Overexpression of gluconeogenic phosphoenolpyruvate carboxykinase (PCK) under glycolytic conditions enables Escherichia coli to maintain a greater intracellular ATP concentration and, consequently, to up-regulate genes for amino acid and nucleotide biosynthesis. To investigate the effect of a high intracellular ATP concentration on heterologous protein synthesis, we studied the expression of a foreign gene product, enhanced green fluorescence protein (eGFP), under control of the T7 promoter in E. coli BL21(DE3) strain overexpressing PCK. This strain was able to maintain twice as much intracellular ATP and to express two times more foreign protein than the control strain. These results indicate that a high energy-charged cell can be beneficial as a protein-synthesizing cell factory. The potential uses of such a cell factory are discussed

Hye Jung Kim

Pil Kim

Sang Yup Lee

Yeong Deok Kwon

English

Nature Precedings

1G
G
High energy-charged cell factory for heterologous protein synthesis. XG
 YG
Yeong Deok Kwon1, Hye Jung Kim1, Sang Yup Lee2, and Pil Kim1 ZG
 [G
1Department of Biotechnology, Catholic University of Korea, Bucheon, Gyunggi 420-\G
743, Korea; ]G
2Department of Chemical and Biomolecular Engineering, KAIST, Daejon 305-701, ^G
Korea. _G
 `G
 XWG
Correspondence to XXG
Pil Kim, Ph.D., Asso. Prof.  XYG
 XZG
Department of Biotechnology X[G
Catholic University of Korea, X\G
Bucheon, Gyunggi 420-743, Korea X]G
 X^G
T. +82-2-2164-4922 X_G
F. +82-2-2164-4865 X`G
E. kimp@catholic.ac.kr YWG
 YXG
  YYG
2G
G
Overexpression of gluconeogenic phosphoenolpyruvate carboxykinase (PCK) YZG
under glycolytic conditions enables Escherichia coli to maintain a greater Y[G
intracellular ATP concentration and, consequently, to up-regulate genes for amino Y\G
acid and nucleotide biosynthesis. To investigate the effect of a high intracellular Y]G
ATP concentration on heterologous protein synthesis, we studied the expression of Y^G
a foreign gene product, enhanced green fluorescence protein (eGFP), under control Y_G
of the T7 promoter in E. coli BL21(DE3) strain overexpressing PCK. This strain Y`G
was able to maintain twice as much intracellular ATP and to express two times ZWG
more foreign protein than the control strain. These results indicate that a high ZXG
energy-charged cell can be beneficial as a protein-synthesizing cell factory. The ZYG
potential uses of such a cell factory are discussed. ZZG
Z[G
 Z\G
Z]G
3G
G
Introduction Z^G
Adenosine triphosphate (ATP) is the universal energy currency of the cell, transferring Z_G
the chemical energy from metabolism to various biological activities in all life forms on Z`G
earth1. ATP is produced during the processes of photosynthesis, fermentation, and [WG
respiration, and it is consumed by many processes, such as biosynthesis, motility, cell [XG
signaling, and cell division. ATP consists of adenosine and three phosphates and [YG
chemical energy is released by cleavage of a phosphate to produce adenosine [ZG
diphosphate (ADP) + phosphate. Since ATP is an unstable molecule, it is hydrolyzed [[G
spontaneously and therefore is continuously recycled in living organisms; i.e., a human [\G
turns over the equivalent of its body weight in ATP every day2. It is well known that the []G
intracellular ATP concentration is one of the most important factors for cellular [^G
physiology, since it regulates many cellular events, such as growth3, ribosomal RNA [_G
synthesis4, and cellular metabolic pathways5. [`G
Biomaterial synthesis is an age-old knowledge involved in the manufacturing of bread, \WG
beer, wine, and cheese. The recent concept of biomaterial synthesis, however, is the use \XG
of live cells as factories for manufacturing highly valued biomaterials, such as proteins, \YG
amino acids, alcohols, organic acids, solvents, as well as bioplastics used in molecular \ZG
biology and bioinformatics6. Many living cell factory models have been studied for the \[G
4G
G
synthesis of a variety of biomaterials: Escherichia coli7, Bacillus subtilis8, \\G
Corynebacterium glutamicum9, yeast10, lactic acid bacteria11, thermophile12, \]G
actinomycetes13, filamentous fungi14, plant cells15, and mammian cells16.  \^G
Some reports have described reduced macromolecular synthesis in the presence of a \_G
lower intracellular concentration of ATP17. Conversely, one might expect that a higher \`G
than normal intracellular ATP level would be beneficial for biomaterial synthesis in cell ]WG
factories. Enhanced production of intracellular ATP by overexpression of gluconeogenic ]XG
phosphoenolpyruvate carboxykinase (PCK) under glycolytic conditions enables E. coli ]YG
to up-regulate genes for amino acid and nucleotide synthesis as well as flagella ]ZG
components18 (Fig. 1), a finding which strengthens the above hypothesis. A mouse ][G
whose cell constitutively express PCK has been reported to be super athlete since it ran ]\G
over 6 km when control mouse only ran 0.2 km19. Therefore, a verification of the high ]]G
energy-charged single cell as a factory works better for human purposed biomolecule ]^G
synthesis is required.  ]_G
In this paper, we artificially expressed heterologous enhanced green fluorescence ]`G
protein (eGFP) in E. coli BL21(DE3) that maintain a high intracellular ATP to ^WG
determine whether this strain is eligible for use as a powerful, protein-synthesizing cell ^XG
factory. The potential uses of such a high energy-charged cell factory are also discussed. ^YG
5G
G
Results^ZG
To estimate heterologous protein expression in a high energy-charged cell, enhanced ^[G
green fluorescence protein (eGFP) was expressed under control of the T7 promoter in ^\G
an E. coli BL21(DE3) host (Table 1). Strain BL21(DE3) was the control host while ^]G
BL21(DE3) expressing phosphoenolpyruvate carboxykinase (PCK) was the high ^^G
energy-charged host. Strain BL21(DE3)/pEGFP (BL21[DE3] expressing eGFP by the ^_G
T7 promoter) and BL21[DE3]/pEcPCK/pEGFP (BL21[DE3] co-expressing eGFP by the ^`G
T7 promoter and PCK by the trc promoter) were inoculated in LB-glucose medium _WG
containing 50 g/mL of antibiotics. An isopropyl--D-thiogalactopyranoside (IPTG, 1 _XG
mM) was supplemented in the log phase (optical density; O.D. = 0.6) to induce eGFP _YG
expressions. The intracellular ATP concentrations after 6 h induction was 43.1 nmol/mg-_ZG
protein for the BL21(DE3)/pEGFP and 84.5 nmol/mg-protein for the _[G
BL21(DE3)/pEcPCK/pEGFP, which harbored 2-times greater [ATP]. The BL21(DE3) _\G
expressing PCK showed same pattern of greater [ATP] than that of BL21(DE3) (42.3 vs. _]G
78.4 nmol/mg-protein). The total protein contents of BL21(DE3)/pEGFP was 0.60 _^G
mg/mL and that of the BL21(DE3)/pEcPCK/pEGFP was 0.55 mg/mL. The amount of __G
eGFP expression in BL21(DE3) overexpressing PCK was 957.8 RF(relative _`G
fluorescence)/mL, which is more than 2-times greater than that observed for the control `WG
6G
G
strain (443.5 RF/mL) (Fig 2). The specific amount of eGFP produced by the unit cell of `XG
high energy-charged E. coli (1741.5 RF/mg-protein) was 2.4-times greater than that `YG
produced by the control (739 RF/mg-protein). `ZG
 `[G
Discussion `\G
The high energy-charged E. coli was beneficial for the expression of foreign protein `]G
(Table 1, Fig. 2, Suppl. 1). One explanation for this result could be that these high `^G
energy-charged cells up-regulate the genes for biosynthesis of amino acids18, thus `_G
increasing amino acid biosynthesis turnover. An increase in the rate of production of ``G
ribosomes by cells at a higher energy state has been reported4 and it is another potential XWWG
explanation for the observed enhancement of foreign protein synthesis (Suppl. 2). The XWXG
decreased growth rate observed for the high energy-charged cells were found in the LB-XWYG
glucose and the minimal glucose medium (data not shown) and that is reasonable XWZG
considering that a high energy charge has been reported to limit the cellular growth by XW[G
restriction of the glycolytic flux20, under such conditions, the carbon would be re-XW\G
directed to foreign protein synthesis rather than to growth. E. coli BL21(DE3) has been XW]G
widely used for production of recombinant proteins and the whole genome sequence of XW^G
BL21(DE3) was reported lacks of genes for the motility (21 fli genes) as well as Lon XW_G
7G
G
protease 21. The amount eGFP from the high energy-charged BL21(DE3) host (957.8 XW`G
RF/mL) was found to be about 57% more than that from the high energy-charged XXWG
W3110(DE3) host (610.1 RF/mL, Spuppl. 3). Lacks of motility in BL21(DE3) would XXXG
have saved energy for movement and produced more proteins than that in flagella XXYG
moving W3110(DE3) strain, which also supports that the more [ATP] contributes more XXZG
foreign protein expression hypothesis. Aminoacyl-tRNA synthetase requires ATP to XX[G
mediate amino acid-charged tRNA synthesis. The mRNA concentrations of alanyl-XX\G
tRNA synthetase and glutaminyl-tRNA synthetase in the high energy-charged XX]G
BL21(DE3)/pEcPCK was 1.5-times higher than those in BL21(DE3) control (Suppl. 4), XX^G
which implying greater intracellular [ATP] might have contributed the enhanced protein XX_G
synthesis by providing more AA-charged tRNA during translation process. In XX`G
combination, reduction in growth rate, the increase in the size of the amino acids XYWG
turnover, the enhanced production of ribosomes, and the more charged tRNA would XYXG
have a synergistic effect on foreign protein synthesis.  XYYG
The use of high energy-charged cells could be beneficial to other cell factory XYZG
applications in addition to foreign protein synthesis. For instance, high energy-charged XY[G
cells might be able to enhance the production of a metabolite such as succinic acid, a XY\G
widely used specialty chemical22. When a recombinant cell directs its metabolism XY]G
8G
G
toward production of a target metabolite, it tends to restrict its metabolic pathways by XY^G
way of feedback control. If the target metabolite remains inside the cell factory, and XY_G
accumulates to a high concentration, it would eventually inhibit its own synthesis. XY`G
Active transport the of target metabolite using the energy of the high-powered cell XZWG
factory could prevent feedback control from occurring, thereby enabling synthesis via XZXG
the desired pathways to continue unabated23. In addition to the export of products, the XZYG
high-level intracellular energy could be useful for the import of raw materials into the XZZG
cell factory; one could expect to increase the rate of biomaterial synthesis once the XZ[G
regulation of the carbon influx by the high energy-charged cells is understood. Secretion XZ\G
and surface display of proteins might also be enhanced by the availability of high-level XZ]G
intracellular energy24.  XZ^G
It is not clear whether high energy-charged cells other than E. coli would be better XZ_G
suited as cell factories for foreign protein synthesis. Studies on the engineering and use XZ`G
of other types of cells (i.e., yeast, mammalian cell) as high energy-charged cell factories X[WG
are therefore needed. X[XG
X[YG
MethodsX[ZG
Strain and plasmids X[[G
9G
G
All strains, plasmids, and oligonucleotides are summarized in Table 2. The gene for X[\G
eGFP was amplified by PCR using the oligonucleotides of gaattcatggtgagcaagggcgagga X[]G
(EcoRI site underlined; forward I primer) and ctcgagcttgtacagctcgtccatgcc (XhoI site X[^G
underlined; reverse primer) based on pMEGFP as a template. The resulting DNA X[_G
fragment (0.7 kb) was sub-cloned into an expression vector (pET41a, Novagen, X[`G
Darmstadt, Germany) after sub-cloning into a PCR-cloning vector (pGEM-T easy X\WG
vector, Promega, Madison, WI, USA), verification by DNA sequencing (Bioneer Co., X\XG
Daejon, Korea), and double digestion with EcoRI and XhoI, resulting pEGFP for eGFP X\YG
expression. The constructed vectors were transformed into the BL21(DE3) and X\ZG
BL21(DE3)/pEcPCK strains by electrophoration (BTX ECM, Harvard Apparatus, X\[G
Holliston, MS, USA). X\\G
 X\]G
Media and culture  X\^G
Luria-Bertani medium was used for routine DNA manipulations. The LB-glucose X\_G
medium contained glucose (9 g/L), NaHCO3 (10 g/L), yeast extract (5 g/L), tryptone X\`G
(10 g/L), NaCl (10 g/L), and antibiotics (ampicillin and kanamycin, 50 g/mL)25. Single X]WG
colony was inoculated into a 15-mL tube containing 4 mL medium and maintained at X]XG
37ºC and 250 rpm for 12h. Four hundred microliter of culture was transferred into a X]YG
10G
G
250-mL Erlenmeyer flask containing 50 mL medium and maintained at 37ºC and 250 X]ZG
rpm. When the optical density (O.D.) of culture reached 0.6, isopropyl--D-X][G
thiogalactopyranoside (IPTG, 1 mM) was supplemented to allow eGFP expression. X]\G
After 6 h after IPTG induction, culture was withdrawn for the analysis. X]]G
 X]^G
Analysis X]_G
Biomass was estimated by measuring O.D. at 600 nm. Intracellular [ATP] and PCK X]`G
enzyme activity were determined as described previously26. The protein concentration X^WG
of the enzyme solution was determined using a protein assay kit (Bio-Rad, La Jolla, CA, X^XG
USA) with bovine serum albumin as a standard after the sonic disruption of the sample X^YG
for 5 min at 140 W on ice using a UP200S ultrasonic processor (Hielscher Ultrasonics X^ZG
Co., Teltow, Germany). To estimate the amount of eGFP expression, a 700 L-sample X^[G
was subjected to fluorescence spectroscopy (RF-5301PC, Shimadzu, Kyoto, Japan) with X^\G
excitation at 395 nm and emission at 509 nm. Cells were observed using phase contrast X^]G
and fluorescence microscopy (AX-70, Olympus Co, Tokyo, Japan). X^^G
 X^_G
Acknowledgement X^`G
This work was supported by the Korean Ministry of Education, Science, and X_WG
11G
G
Technology (M01-2008-2003464, R01-2007-00020231-0, R01-2009-0070677). X_XG
 X_YG
X_ZG
References  X_[G
X_\G
1 J. R. Knowles, Annual review of biochemistry 49, 877 (1980). X_]G
2 S. Tornroth-Horsefield and R. Neutze, Proceedings of the National Academy of X_^G
Sciences of the United States of America 105 (50), 19565 (2008). X__G
3 C. Petersen and L. B. Moller, The Journal of biological chemistry 275 (6), 3931 X_`G
(2000). X`WG
4 T. Gaal, M. S. Bartlett, W. Ross et al., Science (New York, N.Y 278 (5346), 2092 X`XG
(1997). X`YG
5 J. M. Rohwer, P. R. Jensen, Y. Shinohara et al., European journal of X`ZG
biochemistry / FEBS 235 (1-2), 225 (1996); A. Kayser, J. Weber, V. Hecht et al., X`[G
Microbiology (Reading, England) 151 (Pt 3), 693 (2005). X`\G
6 A. Danchin, Microbial cell factories 3 (1), 13 (2004). X`]G
7 C. P. Chou, Applied microbiology and biotechnology 76 (3), 521 (2007). X`^G
8 L. Westers, H. Westers, and W. J. Quax, Biochimica et biophysica acta 1694 (1-X`_G
3), 299 (2004). X``G
9 O. Kirchner and A. Tauch, Journal of biotechnology 104 (1-3), 287 (2003). YWWG
12G
G
10 R. E. Spier, Enzyme and microbial technology 26 (9-10), 639 (2000). YWXG
11 J. Hugenholtz, M. Kleerebezem, M. Starrenburg et al., Appl Environ Microbiol YWYG
66 (9), 4112 (2000). YWZG
12 A. Hidalgo, L. Betancor, R. Moreno et al., Appl Environ Microbiol 70 (7), 3839 YW[G
(2004). YW\G
13 T. J. Oh, S. J. Mo, Y. J. Yoon et al., J Microbiol Biotechnol 17 (12), 1909 (2007). YW]G
14 D. B. Archer, Current opinion in biotechnology 11 (5), 478 (2000). YW^G
15 R. Verpoorte, R. van der Heijden, and J. Memelink, Transgenic research 9 (4-5), YW_G
323 (2000). YW`G
16 K. Sainio and A. Raatikainen-Ahokas, The International journal of YXWG
developmental biology 43 (5), 435 (1999). YXXG
17 N. J. Snoeij, H. J. van Rooijen, A. H. Penninks et al., Biochimica et biophysica YXYG
acta 852 (2-3), 244 (1986); C. Oliveras-Ferraros, A. Vazquez-Martin, J. M. YXZG
Fernandez-Real et al., Biochemical and biophysical research communications YX[G
378 (3), 488 (2009). YX\G
18 Y. D. Kwon, S. Y. Lee, and P. Kim, Bioscience, biotechnology, and biochemistry YX]G
72 (4), 1138 (2008). YX^G
19 R. W. Hanson and P. Hakimi, Biochimie 90 (6), 838 (2008). YX_G
13G
G
20 B. J. Koebmann, H. V. Westerhoff, J. L. Snoep et al., Journal of bacteriology YX`G
184 (14), 3909 (2002). YYWG
21 H. Jeong, V. Barbe, C. H. Lee et al., Journal of molecular biology (2009). YYXG
22 I. J. Oh, H. W. Lee, C. H. Park et al., J Microbiol Biotechnol 18 (5), 908 (2008). YYYG
23 R. M. Zelle, E. de Hulster, W. A. van Winden et al., Appl Environ Microbiol 74 YYZG
(9), 2766 (2008). YY[G
24 T. J. Park, S. K. Choi, H. C. Jung et al., J Microbiol Biotechnol 19 (5), 495 YY\G
(2009). YY]G
25 Y. D. Kwon, O. H. Kwon, H. S. Lee et al., J Appl Microbiol 103 (6), 2340 YY^G
(2007). YY_G
26 Y. D. Kwon, S. Y. Lee, and P. Kim, J Microbiol Biotechnol 16 (9), 1448 (2006). YY`G
 YZWG
 YZXG
  YZYG
14G
G
List of Table YZZG
Table 1. Effect of intracellular ATP level on eGFP expression. YZ[G
Table 2. Strains and plasmids YZ\G
 YZ]G
 YZ^G
List of Figures YZ_G
 YZ`G
Figure 1. Biochemical reactions between PEP and OAA in high energy-charged E.Y[WG
coli.Y[XG
Biochemical reactions under glycolytic and gluconeogenic conditions occurring in Y[YG
BL21(DE3) and high energy-charged BL21(DE3). Y[ZG
pck: PEP carboxykinase, ppc: PEP carboxylase. Superscripts p and c indicate promoter-Y[[G
origin and chromosome-origin, respectively. Y[\G
 Y[]G
Figure 2. Microscopic images of E. coli BL21(DE3) expressing eGFP. Y[^G
 Y[_G
Y[`G
15G
G
Table 2. Effect of intracellular energy level on eGFP expressiona.Y\WG
Y\XG
Strain Biomass Intracellular 
[ATP] 
(nmol/mg-
protein) 
Volumetric 
eGFP 
expressionb 
(fluorescence 
intensity/mL) 
 
Specific eGFP 
expressiond 
(fluorescence 
intensity/mg-
protein) 
O.D.600nm Total 
protein 
(mg/mL)
BL21(DE3) 1.98 ±0.01 0.62 ±0.01 42.3 ·1.5 - - 
BL21(DE3)/pEcPck 2.06 ±0.03 0.64 ±0.05 78.4 ·6.3 - - 
BL21(DE3)/pTGFP 1.98 ±0.01 0.60 ±0.03 43.1 ·4.6 443.5 ·21.9 739.2 ·36.5 
BL21(DE3)/pEcPck/pEGFP 1.77 ±0.09 0.55 ±0.01 84.5 ·4.7 957.8 ·30.3 1741.5 ·55.1 
 Y\YG
aAll experiments were repeated at least 5 times. Samples were harvested at 6 h of IPTG Y\ZG
induction. Cells were cultured in a 250-mL Erlenmeyer flask containing 5 mL medium Y\[G
at 250 rpm, and 37C. Y\\G
bA culture sample was directly subjected to fluorescence spectrophotometry (excitation Y\]G
at 395 nm, emission at 509 nm) for estimation of eGFP expression. Y\^G
 Y\_G
Y\`G
16G
G
Table 2. Strains and plasmids Y]WG
 Y]XG
Strains Description Source 
Oligonucleotides   
Forward eGFP gaattcatggtgagcaagggcgagga (EcoRI site underlined) This study 
Reverse eGFP ctgcagcttgtacagctcgtccatgcc (XhoI site underlined) This study 
   
Plasmids   
pGEM-T T&A cloning vector, ApR Promega 
pET41a Expression vector, pT7, KmR Novagen 
pMEGFP eGFP expression vector, ptac, ApR Donated by Dr. 
Seong Goo 
Lee, (KRIBB)
pEcPck pTrc99A containing PCK gene 26 
pEGFP pET41a containing eGFP at EcoRI-XhoI sites This study 
   
Strains   
DH5 F- 80 dlacZ M15  (lacZYA-argF) U169 endA1 
recA1 hsdR17 (rK-mK+) deoR thi-1 phoA supE44 - 
gyrA96 relA1 
Invitrogen 
BL21(DE3)  FompT gal dcm lon hsdSB (rB mB; E. coli B strain), 
with DE3, a  prophage carrying the T7 RNA pol gene 
 
GY]YG
GY]ZG
  Y][G
17G
G
 Y]\G
 Y]]G
 Y]^G
Y]_G
Figure 1. Biochemical reactions between PEP and OAA in high energy-charged E.Y]`G
coli.Y^WG
Biochemical reactions under glycolytic and gluconeogenic conditions occurring in Y^XG
BL21(DE3) and high energy-charged BL21(DE3). Y^YG
pck: PEP carboxykinase, ppc: PEP carboxylase. Superscripts p and c indicate promoter-Y^ZG
origin and chromosome-origin, respectively. Y^[G
  Y^\G
Glucose PEP OAA
CO2 Pippcc
Glucose PEP OAA
CO2+ADP ATPpckc
Glucose PEP OAA
CO2+ADP ATPpckp
CO2 Pi
ppcc
glycolytic condition
glycolytic condition
gluconeogenic condition
BL21(DE3)
BL21(DE3)/pEcPCK
18G
G
 Y^]G
Strains Phase contrast microscopy (1000) Fluorescence microscopy (1000) 
BL21(DE3) 
/pEGFP 
  
BL21(DE3) 
/pEcPCK/pEGFP/ 
 Y^^G
Figure 2. Microscopic images of E. coli BL21(DE3) expressing eGFP. Y^_G
 Y^`G
 Y_WG


High energy-charged cell factory for heterologous protein synthesis

http://precedings.nature.com/documents/3953/version/1

High energy-charged cell factory for heterologous protein synthesis

Abstract

Similar works

Full text

Available Versions

Nature Precedings