRNA. Data are means ± SEM (n = 4) ∗, p<0.05 Inducible downregulation of p38 in IECs sensitizes to AOM/DSS induced colon tumorigenesis p38 chemical inhibitors have been reported to inhibit proliferation in some human cancer cell lines (Wagner and Nebreda, 2009). However, our genetic analyses in RESULTS 94 mice indicate that p38 suppresses colon tumor formation. To clarify the role of p38 in colon tumorigenesis, we generated a mouse line with Villin‐CreERT2 and p38‐lox alleles where p38 can be downregulated in IECs by 4‐hydroxy tamoxifen (4‐OHT) administration. We confirmed that treatment with 4‐OHT downregulated p38 in colon but not in other tissues of p38‐lox/Villin‐CreERT2 mice (Figure 23A). Figure 23 Inducible downregulation of p38 in IECs increases AOM/DSS‐induced colorectal tumorigenesis. (A) Colon, liver, lung and spleen lysates from 4OHT‐treated mice were analyzed by Western blotting with the indicated antibodies. Lysates from 2 different mice were individually analyzed in each case (one per lane). (B) Schematic representation of the AOM/DSS protocol used to induce colorectal tumors in p38IEC‐ERT2 mice. (C) Average tumor number, tumor size and tumor load in WT and p38IEC‐ERT2 mice at the end of the AOM/DSS protocol. (D) Body weight loss induced by 2% DSS administered in drinking water to WT and p38IEC‐ERT2 mice. Data represent means ± SEM (n ≥ 7). ∗, p<0.05. RESULTS 95Next, we used these mice to confirm our previous results using constitutive Villin‐Cre, by inducing p38 downregulation before the AOM/DSS treatment (Figure 23B). We found that 4‐OHT‐treated p38‐lox/Villin‐CreERT2 mice (p38‐IEC‐ERT2) developed more tumors compared to WT mice, but the average tumor size was similar (Figure 23C). Moreover, p38‐IEC‐ERT2 mice lost significantly more body weight than WT mice, after 5 days of DSS treatment, as in the case of p38‐IEC mice (Figure 23D). Downregulation of p38 in tumor epithelial cells reduces tumor burden Our genetic analysis showed that p38 downregulation in non‐transformed IECs negatively regulates proliferation and suppresses tumor initiation. To investigate the effect of p38 in the transformed IECs, mice with p38‐lox or p38‐lox/Villin‐CreERT2 alleles were subjected to the AOM/DSS protocol and 65 days after the AOM injection, the presence of colon tumors was confirmed by sacrificing a few animals. Then, p38 deletion was induced by 5 consecutive intraperitoneal injections of 4‐OHT. Control mice were also injected with 4‐OHT. 20 days after the last 4‐OHT injection, mice were sacrificed and colon samples were harvested for tumor analysis (Figure 24A). Interestingly, a significant reduction in the number of macroscopic tumors was observed in p38‐IEC‐ERT2 mice compared to the control mice that express p38 (Figure 24B). Average tumor size and tumor load were also significantly reduced upon p38downregulation in tumor epithelial cells (Figure 24C). When we analyzed tumor size distribution, we found a small difference in the number of tumors smaller than 2 mm. However, there were significantly fewer tumors of less than 4 mm in the mice where p38 was downregulated than in WT controls. Importantly, we could not detect any tumors bigger than 4 mm in p38‐IEC‐ERT2 mice (Figure 24C). RESULTS 96 Figure 24. Downregulation of p38 in colon tumor cells reduces tumor burden (A) Schematic representation of the protocol used to downregulate p38 in AOM/DSS‐induced colon tumors. (B) Representative images of colons from WT and p38IEC‐ERT2 mice showing tumors in the distal/middle region. (C) Average tumor number, tumor size, tumor load and tumor size distribution in WT and p38IEC‐ERT2 mice at the end of the AOM/DSS treatment. Data represent means ± SEM (n = 8). ∗, p<0.05. These results indicate a pro‐tumorigenic role for p38 signaling in transformed colon epithelia cells, which is important for tumor maintenance. RESULTS 97Downregulation of p38 reduces proliferation and increases apoptosis in colon tumor cells To determine the molecular basis for the reduced tumor burden in p38‐IEC‐ERT2 mice, we performed IHC analysis. Microscopic analysis of tumor sections stained with H&E showed smaller tumors in p38‐IEC‐ERT2 mice compared to WT mice (Figure 25A). In order to check if p38 was efficiently downregulated in tumors, we performed IHC and western blot analysis. We confirmed downregulation of p38 in colon tumors and the adjacent normal epithelia by IHC as well as by western blotting in the lysates of tumors from p38‐IEC‐ERT2 mice (Figure 25B and 25C). Figure 25. Downregulation of p38 in colon tumors upon 4‐OHT treatment. (A) Sections of colon tumors from WT and p38IEC‐ERT2 mice were stained with H&E. Bars are 200 m. (B) Sections of colon tumors and adjacent normal epithelia from WT and p38IEC‐ERT2 mice were stained with p38 antibody. Bars are 50 m. (C) Tumor lysates from WT and p38IEC‐ERT2 mice were analyzed by western blotting with p38 antibody. Typically 2 to 4 tumors were pooled from a given mouse and individually analyzed. In the right panel quantification of p38 in tumor lysates is shown. Data represent means ± SEM (n = 6). ∗, p<0.05. RESULTS 98 Next, we analyzed the levels of proliferation and apoptosis in colon tumors from WT and p38‐IEC‐ERT2 mice, by staining with anti‐Ki67 and anti‐Cleaved Caspase 3 antibodies. Quantification of Ki67+ cells revealed significantly reduced cell proliferation in the tumors from p38‐IEC‐ERT2 mice compared to WT controls, whereas Cleaved Caspase‐3+ apoptotic cells were more abundant in the tumors from p38‐IEC‐ERT2 mice (Figure 26A and 26B). We confirmed these findings by western blotting using anti‐PCNA antibody as a proliferative marker and anti‐total Caspase 3 antibody as an apoptotic marker Expression of PCNA was reduced in tumors from p38‐IEC‐ERT2 mice, whereas total Caspase 3 levels were also reduced, suggesting increase in Cleaved Caspase 3 activity, in p38‐IEC‐ERT2 mice (Figure 26C). Figure 26. Downregulation of p38 in colon tumors reduces proliferation and increases apoptosis. (A) and (B) Sections of colon tumors from WT and p38IEC‐ERT2 mice were stained with antibodies against cleaved Caspase 3 and Ki67. Bars are 50 m. Average number of apoptotic cells (Cleaved caspase 3+) and proliferative cells (Ki67+) cells per field at the end of the AOM/DSS protocol. Data represent means ± SEM (n = 8). ∗, p<0.05. RESULTS 99(C) Colon lysates from WT and p38IEC‐ERT2 mice were analyzed by western blotting with the indicated antibodies. Colon lysates from 3 different mice were individually analyzed in each case (one per lane). We also analyzed macrophage infiltration in the tumors from both groups of mice. Quantification of F4/80+ macrophages revealed no significant difference in tumors from WT and p38‐IEC‐ERT2 mice (Figure 27A). Consistent with the importance of pro‐inflammatory cytokines and chemokines such as IL‐6, IL23, CXCL‐1 and CXCL‐2 for tumor growth (Grivennikov et al., 2009; Grivennikov et al., 2012; Jamieson et al., 2012), we also found reduced expression of these mediators in the tumors of p38‐IEC‐ERT2 mice (Figure 27B). Figure 27. Inflammatory mediators in the tumors of WT and p38IEC‐ERT2 mice. (A) Sections of colon tumors from WT and p38‐IEC‐ERT2 mice were stained with F4/80 antibody to identify macrophages. RESULTS 100 (B) Relative mRNA expression levels for the indicated genes were determined by real‐time qPCR and were normalized to GAPDH. Data are means ± SEM (n = 4). Next we studied the effect of p38 downregulation on key signaling pathways, and found that the reduced proliferation and increased apoptosis observed in p38‐IEC‐ERT2 mice correlated with enhanced levels of phospho‐JNK and reduced levels of phospho‐STAT3. In contrast, the pro‐survival pathways ERK1/2 and AKT did not seem to be affected by p38 downregulation in colon cancer cells (Figure 28). Figure 28. Signaling pathways affected by downregulation of p38 in colon tumor cells. Colon lysates from WT and p38IEC‐ERT2 mice were analyzed by western blotting with the indicated antibodies. Colon lysates from 3 different mice were individually analyzed in each case (one per lane). Systemic inhibition of p38 reduces colon tumor burden To follow up on the above findings, we investigated the effect of chemical inhibition of p38 MAPK signaling on colon tumors. We used PH797804, a novel compound that can inhibit p38 with IC50 of 26 nM and that is being used in clinical trials for Chronic Obstractive Pulmomary Disease (COPD) and Rheumatoid Arthritis (RA) (Goldstein et al., 2010). For this experiment, colon tumors were induced using the standard AOM/DSS protocol and, after confirming that tumors were formed, mice were separated in two groups. Half of the mice received PH797804 during 12 days (from day 68‐80 after AOM injection), and the other half received vehicle. All the RESULTS 101mice were sacrificed at day 81 (Figure 29A). Importantly, we found that mice treated with the p38 inhibitor had a significantly reduced colon tumor load, reflecting both less tumors and of smaller sizes compared to mice treated with vehicle (Figure 29B). Histological analysis confirmed the inhibition of colon tumorigenesis by administration of PH797804, which also significantly reduced p38 MAPK signaling in the colon tumors and in the adjacent normal epithelia (Figure 29C and 29D). These results confirm our genetic analysis indicating a pro‐tumorigenic role for p38signaling in colon tumor cells. Figure 29. Chemical inhibition of p38 reduces colon tumor burden. (A) Schematic representation of the AOM/DSS protocol used to induce colorectal tumors in C57BL/6 mice and administration of the p38 inhibitor PH797904. (B) Average tumor number, tumor size and tumor load at the end of the AOM/DSS protocol. Data are means ± SEM (n = 7). ∗, p<0.05. (C) Representative images of colon sections stained with H&E or the phospho‐p38 MAPK antibody at the end of the AOM/DSS protocol. (D) Colon lysates from vehicle and PH797804‐treated mice were analyzed by western blotting with the indicated antibodies. RESULTS 102 We also tested the effect of p38 inhibitors in human colon cancer cell lines. We found that incubation of Caco‐2 and SW‐620 cells with three different p38 MAPK inhibitors resulted in enhanced apoptosis (Figure 30). Interestingly, the induction of apoptosis, detected by p85 PARP, correlated with increased levels of phospho‐JNK, as observed upon p38 downregulation in the mouse colon tumors induced by AOM/DSS treatment (Figure 30 and Figure 28). Figure 30. Inhibition of p38 MAPK induces apoptosis. Human colon cancer cell lines SW‐620 and Caco‐2 were treated with the p38 MAPK inhibitors SB203580 (10 M), PH797804 (1 M), or Birb0796 (200 nM) for 4 days and then cell lysates were analyzed by western blotting with the indicated antibodies. Taking together our results indicate that signaling by p38 in transformed epithelial cells contributes to colon tumorigenesis, in contrast with the tumor suppressor role of this pathway in normal colon epithelial cells. Downregulation of p38 in myeloid cells In order to study the role of myeloid cells (macrophages and neutrophils) in colitis and CAC, mice lacking p38 in myeloid cells (p38‐MC) were generated by crossing p38 (lox/lox) mice with LysM‐Cre mice (Clausen et al., 1999), which express Cre recombinase under the control of the promoter for the M lysozyme gene. We confirmed the efficiency of p38 deletion in isolated peritoneal macrophages by western blotting (Figure 31A). We also confirmed the deletion of exon‐2 (floxed) at genomic level in isolated peritoneal macrophages. As a control B‐RESULTS 103cells and IECs did not show any deletion of Exon‐2 of p38 (Figure 31B). This analysis shows the specificity of the LysM‐Cre model in myeloid cells. Mice deficient in p38 in myeloid cells (p38‐MC) appeared to be healthy and had no obvious phenotype. Figure 31. Analysis of p38 downregulation in p38‐MC mice. (A) Western blotting of p38 in lysates prepared from isolated peritoneal macrophages from non‐treated WT and p38‐MC mice. (B) Genomic DNA was isolated from the indicated cell types either from WT or p38‐MC mice and analyzed by qPCR with primer pairs specific for exon 2 and exon 12 of the p38. Relative copy number of exon 2 versus exon 12 is shown. Data are means ± SEM (n = 3) ∗, p<0.05. Downregulation of p38 in myeloid cells does not affect DSS‐induced colitis Since p38 in myeloid cells plays a role in the production of pro‐inflammatory cytokines (Kang et al., 2008; Kim et al., 2008a), we investigated the effect of inhibition of p38 in myeloid cells on DSS‐induced colitis and inflammation. Mice were administered with 2% DSS for 5 days to induce acute colitis and body weight changes were recorded. We found that p38‐MC mice lost body weight similar to their WT control littermates. This observation suggested that p38 inhibition in myeloid cells probably has no effect on the development of DSS‐induced colitis (Figure 32A). RESULTS 104 Figure 32. Downregulation of p38 in myeloid cells does not affect DSS‐induced colitis. (A) Body weight loss induced by 2% DSS in WT and p38‐MC mice. DSS was administered in drinking water and body weight was recorded every other day. Data are means ± SEM (n ≥ 5). (B) Representative H&E‐stained colon sections from WT and p38‐IEC mice that were treated with 2% DSS for 5 days and analyzed at days 6. (C) Quantification of infiltrating immune cells and epithelial damage in H&E‐stained colon sections of mice that were treated with 2% DSS for 5 days and analyzed at day 6. Data represent means ± SEM (n =4). Next we analyzed the immune cell infiltration and epithelial damage caused by DSS administration. Mice were given 2% DSS for 5 days and then sacrificed at day 6 RESULTS 105to perform histological analysis of colon sections (Figure 32B). No significant changes in infiltration and epithelial damage were observed between colon sections from DSS‐treated WT and p38‐MC mice (Figure 32C). Since DSS is directly toxic to the epithelial layer of the colon, these results probably reflect that in both cases colon epithelial cells express p38. p38 in myeloid cells has been reported to be important for the inflammatory reactions in different mouse models. We therefore analyzed the mRNA expression levels of the inflammatory mediator COX‐2 and pro‐inflammatory cytokines such as IL‐6, IL‐1 and TNF‐in the colon of DSS treated mice. To our surprise, we could not detect major differences in the levels of these inflammatory mediators between DSS‐treated WT and p38‐MC mice (Figure 33). Figure 33. Inflammatory mediators in the colon of WT and p38‐MC mice after DSS‐induced colitis. Expression of inflammatory mediators in the distal colon of non‐treated and DSS‐treated WT and p38‐MC mice. Relative mRNA expression levels for the indicated genes were determined by real‐time qPCR and were normalized to GAPDH. Expression levels in non‐treated WT and p38‐IEC mice were the same and were given the value of 1. RESULTS 106 These results indicate that p38 in myeloid cells does not seem to play a major role in DSS‐induced acute inflammation and colitis. Downregulation of p38 in myeloid cells does not affect CAC In order to investigate the role of p38 in myeloid cells in the formation of AOM/DSS‐induced colon tumors, we treated WT and p38‐MC mice with the AOM/DSS protocol. In contrast to p38‐IEC mice, which were more susceptible to AOM/DSS‐induced tumorigenesis compared to WT mice, we did not detect differences in either number or size of colon tumors between p38‐MC mice and WT mice (Figure 34A). Next we histologically analyzed the tumors developed in WT and p38‐MC mice and found tumors from both genotypes were similar in grading (Figure 34B). Consistent with the similar size of the tumors in WT and p38‐MC mice, we also found no significant differences in proliferation and apoptosis within tumors in both cases (Figure 34C and 34D). Also there was no significant difference in the F4/80 positive macrophages within the tumors developed in WT and p38‐MC mice (Figure 34E), indicating that p38 expression in myeloid cells might not be important for the recruitment of macrophages to colon tumors. Taking together, these results indicate that p38 in myeloid cells does not seem to play a major role neither in AOM/DSS‐induced colon tumorigenesis nor in DSS‐induced acute inflammation and colitis. RESULTS 107 Figure 34. Downregulation of p38 in myeloid cells does not affect colorectal tumorigenesis induced by AOM/DSS. (A) Average number and size of tumors formed in WT and p38‐MC mice at the end of the AOM/DSS protocol. Data represent means ± SEM (n = 9). (B) Representative images of H&E stained colon tumors at the end of the AOM/DSS protocol. Tumors were microscopically analyzed and classified into low or high grade (n=4). (C) & (D) Sections of colon tumors from WT and p38MC mice were stained with antibodies against cleaved caspase 3 and Ki67. Average number of apoptotic cells (Cleaved RESULTS 108 casp 3+) and proliferative cells (Ki67+) per field as determined by immunohistochemistry at the end of the AOM/DSS protocol. Data represent means ± SEM (n = 4). (E) Sections of colon tumors from WT and p38MC mice were stained with F4/80 antibody to identify macrophages. 109 Discussion DISCUSSION 111p38 MAPK is activated in response to many extracellular and intracellular signals and plays a vital role in cellular responses such as inflammation, proliferation, survival and differentiation. Accumulating evidence suggests the involvement of p38 in various inflammatory diseases such as asthma, rheumatoid arthritis, brain inflammation and inflammatory bowel disease and also in cancer. But little information is available about the contribution of p38 in colitis and colitis‐associated cancer. In this study, we show in a model of colon tumorigenesis that p38 performs different functions in normal and cancerous epithelial cells without having any major role in myeloid cells. On one side, epithelial p38 suppresses colitis‐associated tumor initiation, whereas downregulation of p38 in myeloid cells has no effect. However, once colon tumors are formed, p38 in epithelial cells promotes tumorigenesis by facilitating proliferation and inhibiting apoptosis in the tumor cells. 1. p38 signaling in normal IECs suppresses CAC We investigated the function of p38 in intestinal epithelial cells using the AOM/DSS model of colorectal tumorigenesis, which generates tumors that resemble human colon tumors both in distribution and at the molecular level (Neufert et al., 2007). Our results indicate that p38 downregulation in IECs enhances colitis‐associated colorectal tumorigenesis. Previous reports have provided evidence for the suppression of tumor formation by p38 in mouse models of lung and liver cancer (Hui et al., 2007; Ventura et al., 2007). In both cases, enhanced tumorigenesis was associated at least in part with increased proliferation, which together with apoptosis evasion are key features in cancer development. However, we found no significant differences in proliferation and apoptosis in the AOM/DSS‐induced tumors of p38‐IEC mice compared to WT animals. Moreover, the tumors formed by p38 deficient epithelial cells were DISCUSSION 112 morphologically and histologically indistinguishable from those formed in WT mice, despite the difference in tumor incidence. These results are consistent with the observation that colon tumor size is not affected by p38 downregulation and indicate that p38 mainly suppresses tumor initiation in IEC treated with the AOM/DSS protocol. Tumors induced by AOM/DSS are highly dependent on the inflammation and epithelial damage caused by DSS. Our results show that mice with p38 downregulation in IECs are more sensitive to DSS‐induced epithelial damage, in line with a recent report (Otsuka et al., 2010). However, in contrast to Otsuka el al; we found enhanced DSS‐induced inflammatory cell infiltration in p38‐IEC mice. The discrepancy could be due to the different mouse background, DSS dose and length of treatment. Different mouse strains show different susceptibility to DSS (Mahler et al., 1998; Stevceva et al., 1999). DSS dosage is also an important factor and we choose 2% DSS because higher DSS concentrations induced significant mortality in our mouse lines. In addition, we show that p38 deficient IECs undergo extensive apoptosis upon DSS exposure which correlates with accumulation of the pro‐apoptotic protein BAK. We have not investigated how accumulation of BAK is regulated by p38 in IECs treated with DSS. However, ionizing radiation has been reported to activate the c‐Src‐Rac1‐p38 MAPK pathway, which attenuates BAK accumulation and cell death (Kim et al., 2008b). Epithelial apoptosis is one of mechanisms by which DSS exposure can lead to development of inflammation and colitis in various experimental mouse models. For example, deficiency of NEMO (nuclear factor kappa B (NFB) essential modulator) in IECs results in chronic colitis due to excessive apoptosis within the epithelium (Nenci et al., 2007). Similarly, mice with specific deletion of Stat‐3 in IECs are highly sensitive to DSS‐induced colitis due to increased apoptosis (Bollrath et al., 2009; Pickert et al., 2009). Taking together, these DISCUSSION 113results provide evidence that excessive apoptosis in the colon epithelial cells may lead to the pathogenesis of IBD. In line with this hypothesis, there are reports showing increased apoptosis in colonic biopsies taken from IBD patients (Di Sabatino et al., 2003; Hagiwara et al., 2002; Iwamoto et al., 1996). Enhanced epithelial damage and inflammation in p38‐IEC mice also correlated with increased levels of pro‐inflammatory mediators COX‐2 and IL‐6. These results were surprising because both COX‐2 and IL‐6 have been described to be positively regulated by p38 (reviewed in (Wagner and Nebreda, 2009)). The increase of IL‐6 and COX‐2 levels in colon of DSS treated p38‐IEC mice is probably the result of both more infiltrating inflammatory cells and damaged epithelial cells. It has been described that in response to DEN‐induced damage, p38‐deficient hepatocytes that are dying release IL‐1, which leads to induction of IL‐6 and compensatory proliferation of hepatocytes resulting in hepatocellular carcinoma development (Sakurai et al., 2008). Similar to this, we show increased mRNA expression of IL‐1 and IL‐6 in p38‐deficient epithelial cells from DSS‐treated mice. Both COX‐2 and IL‐6 are important for the development of colitis and CAC. COX‐2 levels are elevated in patients with IBD (Singer et al., 1998). IL‐6 is a critical cytokine for colorectal tumorigenesis, which regulates the survival and proliferation of IECs, and its pro‐tumorigenic functions strongly relay on the activation of the transcription factor STAT3 (Becker et al., 2004; Bollrath et al., 2009; Grivennikov et al., 2009). NFB is rapidly activated during acute inflammation, and sustained activation of this pathway can contribute to tumor development by inducing expression of inflammatory mediators and growth factors. Genetic inactivation of the NFkB pathway activator IKK reduces tumor burden after AOM/DSS treatment by reducing expression of cytokines and growth factors (Greten et al., 2004; Karin, 2006). Consistent with these results, the activities of both STAT3 and NFB pathways are increased in p38‐IEC mice after DSS‐induced colitis. DISCUSSION 114 We also show that enhanced epithelial injury in p38‐IEC mice correlates with increased IEC proliferation during the recovery phase. This probably represents compensatory proliferation similar to what has been described in p38‐deficient hepatocytes of mice treated with the DEN carcinogen (Sakurai et al., 2008). The idea that tissue injury can contribute to cancer was hypothesized by Rudolf Virchow in 1863 (Balkwill and Mantovani, 2001; Mantovani et al., 2008). Recently, inflammation has been also proposed to play a role in injury‐induced tumor development. Inflammation caused by tissue injury orchestrates wound healing and tissue regeneration, but when it cannot be properly resolved or it is propagated chronically by repetitive injury, may result in tumor promotion by uncontrolled wound healing process (Kuraishy et al., 2011). In line with this hypothesis, our results show that repetitive DSS‐induced epithelial injury triggers the hyperproliferation of p38‐deficient IECs and induces colon tumor formation in the absence of AOM. These results identify p38 as a key regulator of the wound healing process, which impinges on tissue injury‐induced colon tumor development. Our results are in agreement with recent work showing that mice deficient for ASK1, a MAP3K that can activate several MAPKs including p38, show enhanced DSS‐induced epithelial injury and inflammation, and are more susceptible to AOM/DSS‐induced colon tumorigenesis (Hayakawa et al., 2010). However, the effect of DSS alone on tumor formation was not evaluated in this study. DSS treatment has been reported to induce oxidative stress (Trivedi and Jena, 2012), and oxidative stress can activate ASK1‐p38signaling, which in turn negatively regulates malignant cell transformation by preventing the accumulation of oxidative stress (Dolado et al., 2007). Taking together, ASK1 may play a role upstream of p38 in the response of IECs to DSS‐induced damage. Thus, oxidative stress that accumulates in absence of p38 could cooperate with increased compensatory proliferation to induce IEC transformation. DISCUSSION 115In summary, we have identified p38 as a negative regulator of CAC by controlling the apoptosis, inflammation and regeneration of the damaged colon epithelial cells. 2. p38 regulates colon epithelial cells homeostasis The enhanced epithelial damage and inflammation induced by DSS in p38‐IEC mice indicate that p38 is important for maintaining homeostasis and integrity of the colon epithelia. Of particular importance is the reduced number of mucus‐producing goblet cells and more proliferative cells, which we and others (Otsuka et al., 2010) have consistently observed in p38‐IEC mice. It has been recently shown that the p38 MAPK inhibitor SB202190 facilitates the growth of human colonic organoids in cultures, and removal of SB202190 was required to differentiate organoids into goblet and enteroendocrine cells (Sato et al., 2011). The effect of p38 may be mediated by its ability to regulate differentiation related genes like Schlafen‐3 and Cdx‐2 (Houde et al., 2001; Yuan et al., 2010). Mucins produced by goblet cells form a protective mucous layer, which serves as a first barrier to luminal pathogens or chemical injury. Accordingly, Muc2 knockout mice have been reported to spontaneously develop colitis and intestinal tumors (Van der Sluis et al., 2006). Despite decreased Muc2 expression in mice deficient for p38 in IEC, these mice do not develop spontaneous colitis, which may be due to insufficient reduction of Muc2 in these mice. Of note, differences in developing spontaneous colitis was very mild when compared Muc2 heterozygous mice WT mice which was more evident after DSS challenge (Van der Sluis et al., 2006), similar to p38‐IEC mice. These observations reflect that decreased Muc2 expression levels are likely to facilitate DSS‐induced epithelial damage and tumorigenesis in the colon of p38‐IEC mice. It is possible that differences in genetic background might also contribute to the susceptibility of p38‐IEC mice to develop spontaneous colitis. For example, the severity of spontaneous inflammatory phenotype in IL‐10 knockout mice has been reported to be genetic DISCUSSION 116 background and husbandry conditions dependent (Buchler et al., 2012; Kuhn et al., 1993). It would be interesting to see if p38‐IEC mice can develop spontaneous inflammation and colitis in non‐SPF animal facilities or in different genetic backgrounds. Consistent with the expected importance of epithelial integrity in damage protection, IBD patients show altered paracellular permeability and tight junction functions (Das et al., 2012; Peeters et al., 1997; Schmitz et al., 1999; Westbrook et al., 2010). Mice lacking the tight junction protein JAM‐A also show increased intestinal permeability and are more susceptible to DSS‐induced colitis (Laukoetter et al., 2007). We have found that p38‐IEC mice show enhanced intestinal permeability, which correlates with disrupted tight junctions and reduced expression of ZO‐1, an important regulator of tight junction assembly (McNeil et al., 2006). The requirement of p38 signaling to maintain epithelial homeostasis and paracellular permeability, suggest that p38 activation in IECs may provide new therapeutic opportunities for the IBD patients. Interestingly, VSL#3 probiotics can partially prevent the increased colonic permeability induced by DSS in rats, which correlates with improved expression of ZO‐1 and with p38 MAPK activation (Dai et al., 2012). As probiotics mixtures can partially rescue the increased intestinal permeability, it would be interesting to use them to try to rescue some of the phenotypes associated with DSS‐induced colitis such as increased apoptosis and inflammation in p38‐IEC mice. In summary, our results indicate that the regulation of intestinal homeostasis by p38 may be critical to protect against colitis‐induced colon epithelial damage and the initiation of colon tumorigenesis. DISCUSSION 1173. p38signaling in transformed IECs supports colorectal tumorigenesis Experiments using genetically modified mice, including this study, as well as cell culture models have provided good evidence for tumor suppressor functions of p38. On the other hand, there is evidence suggesting that p38 might facilitate the proliferation and survival of established human cancer cell lines (reviewed by (Wagner and Nebreda, 2009)). However, these studies are mainly based on the use of p38 MAPK chemical inhibitors, SB203580 and SB202190, which are known to have some off target effects (Bain et al., 2007; Fabian et al., 2005). Of particular interest, SB202190 has been reported to induce autophagy in colorectal and ovarian cancer cells (Chiacchiera et al., 2009; Comes et al., 2007; Matrone et al., 2010). However, it has been described that induction of autophagic vacuoles by SB202190 is due to non‐specific effect of this chemical compound rather that to the inhibition of p38MAPK signaling (Menon et al., 2011). Nevertheless, many cell culture based studies suggest possible pro‐tumorigenic effects of p38 signaling. Here we provide genetic and pharmacological evidence that supports the implication of p38 in colon tumor development. We show that genetic inactivation of p38 in transformed IECs reduces tumor burden, which correlates with enhanced apoptosis and impaired cell proliferation. We also showed similar results using a new potent p38 inhibitor, PH797804, which is currently under phase II clinical trials for several inflammatory diseases (Goldstein et al., 2010; Hope et al., 2009). We found that p38 downregulation in colon tumor cells impairs the phosphorylation of STAT3, which is an important regulator of colon tumor cell survival and proliferation (Bollrath et al., 2009; Grivennikov et al., 2009). Accordingly, we also found that downregulated expression of IL‐6 family cytokines in the p38 depleted colon tumors. Therefore, autocrine mechanisms, such as production of IL‐6, could account for the observed link between p38 DISCUSSION 118 activity and STAT3 phosphorylation, although we cannot rule out that p38 might also regulate intracellular signaling pathways leading to STAT3 phosphorylation in tumor cells, as described for head and neck cancer cell lines (Riebe et al., 2011). We also found that p38 inactivation in colon tumor cells induces JNK upregulation and there is good evidence that p38 can negatively regulate JNK signaling by several mechanisms (Wagner and Nebreda, 2009). Interestingly, sustained activation of JNK has been linked to the induction of apoptosis (Dhanasekaran and Reddy, 2008; Ventura et al., 2006), and can suppress Ras‐induced tumor formation (Kennedy et al., 2003). JNK can also interact with ‐catenin and can negatively regulate ‐catenin signaling in vivo and in vitro (Hu et al., 2008). Moreover, JNK activity is crucial for the induction of apoptosis by various stimuli in several colon cancer lines (Collett and Campbell, 2004; El Fajoui et al., 2011; Sunayama et al., 2005; Zhang et al., 2010). Taken together, it seems likely that the induction of STAT3 phosphorylation together with downregulation of JNK signaling contribute to the pro‐tumorigenic role of p38 in colon cancer cells. Of note, similar results have been described for the MAP3K ASK1 whose genetic ablation in mice enhances susceptibility to DSS‐induce colitis and CAC (Hayakawa et al., 2010). In contrast, ASK1 downregulation causes growth arrest and cell death in human colon cancer lines (Kuwamura et al., 2007). Therefore, ASK1 may play a role upstream of p38 in response to DSS. Interestingly, the PRAK/MK5 kinase, which can be activated downstream of p38 signaling, has been reported to have dual functions in skin carcinogenesis: a tumor suppressor function in epithelial cells during initiation and a pro‐tumorigenic role in endothelial cells during the progression stage (Sun et al., 2007; Yoshizuka et al., 2012). Our in vivo genetic inactivation experiments indicate that p38 signaling plays different roles in a cell autonomous manner but depending on the transformation stage of the IECs. It DISCUSSION 119remains to be determined how p38 signaling in other cell types might contribute to colorectal tumorigenesis. During malignant transformation, cells probably experience a wide variety of stresses becoming dependent not only on the oncogenes that initiate the transformation process but also on a number of stress managing pathways that would be required for survival and/or proliferation, what has been termed non‐oncogene addiction (Luo et al., 2009). Our results indicate that p38 signaling may be important for the maintenance of colon tumors by functioning as a non‐oncogenic addictive pathway in colon cancer cells. Targeting this pathway may provide new therapeutic opportunities for treatment of colorectal tumors. Taking together, our study identifies a novel mechanism by which p38 signaling may interfere with colon tumor initiation by maintaining epithelial homeostasis and regulating inflammatory responses. In addition, we show that the p38 pathway has a completely different function once the colon tumors are formed and contributes to tumor maintenance. Thus, p38 has opposite roles in non‐transformed and tumorigenic epithelial cells. These results support the importance of p38 for colon tumor maintenance and its potential interest as a therapeutic target. 4. Role of p38 in myeloid cells during DSS‐induced colitis and CAC Since p38 signaling is known to regulate inflammatory responses both in vitro and in vivo, we investigated if p38 in macrophages regulates DSS‐induced colitis and CAC. In contrast to the study by Otsuka et al, our results show that myeloid cell‐specific inhibition of p38 signaling does not protect against DSS‐induced colitis. mRNA expression analysis of pro‐inflammatory mediators also failed to reveal any considerable differences in the colon of DSS‐treated WT and p38‐MC mice. Both studies were performed on mice with different genetic backgrounds DISCUSSION 120 and the time and length of the DSS treatment were also different. This may be one of reasons for the observed discrepancies as DSS has different susceptibility on different genetic background (Mahler et al., 1998; Stevceva et al., 1999). We choose 2% DSS based on our experiments with p38‐IEC mice, where 2% DSS was sufficient to elicit differences between WT and p38‐IEC mice. Similar controversial results were published on the role of p38 in myeloid cells during atherosclerosis pathogenesis, a chronic inflammatory disease and a major cause of cardiovascular mortality (Kardakaris et al., 2011; Seimon et al., 2009). Results from these studies suggest that subtle changes in p38 activity due to experimental conditions may be responsible for different outcomes. Our studies also show that p38 in myeloid cells does not affect CAC. This is consistent with the absence of differences in intestinal inflammation and injury between WT and p38‐MC mice during the DSS treatment. Taken together, our results indicate that myeloid cell specific inhibition of p38 signaling does not protect against DSS‐induced colitis and CAC. 5. p38 as a potential therapeutic target for colon cancer? p38 signaling pathway has been shown to contribute to several processes, which are considered as `hallmarks of cancer´. The majority of the cell culture experiments and the experiments in mice have provided evidence that p38 acts as a tumor suppressor, mainly due to its ability to negatively regulate proliferation and to induce cell death. Noteworthy, all the in vivo studies to illustrate the tumor suppressor function of p38 have been performed during the initiation and early transformation process. In contrast, few reports suggest oncogenic functions of p38. In addition to oncogenic function of p38, it has been shown that inhibition of p38 in combination with DNA damaging anti‐cancer drugs could increase the apoptotic effect (Thornton and Rincon, 2009). Moreover, increased phosphorylation of p38 has been detected in many human cancers (Wagner and DISCUSSION 121Nebreda, 2009). It is worth mentioning that tumors are often detected in patients when they are in advance stage. In this study we show that epithelial p38 signaling can exert opposite functions depending on the transformation stage. Based on our results, it seems that p38 signaling may be one of the non‐oncogenic addiction pathways which is required for the survival and proliferation of cancer cells. Thus targeting this pathway alone or in combination with chemotherapeutic agents may provide new therapeutic opportunities for the treatment of cancer. In line with this hypothesis, we show that pharmacological inhibition of p38 reduces colon tumor burden. Another study from our lab suggests that p38 inhibition can have an additive effect with cisplatin, a widely used anti‐tumor drug, in a mouse model of breast cancer (Pereira, L., PhD thesis work). Thus p38 should be considered as a target for future cancer therapies. Further studies should be aimed at better defining the role of p38 in advance tumoral stages. Genetically modified mouse models with the ability to modulate p38 activity in a time and tissue dependent manner should prove useful. 123 Conclusions CONCLUSIONS 1251. p38 regulates homeostasis and maintains the barrier function in intestinal epithelial cells. 2. In response to colitis, p38 controls epithelial cell damage and inflammation. 3. p38negatively regulates colitis‐associated tumor initiation in colon epithelial cells. 4. p38 is required for the proliferation and survival of colon tumor cells. 5. p38 in myeloid cells does not seem to have a major role in colitis and colitis‐associated colon cancer. 6. p38 should be considered as a potential therapeutic target in colon cancer. 127 Bibliography BIBLIOGRAPHY 129(2001). Common Stock Solutions, Buffers, and Media. In Current Protocols in Cell Biology, (John Wiley & Sons, Inc.). http://onlinelibrary.wiley.com/doi/10.1002/0471143030.cba02as00/abstract. Adams, R. H., Porras, A., Alonso, G., Jones, M., Vintersten, K., Panelli, S., Valladares, A., Perez, L., Klein, R., and Nebreda, A. R. (2000). Essential role of p38alpha MAP kinase in placental but not embryonic cardiovascular development. Mol Cell 6, 109‐116. Al Rashid, S. T., Dellaire, G., Cuddihy, A., Jalali, F., Vaid, M., Coackley, C., Folkard, M., Xu, Y., Chen, B. P., Chen, D. J., et al. (2005). Evidence for the direct binding of phosphorylated p53 to sites of DNA breaks in vivo. Cancer Res 65, 10810‐10821. Allen, M., Svensson, L., Roach, M., Hambor, J., McNeish, J., and Gabel, C. A. (2000). Deficiency of the stress kinase p38alpha results in embryonic lethality: characterization of the kinase dependence of stress responses of enzyme‐deficient embryonic stem cells. J Exp Med 191, 859‐870. Arthur, J. S. (2008). MSK activation and physiological roles. Front Biosci 13, 5866‐5879. Aust, D. E., Terdiman, J. P., Willenbucher, R. F., Chang, C. G., Molinaro‐Clark, A., Baretton, G. B., Loehrs, U., and Waldman, F. M. (2002). The APC/beta‐catenin pathway in ulcerative colitis‐related colorectal carcinomas: a mutational analysis. Cancer 94, 1421‐1427. Bain, J., Plater, L., Elliott, M., Shpiro, N., Hastie, C. J., McLauchlan, H., Klevernic, I., Arthur, J. S., Alessi, D. R., and Cohen, P. (2007). The selectivity of protein kinase inhibitors: a further update. Biochem J 408, 297‐315. Balkwill, F., and Mantovani, A. (2001). Inflammation and cancer: back to Virchow? Lancet 357, 539‐545. Beardmore, V. A., Hinton, H. J., Eftychi, C., Apostolaki, M., Armaka, M., Darragh, J., McIlrath, J., Carr, J. M., Armit, L. J., Clacher, C., et al. (2005). Generation and characterization of p38beta (MAPK11) gene‐targeted mice. Mol Cell Biol 25, 10454‐10464. Becker, C., Fantini, M. C., Schramm, C., Lehr, H. A., Wirtz, S., Nikolaev, A., Burg, J., Strand, S., Kiesslich, R., Huber, S., et al. (2004). TGF‐beta suppresses tumor progression in colon cancer by inhibition of IL‐6 trans‐signaling. Immunity 21, 491‐501. Becker, C., Fantini, M. C., Wirtz, S., Nikolaev, A., Kiesslich, R., Lehr, H. A., Galle, P. R., and Neurath, M. F. (2005). In vivo imaging of colitis and colon cancer development in mice using high resolution chromoendoscopy. Gut 54, 950‐954. Bensaad, K., and Vousden, K. H. (2005). Savior and slayer: the two faces of p53. Nat Med 11, 1278‐1279. Bissahoyo, A., Pearsall, R. S., Hanlon, K., Amann, V., Hicks, D., Godfrey, V. L., and Threadgill, D. W. (2005). Azoxymethane is a genetic background‐dependent colorectal tumor initiator and promoter in mice: effects of dose, route, and diet. Toxicol Sci 88, 340‐345. BIOBIOGRAPHY 130 Bogoyevitch, M. A., and Court, N. W. (2004). Counting on mitogen‐activated protein kinases‐‐ERKs 3, 4, 5, 6, 7 and 8. Cell Signal 16, 1345‐1354. Boismenu, R., Chen, Y., Chou, K., El‐Sheikh, A., and Buelow, R. (2002). Orally administered RDP58 reduces the severity of dextran sodium sulphate induced colitis. Ann Rheum Dis 61 Suppl 2, ii19‐24. Boivin, G. P., Washington, K., Yang, K., Ward, J. M., Pretlow, T. P., Russell, R., Besselsen, D. G., Godfrey, V. L., Doetschman, T., Dove, W. F., et al. (2003). Pathology of mouse models of intestinal cancer: consensus report and recommendations. Gastroenterology 124, 762‐777. Bollrath, J., Phesse, T. J., von Burstin, V. A., Putoczki, T., Bennecke, M., Bateman, T., Nebelsiek, T., Lundgren‐May, T., Canli, O., Schwitalla, S., et al. (2009). gp130‐mediated Stat3 activation in enterocytes regulates cell survival and cell‐cycle progression during colitis‐associated tumorigenesis. Cancer Cell 15, 91‐102. Brancho, D., Tanaka, N., Jaeschke, A., Ventura, J. J., Kelkar, N., Tanaka, Y., Kyuuma, M., Takeshita, T., Flavell, R. A., and Davis, R. J. (2003). Mechanism of p38 MAP kinase activation in vivo. Genes Dev 17, 1969‐1978. Brentnall, T. A., Crispin, D. A., Rabinovitch, P. S., Haggitt, R. C., Rubin, C. E., Stevens, A. C., and Burmer, G. C. (1994). Mutations in the p53 gene: an early marker of neoplastic progression in ulcerative colitis. Gastroenterology 107, 369‐378. Brozovic, A., and Osmak, M. (2007). Activation of mitogen‐activated protein kinases by cisplatin and their role in cisplatin‐resistance. Cancer Lett 251, 1‐16. Buchler, G., Wos‐Oxley, M. L., Smoczek, A., Zschemisch, N. H., Neumann, D., Pieper, D. H., Hedrich, H. J., and Bleich, A. (2012). Strain‐specific colitis susceptibility in IL10‐deficient mice depends on complex gut microbiota‐host interactions. Inflamm Bowel Dis 18, 943‐954. Bulavin, D. V., Amundson, S. A., and Fornace, A. J. (2002). p38 and Chk1 kinases: different conductors for the G(2)/M checkpoint symphony. Curr Opin Genet Dev 12, 92‐97. Bulavin, D. V., and Fornace, A. J., Jr. (2004). p38 MAP kinaseʹs emerging role as a tumor suppressor. Adv Cancer Res 92, 95‐118. Bulavin, D. V., Saito, S., Hollander, M. C., Sakaguchi, K., Anderson, C. W., Appella, E., and Fornace, A. J., Jr. (1999). Phosphorylation of human p53 by p38 kinase coordinates N‐terminal phosphorylation and apoptosis in response to UV radiation. EMBO J 18, 6845‐6854. Burmer, G. C., Rabinovitch, P. S., Haggitt, R. C., Crispin, D. A., Brentnall, T. A., Kolli, V. R., Stevens, A. C., and Rubin, C. E. (1992). Neoplastic progression in ulcerative colitis: histology, DNA content, and loss of a p53 allele. Gastroenterology 103, 1602‐1610. Cappellini, A., Tazzari, P. L., Mantovani, I., Billi, A. M., Tassi, C., Ricci, F., Conte, R., and Martelli, A. M. (2005). Antiapoptotic role of p38 mitogen activated protein kinase in Jurkat T cells and normal human T lymphocytes treated with 8‐methoxypsoralen and ultraviolet‐A radiation. Apoptosis 10, 141‐152. BIOBIOGRAPHY 131Carmeliet, P. (2005). VEGF as a key mediator of angiogenesis in cancer. Oncology 69 Suppl 3, 4‐10. Carter, A. B., Knudtson, K. L., Monick, M. M., and Hunninghake, G. W. (1999). The p38 mitogen‐activated protein kinase is required for NF‐kappaB‐dependent gene expression. The role of TATA‐binding protein (TBP). J Biol Chem 274, 30858‐30863. Carter, A. B., Tephly, L. A., and Hunninghake, G. W. (2001). The absence of activator protein 1‐dependent gene expression in THP‐1 macrophages stimulated with phorbol esters is due to lack of p38 mitogen‐activated protein kinase activation. J Biol Chem 276, 33826‐33832. Casanovas, O., Miro, F., Estanyol, J. M., Itarte, E., Agell, N., and Bachs, O. (2000). Osmotic stress regulates the stability of cyclin D1 in a p38SAPK2‐dependent manner. J Biol Chem 275, 35091‐35097. Chao, A., Thun, M. J., Jacobs, E. J., Henley, S. J., Rodriguez, C., and Calle, E. E. (2000). Cigarette smoking and colorectal cancer mortality in the cancer prevention study II. J Natl Cancer Inst 92, 1888‐1896. Chen, G., Hitomi, M., Han, J., and Stacey, D. W. (2000). The p38 pathway provides negative feedback for Ras proliferative signaling. J Biol Chem 275, 38973‐38980. Chen, H. Y., Zhu, L., Zhan, S. M., Han, Z. W., Du, W., Wang, Y. J., Cui, R. Y., and Wang, C. B. (2005). Polypeptide from Chlamys farreri inhibits murine thymocytes apoptosis and modulates UVB induced signaling pathway activation. Life Sci 77, 768‐779. Chiacchiera, F., Matrone, A., Ferrari, E., Ingravallo, G., Lo Sasso, G., Murzilli, S., Petruzzelli, M., Salvatore, L., Moschetta, A., and Simone, C. (2009). p38alpha blockade inhibits colorectal cancer growth in vivo by inducing a switch from HIF1alpha‐ to FoxO‐dependent transcription. Cell Death Differ 16, 1203‐1214. Chung, D. C. (2000). The genetic basis of colorectal cancer: insights into critical pathways of tumorigenesis. Gastroenterology 119, 854‐865. Clapper, M. L., Cooper, H. S., and Chang, W. C. (2007). Dextran sulfate sodium‐induced colitis‐associated neoplasia: a promising model for the development of chemopreventive interventions. Acta Pharmacol Sin 28, 1450‐1459. Clausen, B. E., Burkhardt, C., Reith, W., Renkawitz, R., and Forster, I. (1999). Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res 8, 265‐277. Cobb, M. H., Hepler, J. E., Cheng, M., and Robbins, D. (1994). The mitogen‐activated protein kinases, ERK1 and ERK2. Semin Cancer Biol 5, 261‐268. Collett, G. P., and Campbell, F. C. (2004). Curcumin induces c‐jun N‐terminal kinase‐dependent apoptosis in HCT116 human colon cancer cells. Carcinogenesis 25, 2183‐2189. BIOBIOGRAPHY 132 Comes, F., Matrone, A., Lastella, P., Nico, B., Susca, F. C., Bagnulo, R., Ingravallo, G., Modica, S., Lo Sasso, G., Moschetta, A., et al. (2007). A novel cell type‐specific role of p38alpha in the control of autophagy and cell death in colorectal cancer cells. Cell Death Differ 14, 693‐702. Cooper, H. S., Murthy, S., Kido, K., Yoshitake, H., and Flanigan, A. (2000). Dysplasia and cancer in the dextran sulfate sodium mouse colitis model. Relevance to colitis‐associated neoplasia in the human: a study of histopathology, B‐catenin and p53 expression and the role of inflammation. Carcinogenesis 21, 757‐768. Cosaceanu, D., Budiu, R. A., Carapancea, M., Castro, J., Lewensohn, R., and Dricu, A. (2007). Ionizing radiation activates IGF‐1R triggering a cytoprotective signaling by interfering with Ku‐DNA binding and by modulating Ku86 expression via a p38 kinase‐dependent mechanism. Oncogene 26, 2423‐2434. Coulombe, P., and Meloche, S. (2007). Atypical mitogen‐activated protein kinases: structure, regulation and functions. Biochim Biophys Acta 1773, 1376‐1387. Coulthard, L. R., White, D. E., Jones, D. L., McDermott, M. F., and Burchill, S. A. (2009). p38(MAPK): stress responses from molecular mechanisms to therapeutics. Trends Mol Med 15, 369‐379. Coussens, L. M., Fingleton, B., and Matrisian, L. M. (2002). Matrix metalloproteinase inhibitors and cancer: trials and tribulations. Science 295, 2387‐2392. Coussens, L. M., and Werb, Z. (2002). Inflammation and cancer. Nature 420, 860‐867. Crump, N., Han, Y., and Mahadevan, L. (2008). Stress‐activated MAP Kinases in Chromatin and Transcriptional Complexes. In Stress‐Activated Protein Kinases, F. Posas, and A. Nebreda, eds. (Springer Berlin Heidelberg), pp. 283‐297. Cuadrado, A., and Nebreda, A. R. (2010). Mechanisms and functions of p38 MAPK signalling. Biochem J 429, 403‐417. Cuenda, A., and Rousseau, S. (2007). p38 MAP‐kinases pathway regulation, function and role in human diseases. Biochim Biophys Acta 1773, 1358‐1375. Cuevas, B. D., Abell, A. N., and Johnson, G. L. (2007). Role of mitogen‐activated protein kinase kinase kinases in signal integration. Oncogene 26, 3159‐3171. Dai, C., Zhao, D. H., and Jiang, M. (2012). VSL#3 probiotics regulate the intestinal epithelial barrier in vivo and in vitro via the p38 and ERK signaling pathways. Int J Mol Med 29, 202‐208. Das, P., Goswami, P., Das, T. K., Nag, T., Sreenivas, V., Ahuja, V., Panda, S. K., Gupta, S. D., and Makharia, G. K. (2012). Comparative tight junction protein expressions in colonic Crohnʹs disease, ulcerative colitis, and tuberculosis: a new perspective. Virchows Arch 460, 261‐270. BIOBIOGRAPHY 133del Barco Barrantes, I., Coya, J. M., Maina, F., Arthur, J. S., and Nebreda, A. R. (2011). Genetic analysis of specific and redundant roles for p38alpha and p38beta MAPKs during mouse development. Proc Natl Acad Sci U S A 108, 12764‐12769. del Barco Barrantes, I., and Nebreda, A. R. (2012). Roles of p38 MAPKs in invasion and metastasis. Biochem Soc Trans 40, 79‐84. Demuth, T., Reavie, L. B., Rennert, J. L., Nakada, M., Nakada, S., Hoelzinger, D. B., Beaudry, C. E., Henrichs, A. N., Anderson, E. M., and Berens, M. E. (2007). MAP‐ing glioma invasion: mitogen‐activated protein kinase kinase 3 and p38 drive glioma invasion and progression and predict patient survival. Mol Cancer Ther 6, 1212‐1222. Dhanasekaran, D. N., and Reddy, E. P. (2008). JNK signaling in apoptosis. Oncogene 27, 6245‐6251. Dhillon, A. S., Hagan, S., Rath, O., and Kolch, W. (2007). MAP kinase signalling pathways in cancer. Oncogene 26, 3279‐3290. Di Sabatino, A., Ciccocioppo, R., Luinetti, O., Ricevuti, L., Morera, R., Cifone, M. G., Solcia, E., and Corazza, G. R. (2003). Increased enterocyte apoptosis in inflamed areas of Crohnʹs disease. Dis Colon Rectum 46, 1498‐1507. Dickinson, S. E., Olson, E. R., Zhang, J., Cooper, S. J., Melton, T., Criswell, P. J., Casanova, A., Dong, Z., Hu, C., Saboda, K., et al. (2011). p38 MAP kinase plays a functional role in UVB‐induced mouse skin carcinogenesis. Mol Carcinog 50, 469‐478. DiDonato, J. A., Mercurio, F., and Karin, M. (2012). NF‐kappaB and the link between inflammation and cancer. Immunol Rev 246, 379‐400. Diehl, N. L., Enslen, H., Fortner, K. A., Merritt, C., Stetson, N., Charland, C., Flavell, R. A., Davis, R. J., and Rincon, M. (2000). Activation of the p38 mitogen‐activated protein kinase pathway arrests cell cycle progression and differentiation of immature thymocytes in vivo. J Exp Med 191, 321‐334. Docena, G., Rovedatti, L., Kruidenier, L., Fanning, A., Leakey, N. A., Knowles, C. H., Lee, K., Shanahan, F., Nally, K., McLean, P. G., et al. (2010). Down‐regulation of p38 mitogen‐activated protein kinase activation and proinflammatory cytokine production by mitogen‐activated protein kinase inhibitors in inflammatory bowel disease. Clin Exp Immunol 162, 108‐115. Dolado, I., and Nebreda, A. (2008). Regulation of Tumorigenesis by p38α MAP Kinase. In Stress‐Activated Protein Kinases, F. Posas, and A. Nebreda, eds. (Springer Berlin Heidelberg), pp. 99‐128. Dolado, I., Swat, A., Ajenjo, N., De Vita, G., Cuadrado, A., and Nebreda, A. R. (2007). p38alpha MAP kinase as a sensor of reactive oxygen species in tumorigenesis. Cancer Cell 11, 191‐205. BIOBIOGRAPHY 134 Doza, Y. N., Cuenda, A., Thomas, G. M., Cohen, P., and Nebreda, A. R. (1995). Activation of the MAP kinase homologue RK requires the phosphorylation of Thr‐180 and Tyr‐182 and both residues are phosphorylated in chemically stressed KB cells. FEBS letters 364, 223‐228. Draht, M. X., Riedl, R. R., Niessen, H., Carvalho, B., Meijer, G. A., Herman, J. G., van Engeland, M., Melotte, V., and Smits, K. M. (2012). Promoter CpG island methylation markers in colorectal cancer: the road ahead. Epigenomics 4, 179‐194. Ekbom, A., Helmick, C., Zack, M., and Adami, H. O. (1990a). Increased risk of large‐bowel cancer in Crohnʹs disease with colonic involvement. Lancet 336, 357‐359. Ekbom, A., Helmick, C., Zack, M., and Adami, H. O. (1990b). Ulcerative colitis and colorectal cancer. A population‐based study. N Engl J Med 323, 1228‐1233. El Fajoui, Z., Toscano, F., Jacquemin, G., Abello, J., Scoazec, J. Y., Micheau, O., and Saurin, J. C. (2011). Oxaliplatin sensitizes human colon cancer cells to TRAIL through JNK‐dependent phosphorylation of Bcl‐xL. Gastroenterology 141, 663‐673. el Marjou, F., Janssen, K. P., Chang, B. H., Li, M., Hindie, V., Chan, L., Louvard, D., Chambon, P., Metzger, D., and Robine, S. (2004). Tissue‐specific and inducible Cre‐mediated recombination in the gut epithelium. Genesis 39, 186‐193. Elenitoba‐Johnson, K. S., Jenson, S. D., Abbott, R. T., Palais, R. A., Bohling, S. D., Lin, Z., Tripp, S., Shami, P. J., Wang, L. Y., Coupland, R. W., et al. (2003). Involvement of multiple signaling pathways in follicular lymphoma transformation: p38‐mitogen‐activated protein kinase as a target for therapy. Proc Natl Acad Sci U S A 100, 7259‐7264. Emerling, B. M., Platanias, L. C., Black, E., Nebreda, A. R., Davis, R. J., and Chandel, N. S. (2005). Mitochondrial reactive oxygen species activation of p38 mitogen‐activated protein kinase is required for hypoxia signaling. Mol Cell Biol 25, 4853‐4862. Engel, F. B., Schebesta, M., Duong, M. T., Lu, G., Ren, S., Madwed, J. B., Jiang, H., Wang, Y., and Keating, M. T. (2005). p38 MAP kinase inhibition enables proliferation of adult mammalian cardiomyocytes. Genes Dev 19, 1175‐1187. Enslen, H., Raingeaud, J., and Davis, R. J. (1998). Selective activation of p38 mitogen‐activated protein (MAP) kinase isoforms by the MAP kinase kinases MKK3 and MKK6. J Biol Chem 273, 1741‐1748. Esteva, F. J., Sahin, A. A., Smith, T. L., Yang, Y., Pusztai, L., Nahta, R., Buchholz, T. A., Buzdar, A. U., Hortobagyi, G. N., and Bacus, S. S. (2004). Prognostic significance of phosphorylated P38 mitogen‐activated protein kinase and HER‐2 expression in lymph node‐positive breast carcinoma. Cancer 100, 499‐506. Eyers, P. A., Craxton, M., Morrice, N., Cohen, P., and Goedert, M. (1998). Conversion of SB 203580‐insensitive MAP kinase family members to drug‐sensitive forms by a single amino‐acid substitution. Chem Biol 5, 321‐328. BIOBIOGRAPHY 135Fabian, M. A., Biggs, W. H., 3rd, Treiber, D. K., Atteridge, C. E., Azimioara, M. D., Benedetti, M. G., Carter, T. A., Ciceri, P., Edeen, P. T., Floyd, M., et al. (2005). A small molecule‐kinase interaction map for clinical kinase inhibitors. Nat Biotechnol 23, 329‐336. Farraye, F. A., Odze, R. D., Eaden, J., and Itzkowitz, S. H. (2010). AGA technical review on the diagnosis and management of colorectal neoplasia in inflammatory bowel disease. Gastroenterology 138, 746‐774. Fassetta, M., DʹAlessandro, L., Coltella, N., Di Renzo, M. F., and Rasola, A. (2006). Hepatocyte growth factor installs a survival platform for colorectal cancer cell invasive growth and overcomes p38 MAPK‐mediated apoptosis. Cell Signal 18, 1967‐1976. Fearon, E. R. (2011). Molecular genetics of colorectal cancer. Annu Rev Pathol 6, 479‐507. Fearon, E. R., and Vogelstein, B. (1990). A genetic model for colorectal tumorigenesis. Cell 61, 759‐767. Finn, G. J., Creaven, B. S., and Egan, D. A. (2004). Daphnetin induced differentiation of human renal carcinoma cells and its mediation by p38 mitogen‐activated protein kinase. Biochem Pharmacol 67, 1779‐1788. Freshney, N. W., Rawlinson, L., Guesdon, F., Jones, E., Cowley, S., Hsuan, J., and Saklatvala, J. (1994). Interleukin‐1 activates a novel protein kinase cascade that results in the phosphorylation of Hsp27. Cell 78, 1039‐1049. Garner, A. P., Weston, C. R., Todd, D. E., Balmanno, K., and Cook, S. J. (2002). Delta MEKK3:ER* activation induces a p38 alpha/beta 2‐dependent cell cycle arrest at the G2 checkpoint. Oncogene 21, 8089‐8104. Gauthier, M. L., Pickering, C. R., Miller, C. J., Fordyce, C. A., Chew, K. L., Berman, H. K., and Tlsty, T. D. (2005). p38 regulates cyclooxygenase‐2 in human mammary epithelial cells and is activated in premalignant tissue. Cancer Res 65, 1792‐1799. Ge, B., Gram, H., Di Padova, F., Huang, B., New, L., Ulevitch, R. J., Luo, Y., and Han, J. (2002). MAPKK‐independent activation of p38alpha mediated by TAB1‐dependent autophosphorylation of p38alpha. Science 295, 1291‐1294. Gillen, C. D., Walmsley, R. S., Prior, P., Andrews, H. A., and Allan, R. N. (1994). Ulcerative colitis and Crohnʹs disease: a comparison of the colorectal cancer risk in extensive colitis. Gut 35, 1590‐1592. Goedert, M., Cuenda, A., Craxton, M., Jakes, R., and Cohen, P. (1997). Activation of the novel stress‐activated protein kinase SAPK4 by cytokines and cellular stresses is mediated by SKK3 (MKK6); comparison of its substrate specificity with that of other SAP kinases. EMBO J 16, 3563‐3571. Goldstein, D. M., Kuglstatter, A., Lou, Y., and Soth, M. J. (2010). Selective p38alpha inhibitors clinically evaluated for the treatment of chronic inflammatory disorders. J Med Chem 53, 2345‐2353. BIOBIOGRAPHY 136 Greenberg, A. K., Basu, S., Hu, J., Yie, T. A., Tchou‐Wong, K. M., Rom, W. N., and Lee, T. C. (2002). Selective p38 activation in human non‐small cell lung cancer. Am J Respir Cell Mol Biol 26, 558‐564. Greten, F. R., Eckmann, L., Greten, T. F., Park, J. M., Li, Z. W., Egan, L. J., Kagnoff, M. F., and Karin, M. (2004). IKKbeta links inflammation and tumorigenesis in a mouse model of colitis‐associated cancer. Cell 118, 285‐296. Grivennikov, S., Karin, E., Terzic, J., Mucida, D., Yu, G. Y., Vallabhapurapu, S., Scheller, J., Rose‐John, S., Cheroutre, H., Eckmann, L., and Karin, M. (2009). IL‐6 and Stat3 are required for survival of intestinal epithelial cells and development of colitis‐associated cancer. Cancer Cell 15, 103‐113. Grivennikov, S. I., and Karin, M. (2010). Inflammation and oncogenesis: a vicious connection. Curr Opin Genet Dev 20, 65‐71. Grivennikov, S. I., Wang, K., Mucida, D., Stewart, C. A., Schnabl, B., Jauch, D., Taniguchi, K., Yu, G. Y., Osterreicher, C. H., Hung, K. E., et al. (2012). Adenoma‐linked barrier defects and microbial products drive IL‐23/IL‐17‐mediated tumour growth. Nature 491, 254‐258. Groden, J., Thliveris, A., Samowitz, W., Carlson, M., Gelbert, L., Albertsen, H., Joslyn, G., Stevens, J., Spirio, L., Robertson, M., and et al. (1991). Identification and characterization of the familial adenomatous polyposis coli gene. Cell 66, 589‐600. Hagiwara, C., Tanaka, M., and Kudo, H. (2002). Increase in colorectal epithelial apoptotic cells in patients with ulcerative colitis ultimately requiring surgery. J Gastroenterol Hepatol 17, 758‐764. Hahn, W. C., and Weinberg, R. A. (2002). Modelling the molecular circuitry of cancer. Nat Rev Cancer 2, 331‐341. Halawani, D., Mondeh, R., Stanton, L. A., and Beier, F. (2004). p38 MAP kinase signaling is necessary for rat chondrosarcoma cell proliferation. Oncogene 23, 3726‐3731. Hanahan, D., and Weinberg, R. A. (2000). The hallmarks of cancer. Cell 100, 57‐70. Hanahan, D., and Weinberg, R. A. (2011). Hallmarks of cancer: the next generation. Cell 144, 646‐674. Hartnett, L., and Egan, L. J. (2012). Inflammation, DNA methylation and colitis‐associated cancer. Carcinogenesis 33, 723‐731. Hayakawa, Y., Hirata, Y., Nakagawa, H., Sakamoto, K., Hikiba, Y., Otsuka, M., Ijichi, H., Ikenoue, T., Tateishi, K., Akanuma, M., et al. (2010). Apoptosis signal‐regulating kinase 1 regulates colitis and colitis‐associated tumorigenesis by the innate immune responses. Gastroenterology 138, 1055‐1067 e1051‐1054. BIOBIOGRAPHY 137Heinrichsdorff, J., Luedde, T., Perdiguero, E., Nebreda, A. R., and Pasparakis, M. (2008). p38 alpha MAPK inhibits JNK activation and collaborates with IkappaB kinase 2 to prevent endotoxin‐induced liver failure. EMBO Rep 9, 1048‐1054. Hoellen, F., Kelling, K., Dittmer, C., Diedrich, K., Friedrich, M., and Thill, M. (2011). Impact of cyclooxygenase‐2 in breast cancer. Anticancer Res 31, 4359‐4367. Hollenbach, E., Neumann, M., Vieth, M., Roessner, A., Malfertheiner, P., and Naumann, M. (2004). Inhibition of p38 MAP kinase‐ and RICK/NF‐kappaB‐signaling suppresses inflammatory bowel disease. FASEB J 18, 1550‐1552. Hommes, D., van den Blink, B., Plasse, T., Bartelsman, J., Xu, C., Macpherson, B., Tytgat, G., Peppelenbosch, M., and Van Deventer, S. (2002). Inhibition of stress‐activated MAP kinases induces clinical improvement in moderate to severe Crohnʹs disease. Gastroenterology 122, 7‐14. Hong, J., Zhou, J., Fu, J., He, T., Qin, J., Wang, L., Liao, L., and Xu, J. (2011). Phosphorylation of serine 68 of Twist1 by MAPKs stabilizes Twist1 protein and promotes breast cancer cell invasiveness. Cancer Res 71, 3980‐3990. Hope, H. R., Anderson, G. D., Burnette, B. L., Compton, R. P., Devraj, R. V., Hirsch, J. L., Keith, R. H., Li, X., Mbalaviele, G., Messing, D. M., et al. (2009). Anti‐inflammatory properties of a novel N‐phenyl pyridinone inhibitor of p38 mitogen‐activated protein kinase: preclinical‐to‐clinical translation. J Pharmacol Exp Ther 331, 882‐895. Houde, M., Laprise, P., Jean, D., Blais, M., Asselin, C., and Rivard, N. (2001). Intestinal epithelial cell differentiation involves activation of p38 mitogen‐activated protein kinase that regulates the homeobox transcription factor CDX2. J Biol Chem 276, 21885‐21894. Hsieh, M. J., Chen, K. S., Chiou, H. L., and Hsieh, Y. S. (2010). Carbonic anhydrase XII promotes invasion and migration ability of MDA‐MB‐231 breast cancer cells through the p38 MAPK signaling pathway. Eur J Cell Biol 89, 598‐606. Hu, D., Fang, W., Han, A., Gallagher, L., Davis, R. J., Xiong, B., and Yang, W. (2008). c‐Jun N‐terminal kinase 1 interacts with and negatively regulates Wnt/beta‐catenin signaling through GSK3beta pathway. Carcinogenesis 29, 2317‐2324. Huang, G., Shi, L. Z., and Chi, H. (2009). Regulation of JNK and p38 MAPK in the immune system: signal integration, propagation and termination. Cytokine 48, 161‐169. Hui, L., Bakiri, L., Mairhorfer, A., Schweifer, N., Haslinger, C., Kenner, L., Komnenovic, V., Scheuch, H., Beug, H., and Wagner, E. F. (2007). p38alpha suppresses normal and cancer cell proliferation by antagonizing the JNK‐c‐Jun pathway. Nat Genet 39, 741‐749. Hussain, S. P., Amstad, P., Raja, K., Ambs, S., Nagashima, M., Bennett, W. P., Shields, P. G., Ham, A. J., Swenberg, J. A., Marrogi, A. J., and Harris, C. C. (2000). Increased p53 mutation load in noncancerous colon tissue from ulcerative colitis: a cancer‐prone chronic inflammatory disease. Cancer Res 60, 3333‐3337. BIOBIOGRAPHY 138 Hussain, S. P., and Harris, C. C. (2007). Inflammation and cancer: an ancient link with novel potentials. Int J Cancer 121, 2373‐2380. Huxley, R. R., Ansary‐Moghaddam, A., Clifton, P., Czernichow, S., Parr, C. L., and Woodward, M. (2009). The impact of dietary and lifestyle risk factors on risk of colorectal cancer: a quantitative overview of the epidemiological evidence. Int J Cancer 125, 171‐180. Ichijo, H. (1999). From receptors to stress‐activated MAP kinases. Oncogene 18, 6087‐6093. Ishikawa, T. O., and Herschman, H. R. (2010). Tumor formation in a mouse model of colitis‐associated colon cancer does not require COX‐1 or COX‐2 expression. Carcinogenesis 31, 729‐736. Issa, J. P., Ahuja, N., Toyota, M., Bronner, M. P., and Brentnall, T. A. (2001). Accelerated age‐related CpG island methylation in ulcerative colitis. Cancer Res 61, 3573‐3577. Itzkowitz, S. H., and Yio, X. (2004). Inflammation and cancer IV. Colorectal cancer in inflammatory bowel disease: the role of inflammation. Am J Physiol Gastrointest Liver Physiol 287, G7‐17. Iwamoto, M., Koji, T., Makiyama, K., Kobayashi, N., and Nakane, P. K. (1996). Apoptosis of crypt epithelial cells in ulcerative colitis. J Pathol 180, 152‐159. Iyoda, K., Sasaki, Y., Horimoto, M., Toyama, T., Yakushijin, T., Sakakibara, M., Takehara, T., Fujimoto, J., Hori, M., Wands, J. R., and Hayashi, N. (2003). Involvement of the p38 mitogen‐activated protein kinase cascade in hepatocellular carcinoma. Cancer 97, 3017‐3026. Jamieson, T., Clarke, M., Steele, C. W., Samuel, M. S., Neumann, J., Jung, A., Huels, D., Olson, M. F., Das, S., Nibbs, R. J., and Sansom, O. J. (2012). Inhibition of CXCR2 profoundly suppresses inflammation‐driven and spontaneous tumorigenesis. J Clin Invest 122, 3127‐3144. Jemal, A., Thomas, A., Murray, T., and Thun, M. (2002). Cancer statistics, 2002. CA Cancer J Clin 52, 23‐47. Johansson, N., Ala‐aho, R., Uitto, V., Grenman, R., Fusenig, N. E., Lopez‐Otin, C., and Kahari, V. M. (2000). Expression of collagenase‐3 (MMP‐13) and collagenase‐1 (MMP‐1) by transformed keratinocytes is dependent on the activity of p38 mitogen‐activated protein kinase. J Cell Sci 113, 227‐235. Junttila, M. R., Ala‐Aho, R., Jokilehto, T., Peltonen, J., Kallajoki, M., Grenman, R., Jaakkola, P., Westermarck, J., and Kahari, V. M. (2007). p38alpha and p38delta mitogen‐activated protein kinase isoforms regulate invasion and growth of head and neck squamous carcinoma cells. Oncogene 26, 5267‐5279. Kang, Y. J., Chen, J., Otsuka, M., Mols, J., Ren, S., Wang, Y., and Han, J. (2008). Macrophage deletion of p38alpha partially impairs lipopolysaccharide‐induced cellular activation. J Immunol 180, 5075‐5082. BIOBIOGRAPHY 139Kardakaris, R., Gareus, R., Xanthoulea, S., and Pasparakis, M. (2011). Endothelial and macrophage‐specific deficiency of P38alpha MAPK does not affect the pathogenesis of atherosclerosis in ApoE‐/‐ mice. PLoS One 6, e21055. Karin, M. (2006). Nuclear factor‐kappaB in cancer development and progression. Nature 441, 431‐436. Kennedy, N. J., Sluss, H. K., Jones, S. N., Bar‐Sagi, D., Flavell, R. A., and Davis, R. J. (2003). Suppression of Ras‐stimulated transformation by the JNK signal transduction pathway. Genes Dev 17, 629‐637. Kim, C., Sano, Y., Todorova, K., Carlson, B. A., Arpa, L., Celada, A., Lawrence, T., Otsu, K., Brissette, J. L., Arthur, J. S., and Park, J. M. (2008a). The kinase p38 alpha serves cell type‐specific inflammatory functions in skin injury and coordinates pro‐ and anti‐inflammatory gene expression. Nat Immunol 9, 1019‐1027. Kim, D. S., Hwang, E. S., Lee, J. E., Kim, S. Y., and Park, K. C. (2003). Sphingosine‐1‐phosphate promotes mouse melanocyte survival via ERK and Akt activation. Cell Signal 15, 919‐926. Kim, M. J., Choi, S. Y., Park, I. C., Hwang, S. G., Kim, C., Choi, Y. H., Kim, H., Lee, K. H., and Lee, S. J. (2008b). Opposing roles of c‐Jun NH2‐terminal kinase and p38 mitogen‐activated protein kinase in the cellular response to ionizing radiation in human cervical cancer cells. Mol Cancer Res 6, 1718‐1731. Kinzler, K. W., Nilbert, M. C., Su, L. K., Vogelstein, B., Bryan, T. M., Levy, D. B., Smith, K. J., Preisinger, A. C., Hedge, P., McKechnie, D., and et al. (1991). Identification of FAP locus genes from chromosome 5q21. Science 253, 661‐665. Kishi, H., Nakagawa, K., Matsumoto, M., Suga, M., Ando, M., Taya, Y., and Yamaizumi, M. (2001). Osmotic shock induces G1 arrest through p53 phosphorylation at Ser33 by activated p38MAPK without phosphorylation at Ser15 and Ser20. J Biol Chem 276, 39115‐39122. Kotlyarov, A., and Gaestel, M. (2008). Protein Kinases as Substrates for SAPKs. In Stress‐Activated Protein Kinases, F. Posas, and A. Nebreda, eds. (Springer Berlin Heidelberg), pp. 243‐260. Kuhn, R., Lohler, J., Rennick, D., Rajewsky, K., and Muller, W. (1993). Interleukin‐10‐deficient mice develop chronic enterocolitis. Cell 75, 263‐274. Kumar, P., Yadav, A., Patel, S. N., Islam, M., Pan, Q., Merajver, S. D., and Teknos, T. N. (2010). Tetrathiomolybdate inhibits head and neck cancer metastasis by decreasing tumor cell motility, invasiveness and by promoting tumor cell anoikis. Mol Cancer 9, 206. Kumar, S., Boehm, J., and Lee, J. C. (2003). p38 MAP kinases: key signalling molecules as therapeutic targets for inflammatory diseases. Nat Rev Drug Discov 2, 717‐726. Kuraishy, A., Karin, M., and Grivennikov, S. I. (2011). Tumor promotion via injury‐ and death‐induced inflammation. Immunity 35, 467‐477. BIOBIOGRAPHY 140 Kurosu, T., Takahashi, Y., Fukuda, T., Koyama, T., Miki, T., and Miura, O. (2005). p38 MAP kinase plays a role in G2 checkpoint activation and inhibits apoptosis of human B cell lymphoma cells treated with etoposide. Apoptosis 10, 1111‐1120. Kuwamura, H., Tominaga, K., Shiota, M., Ashida, R., Nakao, T., Sasaki, E., Watanabe, T., Fujiwara, Y., Oshitani, N., Higuchi, K., et al. (2007). Growth inhibition of colon cancer cells by transfection of dominant‐negative apoptosis signal‐regulating kinase‐1. Oncol Rep 17, 781‐786. Kwak, E. L., and Chung, D. C. (2007). Hereditary colorectal cancer syndromes: an overview. Clin Colorectal Cancer 6, 340‐344. Kyriakis, J. M., and Avruch, J. (2001). Mammalian mitogen‐activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev 81, 807‐869. Kyriakis, J. M., and Avruch, J. (2012). Mammalian MAPK signal transduction pathways activated by stress and inflammation: a 10‐year update. Physiol Rev 92, 689‐737. Lafarga, V., Cuadrado, A., Lopez de Silanes, I., Bengoechea, R., Fernandez‐Capetillo, O., and Nebreda, A. R. (2009). p38 Mitogen‐activated protein kinase‐ and HuR‐dependent stabilization of p21(Cip1) mRNA mediates the G(1)/S checkpoint. Mol Cell Biol 29, 4341‐4351. Laukoetter, M. G., Nava, P., Lee, W. Y., Severson, E. A., Capaldo, C. T., Babbin, B. A., Williams, I. R., Koval, M., Peatman, E., Campbell, J. A., et al. (2007). JAM‐A regulates permeability and inflammation in the intestine in vivo. J Exp Med 204, 3067‐3076. Lavoie, J. N., LʹAllemain, G., Brunet, A., Muller, R., and Pouyssegur, J. (1996). Cyclin D1 expression is regulated positively by the p42/p44MAPK and negatively by the p38/HOGMAPK pathway. J Biol Chem 271, 20608‐20616. Lee, J. C., Laydon, J. T., McDonnell, P. C., Gallagher, T. F., Kumar, S., Green, D., McNulty, D., Blumenthal, M. J., Heys, J. R., Landvatter, S. W., and et al. (1994). A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature 372, 739‐746. Lluis, F., Perdiguero, E., Nebreda, A. R., and Munoz‐Canoves, P. (2006). Regulation of skeletal muscle gene expression by p38 MAP kinases. Trends Cell Biol 16, 36‐44. Long, X., Goldenthal, M. J., and Marin‐Garcia, J. (2007). Oxidative stress enhances phosphorylation of p53 in neonatal rat cardiomyocytes. Mol Cell Biochem 303, 167‐174. Luo, J., Solimini, N. L., and Elledge, S. J. (2009). Principles of cancer therapy: oncogene and non‐oncogene addiction. Cell 136, 823‐837. Lynch, H. T., and de la Chapelle, A. (2003). Hereditary colorectal cancer. N Engl J Med 348, 919‐932. Madison, B. B., Dunbar, L., Qiao, X. T., Braunstein, K., Braunstein, E., and Gumucio, D. L. (2002). Cis elements of the villin gene control expression in restricted domains of the vertical BIOBIOGRAPHY 141(crypt) and horizontal (duodenum, cecum) axes of the intestine. J Biol Chem 277, 33275‐33283. Mahalingam, M., and Cooper, J. A. (2001). Phosphorylation of mammalian eIF4E by Mnk1 and Mnk2: tantalizing prospects for a role in translation. Prog Mol Subcell Biol 27, 132‐142. Maher, P. (1999). p38 mitogen‐activated protein kinase activation is required for fibroblast growth factor‐2‐stimulated cell proliferation but not differentiation. J Biol Chem 274, 17491‐17498. Mahler, M., Bristol, I. J., Leiter, E. H., Workman, A. E., Birkenmeier, E. H., Elson, C. O., and Sundberg, J. P. (1998). Differential susceptibility of inbred mouse strains to dextran sulfate sodium‐induced colitis. Am J Physiol 274, G544‐551. Malamut, G., Cabane, C., Dubuquoy, L., Malapel, M., Derijard, B., Gay, J., Tamboli, C., Colombel, J. F., and Desreumaux, P. (2006). No evidence for an involvement of the p38 and JNK mitogen‐activated protein in inflammatory bowel diseases. Dig Dis Sci 51, 1443‐1453. Maltzman, T., Whittington, J., Driggers, L., Stephens, J., and Ahnen, D. (1997). AOM‐induced mouse colon tumors do not express full‐length APC protein. Carcinogenesis 18, 2435‐2439. Manke, I. A., Nguyen, A., Lim, D., Stewart, M. Q., Elia, A. E., and Yaffe, M. B. (2005). MAPKAP kinase‐2 is a cell cycle checkpoint kinase that regulates the G2/M transition and S phase progression in response to UV irradiation. Mol Cell 17, 37‐48. Mantovani, A., Allavena, P., Sica, A., and Balkwill, F. (2008). Cancer‐related inflammation. Nature 454, 436‐444. Mantovani, A., and Pierotti, M. A. (2008). Cancer and inflammation: a complex relationship. Cancer Lett 267, 180‐181. Matrone, A., Grossi, V., Chiacchiera, F., Fina, E., Cappellari, M., Caringella, A. M., Di Naro, E., Loverro, G., and Simone, C. (2010). p38alpha is required for ovarian cancer cell metabolism and survival. Int J Gynecol Cancer 20, 203‐211. McNeil, E., Capaldo, C. T., and Macara, I. G. (2006). Zonula occludens‐1 function in the assembly of tight junctions in Madin‐Darby canine kidney epithelial cells. Mol Biol Cell 17, 1922‐1932. Medzhitov, R. (2008). Origin and physiological roles of inflammation. Nature 454, 428‐435. Menon, M. B., Kotlyarov, A., and Gaestel, M. (2011). SB202190‐induced cell type‐specific vacuole formation and defective autophagy do not depend on p38 MAP kinase inhibition. PLoS One 6, e23054. Mikhailov, A., Shinohara, M., and Rieder, C. L. (2005). The p38‐mediated stress‐activated checkpoint. A rapid response system for delaying progression through antephase and entry into mitosis. Cell Cycle 4, 57‐62. BIOBIOGRAPHY 142 Morin, P. J., Sparks, A. B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., and Kinzler, K. W. (1997). Activation of beta‐catenin‐Tcf signaling in colon cancer by mutations in beta‐catenin or APC. Science 275, 1787‐1790. Moser, A. R., Pitot, H. C., and Dove, W. F. (1990). A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science 247, 322‐324. Mudgett, J. S., Ding, J., Guh‐Siesel, L., Chartrain, N. A., Yang, L., Gopal, S., and Shen, M. M. (2000). Essential role for p38alpha mitogen‐activated protein kinase in placental angiogenesis. Proc Natl Acad Sci U S A 97, 10454‐10459. Nambiar, P. R., Girnun, G., Lillo, N. A., Guda, K., Whiteley, H. E., and Rosenberg, D. W. (2003). Preliminary analysis of azoxymethane induced colon tumors in inbred mice commonly used as transgenic/knockout progenitors. Int J Oncol 22, 145‐150. Nenci, A., Becker, C., Wullaert, A., Gareus, R., van Loo, G., Danese, S., Huth, M., Nikolaev, A., Neufert, C., Madison, B., et al. (2007). Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature 446, 557‐561. Neufert, C., Becker, C., and Neurath, M. F. (2007). An inducible mouse model of colon carcinogenesis for the analysis of sporadic and inflammation‐driven tumor progression. Nat Protoc 2, 1998‐2004. Neve, R. M., Holbro, T., and Hynes, N. E. (2002). Distinct roles for phosphoinositide 3‐kinase, mitogen‐activated protein kinase and p38 MAPK in mediating cell cycle progression of breast cancer cells. Oncogene 21, 4567‐4576. Oeztuerk‐Winder, F., and Ventura, J. J. (2012). The many faces of p38 mitogen‐activated protein kinase in progenitor/stem cell differentiation. Biochem J 445, 1‐10. Okayasu, I., Hatakeyama, S., Yamada, M., Ohkusa, T., Inagaki, Y., and Nakaya, R. (1990). A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 98, 694‐702. Okayasu, I., Ohkusa, T., Kajiura, K., Kanno, J., and Sakamoto, S. (1996). Promotion of colorectal neoplasia in experimental murine ulcerative colitis. Gut 39, 87‐92. Okayasu, I., Yamada, M., Mikami, T., Yoshida, T., Kanno, J., and Ohkusa, T. (2002). Dysplasia and carcinoma development in a repeated dextran sulfate sodium‐induced colitis model. J Gastroenterol Hepatol 17, 1078‐1083. Olson, J. M., and Hallahan, A. R. (2004). p38 MAP kinase: a convergence point in cancer therapy. Trends Mol Med 10, 125‐129. Ono, K., and Han, J. (2000). The p38 signal transduction pathway: activation and function. Cell Signal 12, 1‐13. BIOBIOGRAPHY 143Otsuka, M., Kang, Y. J., Ren, J., Jiang, H., Wang, Y., Omata, M., and Han, J. (2010). Distinct effects of p38alpha deletion in myeloid lineage and gut epithelia in mouse models of inflammatory bowel disease. Gastroenterology 138, 1255‐1265. Otto, K. B., Acharya, S. S., and Robinson, V. L. (2012). Stress‐activated kinase pathway alteration is a frequent event in bladder cancer. Urol Oncol 30, 415‐420. Papanikolaou, A., Shank, R. C., Delker, D. A., Povey, A., Cooper, D. P., and Rosenberg, D. W. (1998). Initial levels of azoxymethane‐induced DNA methyl adducts are not predictive of tumor susceptibility in inbred mice. Toxicol Appl Pharmacol 150, 196‐203. Papanikolaou, A., Wang, Q. S., Papanikolaou, D., Whiteley, H. E., and Rosenberg, D. W. (2000). Sequential and morphological analyses of aberrant crypt foci formation in mice of differing susceptibility to azoxymethane‐induced colon carcinogenesis. Carcinogenesis 21, 1567‐1572. Park, S. Y., Jeong, K. J., Panupinthu, N., Yu, S., Lee, J., Han, J. W., Kim, J. M., Lee, J. S., Kang, J., Park, C. G., et al. (2011). Lysophosphatidic acid augments human hepatocellular carcinoma cell invasion through LPA1 receptor and MMP‐9 expression. Oncogene 30, 1351‐1359. Peeters, M., Geypens, B., Claus, D., Nevens, H., Ghoos, Y., Verbeke, G., Baert, F., Vermeire, S., Vlietinck, R., and Rutgeerts, P. (1997). Clustering of increased small intestinal permeability in families with Crohnʹs disease. Gastroenterology 113, 802‐807. Perdiguero, E., and Muñoz‐Cánoves, P. (2008). Transcriptional regulation by the p38 MAPK signaling pathway in mammalian cells. In Stress‐Activated Protein Kinases, F. Posas, and A. Nebreda, eds. (Springer Berlin Heidelberg), pp. 51‐79. Perdiguero, E., Ruiz‐Bonilla, V., Serrano, A. L., and Munoz‐Canoves, P. (2007). Genetic deficiency of p38alpha reveals its critical role in myoblast cell cycle exit: the p38alpha‐JNK connection. Cell Cycle 6, 1298‐1303. Phong, M. S., Van Horn, R. D., Li, S., Tucker‐Kellogg, G., Surana, U., and Ye, X. S. (2010). p38 mitogen‐activated protein kinase promotes cell survival in response to DNA damage but is not required for the G(2) DNA damage checkpoint in human cancer cells. Mol Cell Biol 30, 3816‐3826. Pickert, G., Neufert, C., Leppkes, M., Zheng, Y., Wittkopf, N., Warntjen, M., Lehr, H. A., Hirth, S., Weigmann, B., Wirtz, S., et al. (2009). STAT3 links IL‐22 signaling in intestinal epithelial cells to mucosal wound healing. J Exp Med 206, 1465‐1472. Pino, M. S., and Chung, D. C. (2010). The chromosomal instability pathway in colon cancer. Gastroenterology 138, 2059‐2072. Platanias, L. C. (2003). Map kinase signaling pathways and hematologic malignancies. Blood 101, 4667‐4679. BIOBIOGRAPHY 144 Popivanova, B. K., Kitamura, K., Wu, Y., Kondo, T., Kagaya, T., Kaneko, S., Oshima, M., Fujii, C., and Mukaida, N. (2008). Blocking TNF‐alpha in mice reduces colorectal carcinogenesis associated with chronic colitis. J Clin Invest 118, 560‐570. Porras, A., Zuluaga, S., Black, E., Valladares, A., Alvarez, A. M., Ambrosino, C., Benito, M., and Nebreda, A. R. (2004). P38 alpha mitogen‐activated protein kinase sensitizes cells to apoptosis induced by different stimuli. Mol Biol Cell 15, 922‐933. Potter, J. D. (1999). Colorectal cancer: molecules and populations. J Natl Cancer Inst 91, 916‐932. Pretlow, T. P., Barrow, B. J., Ashton, W. S., OʹRiordan, M. A., Pretlow, T. G., Jurcisek, J. A., and Stellato, T. A. (1991). Aberrant crypts: putative preneoplastic foci in human colonic mucosa. Cancer Res 51, 1564‐1567. Pretlow, T. P., OʹRiordan, M. A., Pretlow, T. G., and Stellato, T. A. (1992). Aberrant crypts in human colonic mucosa: putative preneoplastic lesions. J Cell Biochem Suppl 16G, 55‐62. Purcell, N. H., Tang, G., Yu, C., Mercurio, F., DiDonato, J. A., and Lin, A. (2001). Activation of NF‐kappa B is required for hypertrophic growth of primary rat neonatal ventricular cardiomyocytes. Proc Natl Acad Sci U S A 98, 6668‐6673. Puri, P. L., Wu, Z., Zhang, P., Wood, L. D., Bhakta, K. S., Han, J., Feramisco, J. R., Karin, M., and Wang, J. Y. (2000). Induction of terminal differentiation by constitutive activation of p38 MAP kinase in human rhabdomyosarcoma cells. Genes Dev 14, 574‐584. Recio, J. A., and Merlino, G. (2002). Hepatocyte growth factor/scatter factor activates proliferation in melanoma cells through p38 MAPK, ATF‐2 and cyclin D1. Oncogene 21, 1000‐1008. Reinhardt, H. C., Aslanian, A. S., Lees, J. A., and Yaffe, M. B. (2007). p53‐deficient cells rely on ATM‐ and ATR‐mediated checkpoint signaling through the p38MAPK/MK2 pathway for survival after DNA damage. Cancer Cell 11, 175‐189. Ricote, M., Garcia‐Tunon, I., Bethencourt, F., Fraile, B., Onsurbe, P., Paniagua, R., and Royuela, M. (2006). The p38 transduction pathway in prostatic neoplasia. J Pathol 208, 401‐407. Riddell, R. H., Goldman, H., Ransohoff, D. F., Appelman, H. D., Fenoglio, C. M., Haggitt, R. C., Ahren, C., Correa, P., Hamilton, S. R., Morson, B. C., and et al. (1983). Dysplasia in inflammatory bowel disease: standardized classification with provisional clinical applications. Hum Pathol 14, 931‐968. Riebe, C., Pries, R., Schroeder, K. N., and Wollenberg, B. (2011). Phosphorylation of STAT3 in head and neck cancer requires p38 MAPKinase, whereas phosphorylation of STAT1 occurs via a different signaling pathway. Anticancer Res 31, 3819‐3825. Rodriguez‐Gabriel, M. A., and Russell, P. (2008). Control of mRNA stability by SAPKs. Top Curr Genet 20, 159‐170. BIOBIOGRAPHY 145Rouse, J., Cohen, P., Trigon, S., Morange, M., Alonso‐Llamazares, A., Zamanillo, D., Hunt, T., and Nebreda, A. R. (1994). A novel kinase cascade triggered by stress and heat shock that stimulates MAPKAP kinase‐2 and phosphorylation of the small heat shock proteins. Cell 78, 1027‐1037. Roux, P. P., and Blenis, J. (2004). ERK and p38 MAPK‐activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol Mol Biol Rev 68, 320‐344. Rutter, M., Saunders, B., Wilkinson, K., Rumbles, S., Schofield, G., Kamm, M., Williams, C., Price, A., Talbot, I., and Forbes, A. (2004). Severity of inflammation is a risk factor for colorectal neoplasia in ulcerative colitis. Gastroenterology 126, 451‐459. Sabio, G., Arthur, J. S., Kuma, Y., Peggie, M., Carr, J., Murray‐Tait, V., Centeno, F., Goedert, M., Morrice, N. A., and Cuenda, A. (2005). p38gamma regulates the localisation of SAP97 in the cytoskeleton by modulating its interaction with GKAP. EMBO J 24, 1134‐1145. Saccani, S., Pantano, S., and Natoli, G. (2002). p38‐Dependent marking of inflammatory genes for increased NF‐kappa B recruitment. Nat Immunol 3, 69‐75. Sakurai, T., He, G., Matsuzawa, A., Yu, G. Y., Maeda, S., Hardiman, G., and Karin, M. (2008). Hepatocyte necrosis induced by oxidative stress and IL‐1 alpha release mediate carcinogen‐induced compensatory proliferation and liver tumorigenesis. Cancer Cell 14, 156‐165. Salvador, J. M., Mittelstadt, P. R., Guszczynski, T., Copeland, T. D., Yamaguchi, H., Appella, E., Fornace, A. J., Jr., and Ashwell, J. D. (2005). Alternative p38 activation pathway mediated by T cell receptor‐proximal tyrosine kinases. Nat Immunol 6, 390‐395. Santini, V., Kantarjian, H. M., and Issa, J. P. (2001). Changes in DNA methylation in neoplasia: pathophysiology and therapeutic implications. Ann Intern Med 134, 573‐586. Sato, T., Stange, D. E., Ferrante, M., Vries, R. G., Van Es, J. H., Van den Brink, S., Van Houdt, W. J., Pronk, A., Van Gorp, J., Siersema, P. D., and Clevers, H. (2011). Long‐term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrettʹs epithelium. Gastroenterology 141, 1762‐1772. Schetter, A. J., Heegaard, N. H., and Harris, C. C. (2010). Inflammation and cancer: interweaving microRNA, free radical, cytokine and p53 pathways. Carcinogenesis 31, 37‐49. Schirbel, A., and Fiocchi, C. (2010). Inflammatory bowel disease: Established and evolving considerations on its etiopathogenesis and therapy. J Dig Dis 11, 266‐276. Schmitz, H., Barmeyer, C., Fromm, M., Runkel, N., Foss, H. D., Bentzel, C. J., Riecken, E. O., and Schulzke, J. D. (1999). Altered tight junction structure contributes to the impaired epithelial barrier function in ulcerative colitis. Gastroenterology 116, 301‐309. Schreiber, S., Feagan, B., DʹHaens, G., Colombel, J. F., Geboes, K., Yurcov, M., Isakov, V., Golovenko, O., Bernstein, C. N., Ludwig, D., et al. (2006). Oral p38 mitogen‐activated protein kinase inhibition with BIRB 796 for active Crohnʹs disease: a randomized, double‐blind, placebo‐controlled trial. Clin Gastroenterol Hepatol 4, 325‐334. BIOBIOGRAPHY 146 Sebolt‐Leopold, J. S., and Herrera, R. (2004). Targeting the mitogen‐activated protein kinase cascade to treat cancer. Nat Rev Cancer 4, 937‐947. Seimon, T. A., Wang, Y., Han, S., Senokuchi, T., Schrijvers, D. M., Kuriakose, G., Tall, A. R., and Tabas, I. A. (2009). Macrophage deficiency of p38alpha MAPK promotes apoptosis and plaque necrosis in advanced atherosclerotic lesions in mice. J Clin Invest 119, 886‐898. Seril, D. N., Liao, J., Yang, G. Y., and Yang, C. S. (2003). Oxidative stress and ulcerative colitis‐associated carcinogenesis: studies in humans and animal models. Carcinogenesis 24, 353‐362. Shamsuddin, A. M. (1984). Comparative studies of primary, metastatic and transplanted colon adenocarcinomas of Fischer 344 rats. J Submicrosc Cytol 16, 327‐339. Singer, II, Kawka, D. W., Schloemann, S., Tessner, T., Riehl, T., and Stenson, W. F. (1998). Cyclooxygenase 2 is induced in colonic epithelial cells in inflammatory bowel disease. Gastroenterology 115, 297‐306. Sjoblom, T., Jones, S., Wood, L. D., Parsons, D. W., Lin, J., Barber, T. D., Mandelker, D., Leary, R. J., Ptak, J., Silliman, N., et al. (2006). The consensus coding sequences of human breast and colorectal cancers. Science 314, 268‐274. Slattery, M. L. (2000). Diet, lifestyle, and colon cancer. Semin Gastrointest Dis 11, 142‐146. Stalheim, L., and Johnson, G. (2008). MAPK Kinase Kinase Regulation of SAPK/JNK Pathways. In Stress‐Activated Protein Kinases, F. Posas, and A. Nebreda, eds. (Springer Berlin Heidelberg), pp. 1‐15. Stein, B., Brady, H., Yang, M. X., Young, D. B., and Barbosa, M. S. (1996). Cloning and characterization of MEK6, a novel member of the mitogen‐activated protein kinase kinase cascade. J Biol Chem 271, 11427‐11433. Stevceva, L., Pavli, P., Buffinton, G., Wozniak, A., and Doe, W. F. (1999). Dextran sodium sulphate‐induced colitis activity varies with mouse strain but develops in lipopolysaccharide‐unresponsive mice. J Gastroenterol Hepatol 14, 54‐60. Subbaramaiah, K., and Dannenberg, A. J. (2003). Cyclooxygenase 2: a molecular target for cancer prevention and treatment. Trends Pharmacol Sci 24, 96‐102. Sun, P., Yoshizuka, N., New, L., Moser, B. A., Li, Y., Liao, R., Xie, C., Chen, J., Deng, Q., Yamout, M., et al. (2007). PRAK is essential for ras‐induced senescence and tumor suppression. Cell 128, 295‐308. Sunayama, J., Tsuruta, F., Masuyama, N., and Gotoh, Y. (2005). JNK antagonizes Akt‐mediated survival signals by phosphorylating 14‐3‐3. J Cell Biol 170, 295‐304. Suzuki, R., Kohno, H., Sugie, S., Nakagama, H., and Tanaka, T. (2006). Strain differences in the susceptibility to azoxymethane and dextran sodium sulfate‐induced colon carcinogenesis in mice. Carcinogenesis 27, 162‐169. BIOBIOGRAPHY 147Suzuki, R., Kohno, H., Sugie, S., and Tanaka, T. (2004). Sequential observations on the occurrence of preneoplastic and neoplastic lesions in mouse colon treated with azoxymethane and dextran sodium sulfate. Cancer Sci 95, 721‐727. Takahashi, M., Mutoh, M., Kawamori, T., Sugimura, T., and Wakabayashi, K. (2000a). Altered expression of beta‐catenin, inducible nitric oxide synthase and cyclooxygenase‐2 in azoxymethane‐induced rat colon carcinogenesis. Carcinogenesis 21, 1319‐1327. Takahashi, M., Nakatsugi, S., Sugimura, T., and Wakabayashi, K. (2000b). Frequent mutations of the beta‐catenin gene in mouse colon tumors induced by azoxymethane. Carcinogenesis 21, 1117‐1120. Takayama, T., Katsuki, S., Takahashi, Y., Ohi, M., Nojiri, S., Sakamaki, S., Kato, J., Kogawa, K., Miyake, H., and Niitsu, Y. (1998). Aberrant crypt foci of the colon as precursors of adenoma and cancer. N Engl J Med 339, 1277‐1284. Takayama, T., Miyanishi, K., Hayashi, T., Sato, Y., and Niitsu, Y. (2006). Colorectal cancer: genetics of development and metastasis. J Gastroenterol 41, 185‐192. Takeba, Y., Kumai, T., Matsumoto, N., Nakaya, S., Tsuzuki, Y., Yanagida, Y., and Kobayashi, S. (2007). Irinotecan activates p53 with its active metabolite, resulting in human hepatocellular carcinoma apoptosis. J Pharmacol Sci 104, 232‐242. Tamaru, T., Kobayashi, H., Kishimoto, S., Kajiyama, G., Shimamoto, F., and Brown, W. R. (1993). Histochemical study of colonic cancer in experimental colitis of rats. Dig Dis Sci 38, 529‐537. Tamura, K., Sudo, T., Senftleben, U., Dadak, A. M., Johnson, R., and Karin, M. (2000). Requirement for p38alpha in erythropoietin expression: a role for stress kinases in erythropoiesis. Cell 102, 221‐231. Tanaka, N., Kamanaka, M., Enslen, H., Dong, C., Wysk, M., Davis, R. J., and Flavell, R. A. (2002). Differential involvement of p38 mitogen‐activated protein kinase kinases MKK3 and MKK6 in T‐cell apoptosis. EMBO Rep 3, 785‐791. Tanaka, T., Kohno, H., Suzuki, R., Yamada, Y., Sugie, S., and Mori, H. (2003). A novel inflammation‐related mouse colon carcinogenesis model induced by azoxymethane and dextran sodium sulfate. Cancer Sci 94, 965‐973. Tanaka, T., Suzuki, R., Kohno, H., Sugie, S., Takahashi, M., and Wakabayashi, K. (2005). Colonic adenocarcinomas rapidly induced by the combined treatment with 2‐amino‐1‐methyl‐6‐phenylimidazo[4,5‐b]pyridine and dextran sodium sulfate in male ICR mice possess beta‐catenin gene mutations and increases immunoreactivity for beta‐catenin, cyclooxygenase‐2 and inducible nitric oxide synthase. Carcinogenesis 26, 229‐238. Tarmin, L., Yin, J., Harpaz, N., Kozam, M., Noordzij, J., Antonio, L. B., Jiang, H. Y., Chan, O., Cymes, K., and Meltzer, S. J. (1995). Adenomatous polyposis coli gene mutations in ulcerative colitis‐associated dysplasias and cancers versus sporadic colon neoplasms. Cancer Res 55, 2035‐2038. BIOBIOGRAPHY 148 ten Hove, T., van den Blink, B., Pronk, I., Drillenburg, P., Peppelenbosch, M. P., and van Deventer, S. J. (2002). Dichotomal role of inhibition of p38 MAPK with SB 203580 in experimental colitis. Gut 50, 507‐512. Tenesa, A., and Dunlop, M. G. (2009). New insights into the aetiology of colorectal cancer from genome‐wide association studies. Nat Rev Genet 10, 353‐358. Thornton, T. M., Pedraza‐Alva, G., Deng, B., Wood, C. D., Aronshtam, A., Clements, J. L., Sabio, G., Davis, R. J., Matthews, D. E., Doble, B., and Rincon, M. (2008). Phosphorylation by p38 MAPK as an alternative pathway for GSK3beta inactivation. Science 320, 667‐670. Thornton, T. M., and Rincon, M. (2009). Non‐classical p38 map kinase functions: cell cycle checkpoints and survival. Int J Biol Sci 5, 44‐51. Toft, N. J., Winton, D. J., Kelly, J., Howard, L. A., Dekker, M., te Riele, H., Arends, M. J., Wyllie, A. H., Margison, G. P., and Clarke, A. R. (1999). Msh2 status modulates both apoptosis and mutation frequency in the murine small intestine. Proc Natl Acad Sci U S A 96, 3911‐3915. Toyota, M., Ahuja, N., Ohe‐Toyota, M., Herman, J. G., Baylin, S. B., and Issa, J. P. (1999). CpG island methylator phenotype in colorectal cancer. Proc Natl Acad Sci U S A 96, 8681‐8686. Trempolec, N., Dave‐Coll, N., and Nebreda, A. R. (2013a). SnapShot: p38 MAPK Signaling. Cell 152, 656‐656 e651. Trempolec, N., Dave‐Coll, N., and Nebreda, A. R. (2013b). SnapShot: p38 MAPK Substrates. Cell 152, 924‐924 e921. Trivedi, P. P., and Jena, G. B. (2012). Dextran sulfate sodium‐induced ulcerative colitis leads to increased hematopoiesis and induces both local as well as systemic genotoxicity in mice. Mutat Res 744, 172‐183. Tsukita, S., Furuse, M., and Itoh, M. (2001). Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol 2, 285‐293. Ullman, T. A., and Itzkowitz, S. H. (2011). Intestinal inflammation and cancer. Gastroenterology 140, 1807‐1816. Van der Sluis, M., De Koning, B. A., De Bruijn, A. C., Velcich, A., Meijerink, J. P., Van Goudoever, J. B., Buller, H. A., Dekker, J., Van Seuningen, I., Renes, I. B., and Einerhand, A. W. (2006). Muc2‐deficient mice spontaneously develop colitis, indicating that MUC2 is critical for colonic protection. Gastroenterology 131, 117‐129. Van Laethem, A., Van Kelst, S., Lippens, S., Declercq, W., Vandenabeele, P., Janssens, S., Vandenheede, J. R., Garmyn, M., and Agostinis, P. (2004). Activation of p38 MAPK is required for Bax translocation to mitochondria, cytochrome c release and apoptosis induced by UVB irradiation in human keratinocytes. FASEB J 18, 1946‐1948. BIOBIOGRAPHY 149Ventura, J. J., Hubner, A., Zhang, C., Flavell, R. A., Shokat, K. M., and Davis, R. J. (2006). Chemical genetic analysis of the time course of signal transduction by JNK. Mol Cell 21, 701‐710. Ventura, J. J., Tenbaum, S., Perdiguero, E., Huth, M., Guerra, C., Barbacid, M., Pasparakis, M., and Nebreda, A. R. (2007). p38alpha MAP kinase is essential in lung stem and progenitor cell proliferation and differentiation. Nat Genet 39, 750‐758. Waetzig, G. H., Seegert, D., Rosenstiel, P., Nikolaus, S., and Schreiber, S. (2002). p38 mitogen‐activated protein kinase is activated and linked to TNF‐alpha signaling in inflammatory bowel disease. J Immunol 168, 5342‐5351. Wagner, E. F., and Nebreda, A. R. (2009). Signal integration by JNK and p38 MAPK pathways in cancer development. Nat Rev Cancer 9, 537‐549. Wang, D., and Dubois, R. N. (2010). The role of COX‐2 in intestinal inflammation and colorectal cancer. Oncogene 29, 781‐788. Wang, L., Ma, R., Flavell, R. A., and Choi, M. E. (2002a). Requirement of mitogen‐activated protein kinase kinase 3 (MKK3) for activation of p38alpha and p38delta MAPK isoforms by TGF‐beta 1 in murine mesangial cells. J Biol Chem 277, 47257‐47262. Wang, Q. S., Papanikolaou, A., Sabourin, C. L., and Rosenberg, D. W. (1998). Altered expression of cyclin D1 and cyclin‐dependent kinase 4 in azoxymethane‐induced mouse colon tumorigenesis. Carcinogenesis 19, 2001‐2006. Wang, S. N., Lee, K. T., Tsai, C. J., Chen, Y. J., and Yeh, Y. T. (2012). Phosphorylated p38 and JNK MAPK proteins in hepatocellular carcinoma. Eur J Clin Invest 42, 1295‐1301. Wang, W., Chen, J. X., Liao, R., Deng, Q., Zhou, J. J., Huang, S., and Sun, P. (2002b). Sequential activation of the MEK‐extracellular signal‐regulated kinase and MKK3/6‐p38 mitogen‐activated protein kinase pathways mediates oncogenic ras‐induced premature senescence. Mol Cell Biol 22, 3389‐3403. Wang, W., Wang, X., Peng, L., Deng, Q., Liang, Y., Qing, H., and Jiang, B. (2010). CD24‐dependent MAPK pathway activation is required for colorectal cancer cell proliferation. Cancer Sci 101, 112‐119. Waskiewicz, A. J., Johnson, J. C., Penn, B., Mahalingam, M., Kimball, S. R., and Cooper, J. A. (1999). Phosphorylation of the cap‐binding protein eukaryotic translation initiation factor 4E by protein kinase Mnk1 in vivo. Mol Cell Biol 19, 1871‐1880. Westbrook, A. M., Szakmary, A., and Schiestl, R. H. (2010). Mechanisms of intestinal inflammation and development of associated cancers: lessons learned from mouse models. Mutat Res 705, 40‐59. Xie, J., and Itzkowitz, S. H. (2008). Cancer in inflammatory bowel disease. World J Gastroenterol 14, 378‐389. BIOBIOGRAPHY 150 Xu, L., Chen, S., and Bergan, R. C. (2006). MAPKAPK2 and HSP27 are downstream effectors of p38 MAP kinase‐mediated matrix metalloproteinase type 2 activation and cell invasion in human prostate cancer. Oncogene 25, 2987‐2998. Yamada, M., Ohkusa, T., and Okayasu, I. (1992). Occurrence of dysplasia and adenocarcinoma after experimental chronic ulcerative colitis in hamsters induced by dextran sulphate sodium. Gut 33, 1521‐1527. Yee, A. S., Paulson, E. K., McDevitt, M. A., Rieger‐Christ, K., Summerhayes, I., Berasi, S. P., Kim, J., Huang, C. Y., and Zhang, X. (2004). The HBP1 transcriptional repressor and the p38 MAP kinase: unlikely partners in G1 regulation and tumor suppression. Gene 336, 1‐13. Yin, J., Harpaz, N., Tong, Y., Huang, Y., Laurin, J., Greenwald, B. D., Hontanosas, M., Newkirk, C., and Meltzer, S. J. (1993). p53 point mutations in dysplastic and cancerous ulcerative colitis lesions. Gastroenterology 104, 1633‐1639. Yong, H. Y., Koh, M. S., and Moon, A. (2009). The p38 MAPK inhibitors for the treatment of inflammatory diseases and cancer. Expert Opin Investig Drugs 18, 1893‐1905. Yoshino, Y., Aoyagi, M., Tamaki, M., Duan, L., Morimoto, T., and Ohno, K. (2006). Activation of p38 MAPK and/or JNK contributes to increased levels of VEGF secretion in human malignant glioma cells. Int J Oncol 29, 981‐987. Yoshizuka, N., Chen, R. M., Xu, Z., Liao, R., Hong, L., Hu, W. Y., Yu, G., Han, J., Chen, L., and Sun, P. (2012). A novel function of p38‐regulated/activated kinase in endothelial cell migration and tumor angiogenesis. Mol Cell Biol 32, 606‐618. Yuan, L., Yu, Y., Sanders, M. A., Majumdar, A. P., and Basson, M. D. (2010). Schlafen 3 induction by cyclic strain regulates intestinal epithelial differentiation. Am J Physiol Gastrointest Liver Physiol 298, G994‐G1003. Zarubin, T., and Han, J. (2005). Activation and signaling of the p38 MAP kinase pathway. Cell Res 15, 11‐18. Zhang, Y., Zhou, L., Bao, Y. L., Wu, Y., Yu, C. L., Huang, Y. X., Sun, Y., Zheng, L. H., and Li, Y. X. (2010). Butyrate induces cell apoptosis through activation of JNK MAP kinase pathway in human colon cancer RKO cells. Chem Biol Interact 185, 174‐181. 151 Resumen en castellano RESUMEN EN CASTELLANO 153Resumen p38 es una proteína quinasa activada por mitógenos (MAPK), muy importante en las respuestas celulares a estrés, aunque también posee otras funciones cruciales en inflamación y homeostasis de los tejidos. La inactivación genética de p38 en células mieloides ha proporcionado evidencias de la importancia de esta ruta de señalización en la producción de citoquinas y en las respuestas inflamatorias in vivo. Estudios recientes mostraron in vivo que p38 puede suprimir la iniciación de tumores de pulmón e hígado. Sin embargo, no hay muchas evidencias de mutaciones inactivantes de p38 en tumores, lo que sugiere que las células cancerígenas podrían usar esta vía de señalización para controlar múltiples procesos celulares. En línea con esta idea, el uso de inhibidores químicos ha mostrado cómo p38 puede regular positivamente la proliferación de algunas líneas de cáncer humanas. Dado que p38 tiene un papel coordinador de las respuestas inflamatorias, mientras que también regula negativamente la tranformación celular epitelial, hemos investigado cómo se compensan estas dos funciones en la tumorogénesis colorrectal asociada a colitis (CAC). Observamos que la depleción de p38 en las células epiteliales intestinales (IECs) de ratones aumentaba la tumorogénesis asociada a colitis sin afectar al tamaño del tumor, sugiriendo que la señalización epitelial de p38 suprime la iniciación tumoral. En consecuencia, la depleción de p38 en IECs resulta en un incremento del daño epitelial asociado a colitis e inflamación, lo que puede ser explicado por el aumento de permeabilidad paracelular y alteración de la homeostasis colónica observada en las IECs deficientes en p38. Sin embargo, no encontramos diferencias en el daño epitelial asociado a colitis, inflamación o tumorogénesis, cuando p38 fue deplecionada específicamente en las células mieloides. Notablemente, la depleción de p38 en las células epiteliales tumorales afecta a la proliferación e incrementa la apoptosis reduciendo la carga tumoral. Nuestros resultados indican que la señalización de p38 juega un papel dual en las IECs RESUMEN EN CASTELLANO 154 durante la tumorogénesis, suprimiendo los estadíos iniciales que conducen a la transformación celular, pero contribuyendo al mantenimiento de los tumores colorrectales. Además, la inhibición farmacológica de p38 redujo la carga de tumores de colon, sugiriendo que los inhibidores de esta ruta podrían ser terapéuticamente útiles para tratar el cáncer de colon. Introducción El cáncer es una enfermedad compleja que surge a través de un proceso mutagénico de múltiples etapas. Durante la transformación maligna, las células normales adquieren características claves como proliferación ilimitada, autosuficiencia en señales de crecimiento, falta de respuesta a señales antiproliferativas y evasión de la apoptosis (Hanahan and Weinberg, 2011). Para adquirir estas características, las células cancerosas inducen la reprogramación y reactivación de vías de señalización celulares que en circunstancias normales están fuertemente reguladas para mantener la homeostasis de los tejidos (Luo et al., 2009). p38 es una proteína quinasa activada por mitógenos (MAPK), esencial en las respuestas celulares al estrés, pero también en diversas funciones fisiológicas, incluidas la inflamación y homeostasis de los tejidos (Cuadrado and Nebreda, 2010; Wagner and Nebreda, 2009). Varios mediadores pro‐inflamatorios, incluyendo la ciclooxigenasa‐2 (COX‐2) y las citoquinas IL‐1, TNF‐ e IL‐6, pueden ser regulados por p38 (Gauthier et al., 2005; Kumar et al., 2003) mediante el control de su expresión a través de NFB (Saccani et al., 2002). La inactivación genética de p38 en células mieloides ha proporcionado evidencia de la importancia esta quinasa en la producción de citoquinas y en las respuestas inflamatorias in vivo, incluyendo los modelos de sepsis inducida por LPS, lesiones de piel provocadas por SDS y UVB, y colitis mediada por DSS (Kang et al., 2008; Kim et al., 2008a; Otsuka et al., 2010). Otra de las funciones de p38 es la regulación de la homeostasis de tejido mediante el equilibrio de los procesos de RESUMEN EN CASTELLANO 155proliferación y de diferenciación celular. p38 puede controlar la diferenciación de células madre embrionarias, así como de células epiteliales intestinales y de pulmón (Cuenda and Rousseau, 2007; Oeztuerk‐Winder and Ventura, 2012; Otsuka et al., 2010), mientras que regula negativamente la proliferación de muchos tipos celulares, incluyendo fibroblastos, cardiomiocitos, hepatocitos, células hematopoyéticas, y células epiteliales intestinales y de pulmón (Wagner and Nebreda, 2009). Curiosamente, los ratones deficientes en p38 son más susceptibles a la tumorogénesis de pulmón inducida por K‐ras, y la supresión específica de p38 en hepatocitos también promueve cáncer de hígado inducido por DEN/Pb, lo que puede ser explicado, al menos en parte, por la inhibición de la proliferación celular por p38 (Hui et al., 2007; Ventura et al., 2007). Estos resultados indican que p38 actúa como supresor de tumores in vivo. Sin embargo, hay poca evidencia de mutaciones que inactiven p38 en tumores, lo que probablemente refleja la capacidad de esta vía para controlar múltiples procesos celulares, y que es utilizada por las células cancerosas para supervivencia y/o proliferación. En consonancia con esta idea, hay evidencia de que p38 a veces puede regular positivamente la proliferación de líneas tumorales humanas, como de linfoma folicular, pulmón, tiroides, mama, gliomas, cáncer de cabeza y cuello, y carcinoma hepatocelular (Wagner and Nebreda, 2009). Por otra parte, se ha demostrado que SB202190 puede inducir autofagia en células de cáncer colorrectal y de ovario (Chiacchiera et al., 2009; Comes et al., 2007; Matrone et al., 2010). Sin embargo, se ha descrito que la inducción de vacuolas autofágicos por SB202190 es debido a un efecto no específico de este compuesto químico, y no a la inhibición de la señalización de p38 MAPK (Menon et al., 2011). Sin embargo, muchos estudios basados en cultivos celulares sugieren posibles efectos pro‐oncogénicos de la vía de señalización de p38. Los tumores colorrectales son de origen epitelial, y se desarrollan a partir de mutaciones secuenciales de diversos genes, incluyendo las vías de señalización de RESUMEN EN CASTELLANO 156 Wnt, ‐catenina, K‐ras, p53 y factor de crecimiento transformante (TGF)‐ (Fearon and Vogelstein, 1990; Ullman and Itzkowitz, 2011). Estas mutaciones pueden deberse a alteraciones genéticas o pueden ser inducidas por factores ambientales, tales como la inflamación crónica del epitelio del colon. Está bien establecido que la inflamación crónica puede conducir a un mayor riesgo de varios tipos de cáncer (Schetter et al., 2010). Por ejemplo, los pacientes con enfermedad inflamatoria intestinal (IBD), enfermedad de Crohn y con colitis ulcerosa, tienen mayor riesgo de desarrollo de cáncer colorrectal que la población sana (Ekbom et al., 1990a; Ekbom et al., 1990b; Gillen et al., 1994). Se ha demostrado que p38 regula la homeostasis del epitelio intestinal y su inflamación (Otsuka et al., 2010). Dado que ésta se ha asociado con un mayor riesgo de tumorogénesis colorrectal, en esta tesis se ha modulado la vía de señalización de p38 en dos tipos de células, las epiteliales intestinales (IECs) y las mieloides, para dilucidar el papel de p38 en la iniciación y la progresión de la tumorigénesis colorrectal asociada con la colitis crónica in vivo. Resultados La ausencia de p38 en IECs aumenta la tumorogénesis colorrectal asociada a colitis Para investigar el papel de p38 en la tumorogénesis colorrectal asociada a colitis (CAC), se utilizó un protocolo que combina el carcinógeno azoximetano (AOM) con sulfato de dextrano sódico (DSS), inductor de colitis (Neufert et al., 2007). Cuando aplicamos este protocolo a los ratones junto con la eliminación específica de p38 en IECs (ratones p38‐IEC) y los controles (WT) de camada (Figura 8), todos los ratones desarrollaron tumores de colon (Figura 8). El número de tumores macroscópicamente aparentes era mayor en ratones p38‐IEC en comparación con los animales control. Sin embargo, no existe cambio significativo en el tamaño medio de los tumores (Figura 8). RESUMEN EN CASTELLANO 157Un posterior análisis histológico de los tumores desarrollados tras el tratamiento AOM/DSS en ratones p38‐IEC y control no reveló ninguna diferencia relevante en el grado tumoral (Figura 9), implicando a p38 en el proceso de iniciación del tumor. En consonancia con esta idea, no hemos encontrado diferencias notables en la proliferación y la apoptosis entre los tumores procedentes de ratones p38‐IEC y control (Figura 9). A continuación se investigó si las diferencias en la tumorogénesis entre ratones p38‐IEC y control se debían a diferencias en la respuesta inicial al carcinógeno AOM. Tanto el daño inducido al ADN, revelado por los niveles de γ‐H2AX, así como los niveles de apoptosis, medido por la forma procesada de Caspasa 3, producidos por el AOM fueron muy similares en ambas situaciones (Figura 11). Estos resultados indican que la ausencia de p38 en las IECs no afecta a la respuesta inicial a AOM. Los ratones p38‐IEC son más susceptibles a la colitis inducida por DSS El protocolo de AOM/DSS depende en gran medida de la inflamación causada por ciclos repetidos de DSS (Neufert et al., 2007). Puesto que no se detectó ninguna diferencia en la primera respuesta a AOM, se investigó si las diferencias observadas en la tumorogénesis se debían a variaciones en inflamación y daño epitelial provocadas por DSS. Para probar esto, a los ratones se les administró 2% DSS durante 5 días en el agua para inducir colitis aguda. En este contexto se encontró que los ratones p38‐IEC perdían significativamente más peso que los ratones control (Figura 12). El análisis histológico reveló que los ratones p38‐IEC tratados con DSS tenían significativamente más daño epitelial e inflamación en la parte media‐distal en comparación con los controles (Figura 12 y 13). La cuantificación de la infiltración de células inmunes también reveló la presencia de más células infiltradas, incluyendo más macrófagos y células B en ratones p38‐IEC tratados con DSS. En consonancia con el aumento de células infiltradas en ratones p38‐IEC tratados con DSS, también encontramos un mayor nivel de RESUMEN EN CASTELLANO 158 expresión de mediadores pro‐inflamatorios tales como IL‐6 y la COX‐2 (Figura 14). El análisis de ARN mensajero procedente de cada tipo de población celular mostró que el aumento de mediadores pro‐inflamatorios en el colon de ratones p38‐IEC tratados con DSS era probablemente debido a la combinación del incremento de células infiltradas y el aumento de la expresión de estos los genes en los IECs deficiente en p38 (Figura 14). Sin embargo, el aumento de la expresión de IL‐6 correlacionaba con el aumento de la fosforilación de STAT3 y la activación de la vía NFB detectada por la fosforilación y degradación de IκB, una unidad inhibidora de NFB (Figura 15). Se cree que la inflamación del colon producida por DSS es debida a la inducción de apoptosis en el epitelio intestinal, lo que conlleva la disrupción física de la barrera compuesta por la mucosa, exponiendo a las células inflamatorias de la lámina propria a bacterias y productos bacterianos provenientes del lumen intestinal (Okayasu et al., 1990). Para comprobar si el aumento de la inflamación en ratones p38‐IEC podría deberse a la reducción en la supervivencia de células epiteliales tras el tratamiento con DSS, se analizó la apoptosis después de 3 días de exposición a DSS, encontrando más apoptosis en ratones p38‐IEC con respecto a los animales control. Este fenómeno podría deberse a la acumulación de la proteína pro‐apoptótica BAK (Figura 16). Dada la importancia de la IL‐6 en la proliferación y supervivencia de las células epiteliales intestinales (Bollrath et al., 2009; Grivennikov et al., 2009), se analizó la proliferación de células gracias a la detección de Ki67 por técnicas de inmunohistoquímica en el colon de ratones p38‐IEC y control tratados con DSS. A día 6, un día después de terminar la administración de DSS, en las áreas donde se presentaba una completa pérdida de criptas encontramos más células proliferativas en los ratones p38‐IEC que en los ratones control. Dicho incremento probablemente representaba un aumento en las poblaciones de IEC junto con células inflamatorias (Figura 17). En los días 9 y 13, durante la reparación y la regeneración del epitelio del colon, la proliferación detectada en las IEC fue mucho RESUMEN EN CASTELLANO 159mayor en ratones p38‐IEC que en ratones control (Figura 17). Estos datos indican que la ausencia de p38 tiene como resultado la hiperproliferación de las IECs después de la lesión inducida por DSS y colitis. Se ha mostrado que el daño continuo en tejidos presentes en un ambiente inflamatorio puede promover la tumorogénesis (Kuraishy et al., 2011). Para comprobar esta posibilidad, nuevamente inducimos daño repitiendo el tratamiento con DSS, pero en este caso sin el agente carcinógeno AOM. Curiosamente, alrededor del 60% de los ratones p38‐IEC desarrollaron al menos 1 tumor, mientras que los ratones control no desarrollaron ninguno (Figura 18). Por otra parte, encontramos más macrófagos F4/80+ en el colon de animales p38‐IEC, lo que también correlaciona con el aumento en mediadores inflamatorios, tales como COX‐2 e IL‐6 (Figura 19). En su conjunto, estos datos sugieren que el daño continuado sobre el epitelio, junto con la inflamación inducida por DSS en ausencia de p38, resulta en un microambiente pro‐tumorogénico y en la proliferación incontrolada de las IEC, que en última instancia desemboca en la inducción de hiperplasia en el colon y la formación de tumores. p38 regula la homeostasis y la permeabilidad celular intestinales La alteración en las funciones de la barrera epitelial se han asociado con IBD y la inflamación intestinal en seres humanos (Westbrook et al., 2010). Debido a que los ratones p38‐IEC en comparación con los controles presentaron una mayor pérdida de peso corporal, mayor daño epitelial, mayor inflamación e infiltración después de la colitis aguda inducida por DSS, nos llevó a proponer la hipótesis de que los ratones p38‐IEC podrían tener alteradas tanto la homeostasis como la permeabilidad intestinal. De hecho, cuando se analizó la proliferación y diferenciación de las IECs, se encontró que los ratones p38‐IEC presentaban un incremento de células proliferativas así como de células menos diferenciadas (Figura 21). El análisis de la permeabilidad intestinal, utilizando FITC‐dextrano, reveló que los ratones p38‐IEC mostraban un aumento de la permeabilidad RESUMEN EN CASTELLANO 160 intestinal, lo que coincide con zónulas oclusivas alteradas y reducción de ZO‐1, una proteína clave para el mantenimiento de las zónulas oclusivas (Figura 22). En conjunto, la alteración de la homeostasis intestinal junto con una función defectuosa de la barrera epitelial presente en los ratones p38‐IEC probablemente sean la causa de la mayor susceptibilidad a la colitis y al daño epitelial inducido por DSS, así como el cáncer de colon asociado a colitis aguda. La inducción de la depleción de p38 en células epiteliales tumorales reduce la carga tumoral El uso de inhibidores químicos de p38 para inhibir la proliferación de algunas líneas celulares de cáncer humano se ha descrito previamente (Wagner and Nebreda, 2009). Sin embargo, nuestro análisis genético indica que p38 suprime la formación de tumores de colon en las IEC no transformadas. Con el fin de aclarar el papel de p38 en la progresión de la tumorogénesis de colon, hemos generado una línea de ratones con Villin‐CreERT2 y alelos p38‐lox (p38‐IEC‐ERT2) donde la eliminación de p38 en IECs puede ser controlada por la administración de 4‐hidroxi‐tamoxifeno (4 ‐OHT). En primer lugar, ratones portadores de los alelos p38‐lox/Villin‐CreERT2 fueron sometidos al protocolo de AOM / DSS. Transcurridos 65 días de la inyección de AOM, la eliminación de p38 fue inducida administrando 5 inyecciones intraperitoneales consecutivas de 4‐OHT. 20 días después de la última inyección de 4‐OHT, los ratones fueron sacrificados y los tumores fueron analizados (Figura 24). Curiosamente, se observó una reducción estadísticamente significativa en el número de tumores macroscópicos, tamaño medio del tumor y la carga tumoral total en ratones p38‐IEC‐ERT2 en comparación con los ratones control que expresan p38 (Figura 24). Estos resultados indican un papel pro‐tumorogénico para la ruta de señalización de p38 en las células epiteliales transformadas del colon, remarcando la importancia de esta ruta en el mantenimiento del tumor. RESUMEN EN CASTELLANO 161Para determinar la base molecular responsable de la reducción en la carga tumoral en los ratones p38‐IEC‐ERT2, se realizó un estudio imunohistoquímico. El análisis del marcador de proliferación celular Ki67 reveló una reducción importante en el número de células proliferativas presente en los tumores de ratones p38‐IEC‐ERT2 en comparación con los ratones control, mientras que existía una mayor muerte celular en tumores provenientes de ratones p38‐IEC‐ERT2, detectada gracias al análisis del marcador de muerte celular, la forma procesada de la caspasa‐3 (Figura 26). A continuación se estudió el efecto de la ausencia de p38 en otras rutas claves de señalización, encontrando que la proliferación reducida y el aumento de la apoptosis observada en ratones p38‐IEC‐ERT2 correlacionaban con niveles elevados de fosfo‐JNK y reducción de los niveles de fosfo‐STAT3. Sin embrago, las rutas que indican pro‐supervivencia, ERK1/2 y AKT, no parecieron verse afectadas por la ausencia de p38 en las células de cáncer de colon (Figura 28). La inhibición sistémica de p38 reduce la carga de tumor de colon Siguiendo la misma dirección de nuestros resultados anteriores, planteamos la hipótesis de si la inhibición química de la ruta de señalización de p38 MAPK podría tener un efecto terapéutico en tumores de colon. Para ello utilizamos el inhibidor químico denominado PH797804, un nuevo compuesto que puede inhibir específicamente p38 con un IC50 de 26 nM (Goldstein et al., 2010). En este experimento, se indujeron tumores de colon mediante el protocolo AOM/DSS. Una vez confirmada la formación de tumores, los ratones fueron separados en dos grupos. La mitad de los ratones recibieron el tratamiento con PH797804 durante 12 días (desde el día 68‐80 después de la inyección AOM), y la otra mitad recibió el tratamiento con vehículo. Todos los ratones fueron sacrificados en el día 81 (Figura 29). Es importante destacar que hemos encontrado que los ratones tratados con el inhibidor de p38 tenían una carga tumoral reducida significativa desde el punto de vista estadístico, reflejado tanto en la disminución del número de tumores como en la reducción del tamaño de los mismos, comparados con los ratones control RESUMEN EN CASTELLANO 162 tratados sólo con vehículo (Figura 29). Estos resultados amplían nuestro análisis genético previo indicando un papel pro‐tumorogénico de la ruta de señalización de p38 en las células tumorales de colon. En conjunto, nuestros resultados indican que la ruta de señalización de p38 en células epiteliales transformadas contribuye a la tumorogénesis de colon, en contraste con el papel supresor tumoral de esta vía en el epitelio del colon normal. La supresión de p38 en las células mieloides no afecta a la colitis inducida por DSS y CAC Con el fin de estudiar el papel de las células mieloides (macrófagos y neutrófilos) en la colitis y el cáncer colorrectal asociado a colitis, se generaron ratones carentes de p38 en células mieloides (p38‐ΔMC) mediante el cruce de ratones p38 (lox/lox) con ratones LysM ‐Cre (Clausen et al., 1999), que expresan la recombinasa Cre bajo el promotor del gen de la lisozima M en macrófagos y granulocitos. A estos ratones se les administró 2% DSS durante 5 días en el agua para inducir colitis aguda y los cambios de peso corporal se registraron en días alternos. Encontramos que la pérdida de peso fue similar en ratones p38‐ΔMC comparados con ratones control (Figura 32). El análisis histológico no reveló ningún cambio significativo en la infiltración, ni tampoco se encontraron diferencias en el daño epitelial cuantificado en secciones teñidas con H&E de ratones p38‐ΔMC y control tratados con DSS (Figura 32). El DSS actúa principalmente sobre las células epiteliales del colon, siendo directamente tóxico para la capa epitelial del colon, induciendo inflamación y colitis. No hemos detectado ninguna diferencia significativa en el daño epitelial entre ratones p38‐ΔMC y control, lo que refleja una función normal de p38 en las células epiteliales del colon en ambos casos. Con el fin de investigar el posible papel de p38 en células mieloides en la formación de tumores de colon, se trataron ratones p38‐ΔMC y control con el protocolo de tumorogénesis de colon inducido por AOM/DSS, descrito RESUMEN EN CASTELLANO 163previamente para el modelo de ratones Villin‐Cre. En contraste con los resultados obtenidos en ratones p38‐ΔIEC, más susceptibles a la tumorogénesis inducida por AOM/DSS, no detectamos ninguna diferencia ni en el número ni en el tamaño de los tumores de colon entre los ratones p38‐ΔMC y control (Figura 34). El análisis histológico de los tumores que desarrollaron los ratones p38‐ΔMC y control no revelaron diferencias importantes en ninguno de los parámetros analizados (grado tumoral, proliferación, apoptosis y reclutamiento de macrófagos) (Figura 34). En conjunto, estos resultados indican que en células mieloides p38 no parece jugar un papel importante ni en el proceso de tumorogénesis de colon inducido por AOM/DSS, ni en la inflamación y colitis aguda inducida por DSS en nuestras condiciones experimentales (véase discusión). Discusión En el presente estudio mostramos que p38 desarrolla diferentes funciones en un modelo de cáncer de colon, tanto en las células epiteliales normales como en las tumorales. En cambio, su papel parece despreciable en las células mieloides. 1. La vía de señalización de p38 en IECs normales suprime CAC Estudiamos la función de p38 en células epiteliales intestinales usando el modelo de cáncer colorectal inducido por AOM/DSS, que genera tumores que se parecen tanto a nivel molecular como por su distribución a los tumores que encontramos en humanos (Neufert et al., 2007). En línea con la función supresora de tumores previamente descrita para p38 en el cáncer de pulmón e hígado (Hui et al., 2007; Ventura et al., 2007), vemos que la disminución de los niveles de la proteína p38 en las IECs aumenta la aparición de tumores asociados a colitis. Pero no encontramos diferencias significativas en cuanto al grado, tamaño medio, proliferación o apoptosis en los tumores de los ratones p38‐IEC cuando los comparamos con los animales control. Estos resultados indican que la proteína RESUMEN EN CASTELLANO 164 p38 esta implicada principalmente en la iniciación tumoral en las células IECs tratadas con el protocolo AOM/DSS. Los tumores inducidos con el protocolo de AOM/DSS son altamente dependientes del daño, y la inflamación causada en el epitelio por el DSS. En línea con lo publicado recientemente (Otsuka et al., 2010), nuestros resultados muestran que los animales en los que reducimos los niveles de p38 en las células epiteliales son más sensibles al daño causado por el DSS. En cambio, nosotros también observamos un aumento de infiltración celular en los ratones p38‐IEC. Esta discrepancia podría deberse al diferente fondo genético de los ratones, la dosis o el tiempo de tratamiento con DSS (Mahler et al., 1998; Stevceva et al., 1999). La muerte por apoptosis de las células epiteliales es uno de los mecanismos por el cual la exposición a DSS llevaría al desarrollo de inflamación y colitis. En este sentido, observamos que las IECs deficientes en p38 expuestas al tratamiento con DSS muestran mayores niveles de apoptosis debido a la acumulación de la proteína pro‐apoptotica BAK. Esta podría ser también la razón para el aumento de la inflamación que encontramos en estos ratones. En línea con esta hipótesis, existen artículos que muestran niveles altos de apoptosis en biopsias obtenidas de pacientes con tumores de IBD (Di Sabatino et al., 2003; Hagiwara et al., 2002; Iwamoto et al., 1996). Además, el aumento del daño producido en el epitelio y la apoptosis en los ratones p38‐IEC, correlaciona también con mayores niveles de los mediadores pro‐inflamatorios COX‐2 e IL‐6. Ambos son importantes para el desarrollo de la colitis y los tumores de colon asociados a colitis. Los niveles de COX‐2 se encuentran elevados en pacientes con IBD (Singer et al., 1998). La IL‐6 es una citoquina crítica para el desarrollo de tumores colorrectales a través de la regulación de la proliferación y supervivencia de las IECs a través del factor de transcripción RESUMEN EN CASTELLANO 165STAT3 (Becker et al., 2004; Bollrath et al., 2009; Grivennikov et al., 2009). La proteína NFB se activa rápidamente durante la inflamación aguda y contribuye al desarrollo del tumor a través de la inducción de la expresión de los mediadores de la infamación y factores del crecimiento (Greten et al., 2004; Karin, 2006). Tanto la vía de señalización de STAT3 como de NFkB se encuentran aumentadas en los ratones p38‐IEC después del tratamiento con DSS. También vemos cómo el aumento del daño que se ha producido en el epitelio de los ratones p38‐IEC correlaciona con un aumento de la proliferación de las IECs durante la fase de recuperación. Probablemente sea debido a una proliferación compensatoria similar a la que se ha descrito con anterioridad en otros modelos (Sakurai et al., 2008). El daño repetido en el tejido en un ambiente con alto contenido inflamatorio puede resultar en la iniciación del proceso tumoral y promoción de los estadíos tempranos de tumorogénesis debido a los procesos de reparación descontrolados (Kuraishy et al., 2011). En línea con esta hipótesis, nuestros resultados muestran que la inducción repetitiva de daño en el epitelio por el DSS produce una hiperproliferación de las IECs deficientes en p38, lo que es suficiente para inducir la formación del tumor en ausencia de AOM. Estos resultados identifican a la proteína p38 como un regulador clave en los procesos de reparación tisular e iniciación del proceso de tumorogénesis. Además, nuestros resultados muestran que la proteína p38 en las IECs es importante para el correcto mantenimiento de la homeostasis y la integridad del epitelio del colon. Adquiere particular importancia la observación de la reducción del número de células globet, productoras de moco, afectando a la capa protectora de mucinas que sirve como primera barrera para los patógenos o agentes dañinos. Además, los ratones p38‐IEC muestran un aumento de la permeabilidad intestinal que correlaciona con el mal funcionamiento de las uniones adherentes y los niveles reducidos de la proteína ZO‐1. Estas alteraciones se producen también en los RESUMEN EN CASTELLANO 166 pacientes con IBD (Das et al., 2012; Peeters et al., 1997; Schmitz et al., 1999). El requerimiento de la vía de señalización de p38 para mantener la homeostasis en el epitelio y la permeabilidad paracelular, sugieren que la activación de p38 en las IECs puede proporcionar nuevas oportunidades terapéuticas para los pacientes con IBD. 2. La vía de señalización de p38en IECs transformadas promueve el desarrollo de tumores colorrectales Diferentes modelos animales y cultivos celulares han proporcionado evidencia del papel supresor tumoral de p38. Pero existen estudios que sugieren que p38 podría también facilitar la proliferación y supervivencia en algunas líneas celulares humanas establecidas y en algunos modelos animales (revisado por (Wagner and Nebreda, 2009)). Aunque la mayoría de los estudios se basan en el uso de inhibidores químicos de p38 MAPK que pueden tener efectos no específicos (Bain et al., 2007; Fabian et al., 2005). Nosotros proporcionamos evidencias genéticas y farmacológicas que muestran la implicación de p38 en el desarrollo del cáncer de colon. La inactivación genética de p38 en las IECs transformadas reduce la carga tumoral, correlacionando con un aumento de la apoptosis y proliferación deficiente. Los resultados son parecidos cuando usamos un nuevo y potente inhibidor de p38, PH797804 (Goldstein et al., 2010; Hope et al., 2009). Observamos que la disminución de los niveles de p38 en los tumores de colon impide la fosforilación de la proteína STAT3, un importante regulador de la proliferación y supervivencia de la célula tumoral (Bollrath et al., 2009; Grivennikov et al., 2009). También encontramos un aumento en la expresión de las citoquinas de la familia de IL‐6. La producción de estas citoquinas podría establecer un mecanismo autocrino uniendo la actividad de p38 y la fosforilación de STAT3; aunque no podemos descartar que p38 pudiera regular otras rutas de RESUMEN EN CASTELLANO 167señalización que regularan a su vez STAT3 (Riebe et al., 2011). Otra alteración interesante que se produce cuando reducimos los niveles de p38 es el aumento de JNK, aunque no hemos profundizado en esta conexión en esta tesis. En conjunto, parece que la inducción de la fosforilación de la proteína STAT3 junto con la disminución de la vía de señalización de JNK contribuye al papel pro‐tumorogénico de p38 en el cáncer de colon de las IECs. Durante el proceso de transformación maligna, las células probablemente sufran una gran variedad de estrés, de manera que se vuelven dependientes no sólo de los oncogenes que inician la transformación, sino también de las vías que les son necesarias para sobrevivir. Es lo que conocemos como adicción no‐oncogénica (Luo et al., 2009). Nuestros resultados indican que la vía de p38 podría ser importante para el mantenimiento de los tumores de colon, funcionando como una vía adictiva no‐oncogénica en las células de cáncer de colon. De esta manera, el ataque esta vía, sola o en combinación con otros agentes quimioterapéuticos, podría proporcionar nuevas oportunidades para el tratamiento del cáncer de colon. 3. El papel de p38 en las células mieloides durante la inducción de colitis por DSS y CAC Como se ha descrito que la vía de p38 regula las respuestas inflamatorias tanto in vivo como in vitro, estudiamos si la deficiencia de esta proteína en macrófagos tenía algún efecto beneficioso en la colitis inducida por el DSS y CAC. Nuestros resultados muestras que la inhibición específica de p38 en las células mieloides no protege de la colitis inducida por el DSS. Estos resultados no coinciden con otros publicados anteriormente (Kardakaris et al., 2011; Otsuka et al., 2010; Seimon et al., 2009), lo que indicaría que las condiciones experimentales podrían producir pequeños cambios en la actividad de p38 que conducirían a resultados diferentes. Nuestros resultados demuestran que p38 en las células mieloides no afecta a la colitis asociada a cáncer colorectal. También sugieren que la inflamación y el daño RESUMEN EN CASTELLANO 168 inicial son importantes para el desarrollo de CAC, ya que no observamos diferencias entre los animales control y p38‐MC, ni al inicio del tratamiento con DSS, ni al final en la formación de tumores. Aún así, ese necesitan más estudios para poder definir con claridad el papel de p38 en tumores de estadíos avanzados. Los modelos de ratón modificados genéticamente con habilidad para modular la actividad en el tiempo y en el tejido de p38 serían claves para entender el papel de esta proteína en cada uno de los compartimentos celulares y las relaciones que se establecen entre ellos. Conclusiones 1. p38 regula la homeostasis y mantiene la función protectora de las células del epitelio intestinal. 2. En respuesta a colitis, p38 controla el daño a las células epiteliales y la inflamación. 3. p38 regula negativamente la iniciación de tumores asociados a colitis en células epiteliales del colon. 4. p38 es necesaria para la proliferación y la supervivencia de las células tumorales de colon. 5. p38 en las células mieloides no parece tener un papel importante en colitis y en cáncer de colon asociada a colitis. 6. p38  podía ser considerada como una posible diana terapéutica en cáncer de colon.

p38α MAPK in inflammation‐associated colorectal cancer

Abstract

Similar works

Full text

Available Versions

Biblos-e Archivo