Demetris, AJ

Fu, F

Fung, JJ

Li, Y

Lu, L

Noyola, H

Qian, S

Rao, AS

Rudert, WA

Starzl, TE

Thomson, AW

Trucco, M

English

PubMed

Name not available

Propagation of cells expressing donor phenotype (MHC Class I, II and Y-chromosome) from the bone marrow of murine liver allograft recipients in response to GM-CSF in vitro

D-Scholarship@Pitt

DENDRITIC CELLS Propagation of Cells Expressing Donor Phenotype (MHC Class I, II and V-Chromosome) From the Bone Marrow of Murine Liver Allograft Recipients in Response to GM-CSF In Vitro L. Lu, W.A. Rudert, H. Noyola, S. Qian, F. Fu, Y. Li, AS. Rao, AJ. Demetris, J.J. Fung, M. Trucco, i . T.E. Starzl, and AW. Thomson i AN unresolved issue with the recent demonstration of persistent low-level donor leukocyte chimerism fol-lowing organ transplantation 1.2 has been the means by which the chimeric cells can perpetuate themselves for long periods postoperatively. This question was addressed in mice by transplantation without immunosuppression across MHC class I-II and mHC disparities using a strain combi-nation (B10-+C3H) that permits permanent acceptance of the liver. but not other allogeneic organs.J A method used previously to propagate dendritic cell progenitors from nonnal mouse spleen or liver· was implemented to ascer-tain whether. in addition to host-derived cells. cells of donor phenotype could be propagated from the lymphoid tissue (bone marrow and spleen) of liver-transplant recipients. For comparative purposes. similar techniques were applied to cells propagated from the lymphoid tissues of unmodi-fied e,11 mice that rejected cardiac allografts from the same donor stram. MATERIALS AND METHODS Animals Ten to twelve-week-old C57BUlOJ (BIO. H_2h. I-A". I·E-) and C3H!HcJ (C3H. H-2". I_Ak. I_Ek) mic.: were ohtained from The Jackson Lahoratory. Bar Harbor. Me. Thev were maintained in the specific pathogen-free facility of the Universitv of Pittsburgh Medical Center. Uver and Heart Transplantation Ol1hotoplc liver transplantation (OL Tx) was p.:rtormed lIsing techniques descnhed previouslv.' with minor moditications. I kle-rotOPIC heart transplantation I HHTx) was adapted from the rat proccdure of Ono and Lindsev." The heart was transplanted into the abdomen with end-to-side anastomosIs of aorta to aorta and pulmonarY arterY to vena cava. Rejecllon was detined bv th.: cessation of cardiac contraction after daily palpatlon through the abdomtnal wall. and contirmed hv histological examination. No immunosuppressive therapy was used and animals (three per grouP) wae sacrificed I .. days after OLTx and I) days after HHTx. Culture of Tissue-Derived Cells Before harvesting of organs. whole body perfusion was performed. Bone marrow. spleen. and thymus cell suspensions were prepared in RPMI-1640 (Gibco. Grand Island. NY). using conventional methods: liver nonparenchymal cells (NPC) (hepatocyte contami-nation 55%) were isolated as described previously.· Two-5 X 10" cells were cultured in 2.f-well plates in RPMI-1640. supplemented with 10% fetal bovine serum and 0.4 ng/mL mouse recombinant granulocyte-macrophage colony-stimulating factor (GM-CSF) (R&D Systems. Minneapolis. ~linn). The procedure used was modified after that described by Inaba et al 7 for the propagation of large numbers of dendritic c.:11 progenitors from mouse bone marrow. The medium containing GM-CSF was refreshed every 2 days: after gentle swirling of the plates. half of the old medium was aspirated and an cqulvalent volume of RPMI-I640 with GM-CSF was added. An ohjective of this manipulation was to deplete nonadherent granulocytes. without dislodging clusters of develop-ing dendritic cells that attached loosely to a monolayer of firmly adherent macrophages. Morphological and phenotypic analyses of typical. single. nonadherent mononuclear cells released spontane-ously from clusters were performed between band IO days. From the Pittsburgh Transplantation Institute and the Depart-ments of Surgery. Pathology. and PediatriCS. University of Pitts-burgh Medical Center. Pittsburgh. Pennsylvania. Supported by National Institutes of Health grant no. DK 29961-14. Address reprint requests to A.W. Thomson. DSc. W1544 Biomedical Science Tower. Department of Surgery. University of Pittsburgh Medical Center. Pittsburgh. PA 15213. Q 1995 by Appleton & Lange 0041-1345/95/$3.00/ +0 191 '., Ttansplantation Proceedings. Vol 27. No 1 (February), 1995: pp 191-193 192 Flow Cytometric Analysis Cultured cells (5 X lOS/tube) in Hank's balanced salt solution (HBSS) containing 1% w/V bovine serum albumin (Sigma. St. Louis. Mo) and 0.1% sodium azide (Sigma) were stained by direct immunofluorescence. Donor and recipient-specific MHC class I positive cells were identified using FITC-conJugated mouse anti-mouse H-2Kb and H-2Kk monoclonal antibodies (MAbs) (IgG2a; PharMingen. San Diego, Calif), respectively. FITC-conjugated mouse IgG2a was used as a negative isotype control. After staining, the cells were fixed in 1% paraformaldehyde in saline. Flow cytometric analysis was performed using a FACSTARqI} flow cy-tometer (Becton Dickinson. San Jose. Calif) and 5000 events were analyzed for each sample. Immunocytochemistry Cytocentrifuge preparations of the cultured cells were processed and stained using the avidin-biotin-peroxidase complex (ABC) procedure. as described elsewhere.~ Biotinylated mouse IgG2a anti-I-Ek or anti-I-Ah MAbs (PharMingen) were used to demon-strate expression of recipient and donor MHC class II antigens. respectively. Controls included the omission of primary antibody and the use of isotype-matched. irrelevant MAb. Detection of Donor Male (y) Chromosome by Polymerase Chain Reaction (PCR) DNA was prepared from freshly isolated and IO-day GM-CSF-stimulated cells from both normal male BIO and female C3H mice and from female C3H mice 14 or 8 days, respectively, after liver or heart transplantation from male BIO donors. The presence of male donor cells was determined by PCR amplification of the SRY region of the mouse Y chromosome from DNA extracted from the various cell preparations. Primers (CAGCCCTACAGCCACAT and CCACTCCTCTGTGACACTTT) were chosen from the p4.2.2 sequence." The amplified DNA was Southern blotted and hybrid-ized with a homologous radioactive probe. as previously described for human analysis." RESULTS Incidence of Donor MHC Class I Positive Cells in LymphOid Tissues of Liver-Allografted Mice The incidence of chimeric cells in freshly isolated recipients' bone marrow or spleen 14 days after OLTx was determined by flow cytometric analysis. The results were compared to those obtained using freshly isolated cells from naive un-modified mice of either donor (810) or recipient (C3H) strain. The proportion of donor (810) MHC class I positive cells (H_2h +) was low (from 0% to 5%) in the bone marrow. spleen. and thymic cell populations of the transplanted animals. Propagation of Donor and Recipient MHC Class I or MHC Class II Positive Cells From Bone Marrow and Spleen of Liver Allograft Recipients In Response to GM-CSF GM-CSF-stimulated cells derived from freshly isolated bone marrow. spleen. or thymus of liver-allografted mice grew more actively than cells from naive animals. More-over. in the former cultures. more clusters developed from which larger numbers of cells, with similar dendritic mor-LU, RUDERT. NOYOLA ET AL DETECTION OF THE Y CHROMOSOME IN CELLS CULTURED FROM FEMALE RECIPIENTS OF MALE UVERS BM S T NPC 0'.10 PERCENT MALE , C' l"I C' C' ~ ,. Fig 1. Detection of the Y chromosome in cells cultured from female recipients of male livers. One-1L9 aliquots of DNA ob-tained from 10-day bone marrow (8M), spleen (S), thymus (T). or from day 0 and day 10 liver NPC cultures were amplified with 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds in buffer consisting of 50 mmolJL KCI, 10 mmolJL Tris-HCI pH 8.3, 1.5 mmol/L MgCI2, 0.2 mmolJL deoxynucleo-tides. 0.1 % gelatin. 0.2 ILmollL primers. and 2.5 units of Taq polymerase (Perkin Elmer, Norwalk. Conn). The products were separated in a 1 % agarose gel, transferred to nylon membrane. and hybridized with an identical. purified, and radiolabelled PCR product from male mouse DNA. Single copy sensitivity and male specificity were verified with control samples consisting of serial dilutions of male mouse DNA into female mouse DNA. phology, were released. Nonadherent cells were harvested 10 days after initiation of the cultures. The expression of donor or recipient MHC class I antigens was determined using appropriate MAbs and flow cytometric analysis. In addition to the propagation of recipient cells in response to GM-CSF, donor-derived cells expressing H-2Kb were de-tected both in the bone marrow and in the spleen cell cultures. The presence of cells expressing donor MHC allo-antigens was confirmed by immunocytochemical anal-ysis of cultures stained for donor MHC class II (H_2h ). Detection of donor Y chromosome by PCR analysis (Fig I) confirmed the growth of donor-derived cells in the lO-day bone marrow cell cultures and reinforced the immunocyto-chemical observations. Although Y chromosome was also detected in lO-day spleen cell cultures. the signal was reduced substantially compared to that with bone marrow (Fig 1), indicating that comparatively few donor-derived. GM-CSF-responsive precursors reached the spleen. The apparent diminished signal for donor cells in the GM-CSF-stimulated liver NPC population (Fig I) may actually reflect death of contaminating hepatol.-ytes; in addition, in situ replacement of donor with recipient GM-CSF-responsive cells may contribute to a reduced donor signal from liver NPC on day 10. Y chromosome was also detected in freshly isolated bone marrow and spleen cells from unmodified heart allograft recipients isolated ~ days posttransplant. In contrast to cells from liver-transplanted mice. however. Y chromosome was not detected in lO-day cultures propa-gated from either bone marrow or spleen after heart transplantation (data not shown). ," -\L o om )b-. or 30 ~·C Jill eo-raq 'ere me, 'CR lale ~rial ,ted 1 of ned . In e to de-cell (He mal-.2b). ig 1) '-day :yto-also PROPAGATION OF CELLS DISCUSSION We have reported previously that, after local or systemic InJeclion of GM-CSF-stimulated. Iiyer dendritic c~1I pro-~enltllr, (MHC class I1- IU1m ) into unmodified, MHC-dis-parate recipients. donor cells (MHC class I1"ri~hl) can be Idenllfied within recipient central lymphoid tissues. 4 These oM~a\'ations have now been extended to the context of whole organ transplantation. Cells harvested from the bone marrow and spleen 14 days after liver transplantation and cultured for 10 days in GM-CSF-supplemented medium, Ineluded a minor population of cells with DC characteristics expressing donor phenotype (MHC class 1/11 and Y chro-mosome). These findings offer an explanation for the persistence of low-level chimerism in BIO-+C3H liver transplant recipients,:! which do not require host immuno-suppression. In contrast. in unmodified hosts rejecting their cardiac allografts (day 8), propagation of donor cells ex vivo could not Me irrefutably demonstrated. This finding is wnslstcnt with the liver containing comparatively large numMers 01 potential migratory hematopoietic cells. includ-III!! DC progenitors that have the capacity to propagate ex \1\" \;lS lkmonstrated herein), or in vivo in response to the 193 appropriate growth factors. the functional role of the precursors of chimeric DC is currently being investigated. The observation that donor as well as recipient cells un-dergo reciprocal migration after liver transplantation is congruent with the paradigm of bidirectional immune re-activity. which may playa major role in whole organ graft acceptance and acquired tolerance. REFERENCES 1. Starzl TE. Demetris AJ. Murase N. et al: Lancet 339: 1579. 1992 2. Starzl TE. Demetris AJ. Trucco M, et al: Hepatology 17: 1127. 1993 3. Qian S. Demetris AJ. Murase N. et al: Hepatology 19:916. 1994 4. Lu L. Woo J. Rao AS, et al: J Exp Med 179:1823. 1994 5. Qian S. Fung JJ, Demetris AJ, et al: Transplantation 52:562. 1991 6. Ono K. Lindsey ES: J Thorae Cardiovase Surg 7:225. 1969 7. Inaba K. Inaba M. Romani N. et al: J Exp Mcd 176:1693. 1992 H. Gubbay J. Collignon J. Koopman P. et al: Nature 346:245. 1990 9. Starzl TE. Demetris AJ, Trueeo M. et al: Lancet 340:876.1992 

Propagation of cells expressing donor phenotype (MHC class I, II and Y- chromosome) from the bone marrow of murine liver allograft recipients in response to GM-CSF in vitro

http://d-scholarship.pitt.edu/5123/1/31735062125459.pdf

Propagation of cells expressing donor phenotype (MHC class I, II and Y- chromosome) from the bone marrow of murine liver allograft recipients in response to GM-CSF in vitro

Abstract

Similar works

Full text

Available Versions

Name not available

D-Scholarship@Pitt

Name not available