Biothythetic pathway of the most drugable thiopeptide nocathiacin has been elucidated by applying reverse genetics method based on its structural features. The present study provides an efficient approach for an easy access to the biosynthetic gene clusters of complex bioactive peptides that are ribosomally synthesized with extensive posttranslational modifications

Jing Deng

Maochen Wei

Nan Liu

Shuzhen Wang

Yijun Chen

English

Nature Precedings

1Simple Reverse Genetics Approach to Elucidating the
Biosynthetic Pathway of Complex Thiopeptide Nocathiacin
Maochen Wei,[a] Jing Deng,[a] Shuzhen Wang,[a] Nan Liu,[a] and Yijun Chen[a],[b]*
[a]Dr. M. C. Wei, Dr. J. Deng, K. Feng, Dr. S. Z. Wang, Dr. N. Liu, Prof. Dr. Y. J. Chen
Laboratory of Chemical Biology, China Pharmaceutical University, 24 Tongjia
Street, Nanjing, Jiangsu Province, 210009, People’s Republic of China
Tel: 86-25-83271045, Fax: 86-25-83271249
Email: yjchen@cpu.edu.cn
[b]Prof. Dr. Y. J. Chen
Department of Chemical Biology, Ernest Mario School of Pharmacy, Rutgers
University, Piscataway, New Jersey, USA
Correspondence: Prof. Dr. Yijun Chen
2There is an urgent need for the discovery of new antibiotics to fight against
multi-drug resistant bacteria.[1-2] Thiopeptides (Figure 1), a large group of highly
modified macrocyclic peptides, have attracted intensive attention due to the intriguing
molecular architecture and potent activity against various Gram-positive bacteria
including methicillin-resistant Staphylococcus aureus, vancomycin-resistant
Enterococci and fully penicillin-resistant Streptococcus pneumoniae.[3-5] According to
the central heterocyclic feature and the oxidation state, thiopeptides have been
classified into five different series, in terms of a to e.[3] Although almost 100 members
of thiopeptides with similar structures have been reported,[6 ,7] only handful
biosynthetic pathways of them have been elucidated by screening genomic library or
mining microbial genome databases.[6-15]
Nocathiacin (Noc), a tricyclic thiopeptide in e series, exhibited excellent
potency against clinically important multi-drug resistant pathogens in vitro and in
vivo.[16] Therefore, it was considered as the most promising molecule, but the poor
aqueous solubility prevented its development as a clinical agent. To generate
analogues with increased aqueous solubility, semi-synthetic and biotransformation
approaches have been utilized to produce new derivatives.[17-20] However, they did not
turn out satisfactory results. Consequently, manipulation of the biosynthetic
machinery appears to be the only option for generating diverse analogues with
improved physiochemical properties, but elucidation of the biosynthetic pathway of
such thiopeptide by genomic library screening typically involves tedious and
time-consuming steps.
In order to rapidly and efficiently exploit the biosynthetic gene cluster of
nocathiacin, we systematically analyzed the reported biosynthetic genes of
thiopeptides. Surprisingly, for thiostrepton and siomycin in a series, the array and
orientation of the enzymes involved in their biosynthesis are identical, suggesting a
close relationship between structural peptide and biosynthetic gene cluster. To
examine this hypothesis, we next compared the biosynthetic gene clusters of GE2270
and thiomuracin in d series, consisting of same macrocyclic core with obviously
divergent modifications. Similar results were also obtained, in which the enzymes for
3the macrocyclic core structure have identical array and orientation. In contrast,
cross-series comparison of the biosynthetic genes of thiocillin I in d series and
nosiheptide (Nos) in e series showed completely different array and orientation even
though their macrocyclic core structures are nearly identical. Therefore, we postulated
that thiopeptides in the same series perhaps have a direct correlation between
structural feature and biosynthetic gene cluster.
Figure 1. Chemical structures of representative thiopeptides. a series: thiostrepton
and siomycin; d series: thiomuracin A, GE2270A and thiocillin I; e series: nosiheptide
and nocathiacin I.
In view of the chemical structure, nocathiacin is similar to nosiheptide in e series.
In addition to the unique tricyclic characteristics, the major difference of nocathiacin
from nosiheptide is its glycosylation, which may occur at the last step.[16] It is
reasonable to speculate that the arrangement and orientation of the enzymes for the
4biosynthesis of nocathiaicin aglycone should be pertinent to nosiheptide, which may
offer an opportunity of directly applying reverse genetics to obtain the biosynthetic
genes of nocathiacin. Like nosiheptide, [8] nocathiacin possesses an indolic acid at the
same position, suggesting that the enzymes for the biosynthesis of indolic acid should
be near the precursor peptide. Therefore, amplification of the structural peptide region
in combination with the conserved motifs of the enzymes for indolic acid biosynthesis
may result in a specific gene from genomic DNA of the producing strain.
To test our hypothesis, a PCR reaction was employed to amplify the biosynthetic
genes of nocathiacin from Amycolatopsis fastidiosa ATCC 202099. First, primers
were designed based on the structural peptide sequence of nocathiacin.[21] Then,
comparison of two enzymes flanking the both sides of the precursor peptide for
nosiheptide generated specific sequences, in which the conserved motifs containing
more than 6 amino acid residues (at least 3 identical amino acid residues at the
N-terminus) were randomly selected to pair with the above primers (Table S1 and
Figure S1 and S2). As anticipated, two specific DNA fragments were amplified
respectively. A gene encoding a precursor peptide, in term of NocA, consisting of a
leader peptide (36 amino acids) and a structural peptide (13 amino acids) was
obtained (Figure 2 A). The structural peptide of nocathiacin consisted of same
sequence as isotope feeding results except for an additional serine located at the
C-terminus (Figure 2 B). This serine could be removed during the maturation to form
final product in the same fashion as nosiheptide.[8] Although the leader peptide
sequence of nocathiacin showed 80% identity to nosiheptide (Figure 2 A), their
difference may play a role in mediating different modifications of the macrocyclic
core structures. Additionally, the rest of the genes showed high homology to the
tailoring enzymes located at both sides of nosiheptide precursor peptide.
To further verify our approach, we continued to amplify the outer sequences from
NocA. After genome walking with respective primers by our newly developed method
[22] (Table S2 and Figure S3), a complete sequence encoding three tailoring enzymes
and a precursor peptide was rapidly obtained and identified (GenBank no. HM236314,
submitted on May 16, 2010). As we expected, the arrangement and orientation of
5these genes were also same as nosiheptide (Figure 2 C). Bioinformatics analysis of
these genes indicated high homology to the tailoring enzymes within the biosynthetic
pathway of nosiheptide as well (Table 1). Sequence alignments revealed that NocE,
homologous to NosL, belongs to radical SAM-dependent methyltransferase family.[23]
This sequence is also homologous to ThiH-like protein,[24] which was proposed to
cleave the Ca-Cßbond of L-tryptophan and subsequently lead to the rearrangement of
tryptophan for the formation of 3-methylindole-2-carboxylic acid.[8] Meanwhile,
NocB, also shares high sequence similarity to a variety of putative radical
SAM-dependent methyltransferases,[24] not highly similar to corresponding NosN
gene for the biosynthesis of nosiheptide.[8] This type of enzyme was postulated to
re-methylate 3-methylindole-2-carboxylic acid at the C-4 position, and the dimethyl
carboxylic acid would be hydroxylated to form 4-hydroxymethyl-3-methylindole-
2-carboxylic acid, which could be further tethered to the carboxyl group of glutamic
acid and the hydroxyl group of serine within the structural peptide via two ester
bonds.[8] Moreover, NocC, similar to NosO, encodes a protein possibly catalyzing the
formation of central 2,3,5,6-tetrasubstituted pyridine domain.[8, 9, 13] Therefore, a
proposed biosynthetic pathway for nocathiacin is presented in Figure 3. Although
reverse genetics approach has been applied to explore the biosynthesis of ribosomally
synthesized peptides for long time,[25,26] thiopeptides with extensive posttranslational
modifications have not been a subject for utilizing this type of approach due mainly to
the structural complexity and the uncertainty of array and orientation of the
biosynthetic genes for these peptides. The present study provides the first example on
the rapid and effective elucidation of biosynthetic pathways of these complex
molecules, which could generally be applied to various ribosomally synthesized
bioactive peptides.
6Table 1. Open reading frames in the biosynthetic gene cluster of nocathiacin
Gene Size[a] Protein homologue and origin[b] Identity/similarity (%) Proposed function
nocA 49
Nosiheptide precursor peptide
(FJ438820); Streptomyces
actuosus ATCC 25421
82/94 Noc precursor peptide
nocB 391
Tlm Orf11 (ABL74954);
Streptoalloteichus hindustanus
34/67
SAM-dependent oxidase or
methyltransferase
nocC 313
NosO (ACR48344); Streptomyces
actuosus ATCC 25421
40/71 Hypothetical protein
nocE 397
NosL (ACR48341); Streptomyces
actuosus ATCC 25421
75/90
Radical SAM: Related to
biotin and thiamine synthesis
[a] Numbers of amino acids. [b] NCBI accession numbers are given in parentheses.
Figure 2. Biosynthetic genes of nocathiacin. (A) Precursor peptide of nosiheptide
and nocathiacin. (B) Core sequence of nocathiacin from isotope feeding. (C) Partial
biosynthetic gene cluster of nocathiacin.
7Figure 3. Proposed biosynthetic pathway of nocathiacin. Biosynthesis of indolic
acid originated from the rearrangement of tryptophan and subjected to a series of
modifications (pink); Modifications of the macyclic core structure (blue); The
tailoring steps including hydroxylation, glycosylation, amination, methylation and
cleavage of the C-terminal residue to form amide.
While we were preparing this manuscript, the biosynthetic pathway of
nocathiacin was reported by Ding et al (online available since May 17, 2010) with the
method of genomic library screening.[27] However, the detailed sequence information
of this biosynthetic gene cluster is currently unavailable to the public except for the
precursor peptide. Compared to the published results, our study generated an identical
precursor peptide sequence. Moreover, the array and orientation of the related
tailoring enzymes involving in the biosynthesis of nocathiacin are also same as the
results obtained by genomic library screening, which further confirms the validity of
8our reverse genetics approach.
In summary, our study has provided evidence, for the first time, to take
advantages of the combination of core structure and related biosynthetic genes to
rapidly acquire the information on the biosynthetic pathways of thiopeptides.
Moreover, the present study clearly demonstrates the close relationship between
structural peptide sequence of thiopeptides within the same series and their
biosynthetic genes. Thus, our approach offers a shortcut for speedily elucidating the
biosynthetic gene clusters of various thiopeptides, which would facilitate the
generation of diverse analogues by subsequent genetic manipulations.
Experimental Section
PCR primers were designed based on the structural peptide sequence of
nocathiacin and the conserved motifs of modifying enzymes located at both sides of
nosiheptide precursor peptide. When the conserved motifs contained more than 6
identical amino acid residues, conventional primers were designed to avoid the
degeneracy of the last base resided in three prime. Otherwise, degenerated primers
were designed according to the principle of ‘CODEHOP’.[28]
All PCR reactions were performed with 100 ng of genomic DNA of
Amycolatopsis fastidiosa ATCC 202099,[20] which was prepared as previously
described.[22] The reaction mixtures contained 2.5 µl 10 × DNA polymerase buffer,
2.0 mM MgCl2, 0.2 mM of each dNTP, 5% DMSO, 5% glycerol, 2.0 µM of each
primer, 1 U Taq polymerase and deionized water with a total volume of 25µl. The
amplification, based on the structural sequences combined with conserved motifs, was
performed according to ‘Conventional PCR’procedure except that the annealing
temperature was adjusted to 60 °C. For genome walking, the PCR reaction was
conducted according to the method previously described.[22]
The follow-up processes to obtain positive colonies were conducted according to
the method in the literature.[29] The positive colonies were sequenced by Invitrogen
(Shanghai, China) with ABI Genetic Analyzer 3730 (Applied Biosystems), and DNA
sequence analyses were performed by Vector NTI Advance v10.3 (Invitrogen Co.,
9USA). Sequence alignments were conducted with BLASTnr from NCBI online
service (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Acknowledgements
This work was supported by the “111 Project”from the Ministry of Education of
China and the State Administration of Foreign Expert Affairs of China (No. 111-2-07)
and a National Key Project on Science and Technology of China
(2009ZX09103-089).
References
[1] C. F. Higgins, Nature 2007, 446, 749-757.
[2] M. A. Fischbach, C. T. Walsh, Science 2009, 325, 1089-1093.
[3] M. C. Bagley, J. W. Dale, E. A. Merritt, X. Xiong, Chem. Rev. 2005, 105,
685-741.
[4] R. A. Hughes, C. J. Moody, Angew. Chem. Int. Ed. Engl. 2007, 46, 7930-7954.
[5] V. S. Aulakh, M. A. Ciufolini, J. Org. Chem. 2009, 74, 5750-5753.
[6] H. D. Arndt, S. Schoof, J. Y. Lu, Angew. Chem. Int. Ed. Engl. 2009, 48,
6770-6773.
[7] C. Li, W. L. Kelly, Nat. Prod. Rep. 2010, 27, 153-164.
[8] Y. Yu, L. Duan, Q. Zhang, R. Liao, Y. Ding, H. Pan, E. Wendt-Pienkowski, G.
Tang, B. Shen, W. Liu, ACS Chem. Biol. 2009, 4, 855-864.
[9] W. L. Kelly, L. Pan, C. Li, J. Am. Chem. Soc. 2009, 131, 4327-4334.
[10] L. C. Wieland Brown, M. G. Acker, J. Clardy, C. T. Walsh, M. A. Fischbach,
Proc. Natl. Acad. Sci. USA 2009, 106, 2549-2553.
[11] A. S. Geiermann, R. Micura, Chem. Biol. 2009, 16, 1024-1025.
[12] R. P. Morris, J. A. Leeds, H. U. Naegeli, L. Oberer, K. Memmert, E. Weber, M.
J. LaMarche, C. N. Parker, N. Burrer, S. Esterow, A. E. Hein, E. K. Schmitt, P.
Krastel, J. Am. Chem. Soc. 2009, 131, 5946-5995.
[13] R. Liao, L. Duan, C. Lei, H. Pan, Y. Ding, Q. Zhang, D. Chen, B. Shen, Y. Yu,
W. Liu, Chem. Biol. 2009, 16, 141-147.
10
[14] J. Wang, Y. Yu, K. Tang, W. Liu, X. He, X. Huang, Z. Deng, Appl. Environ.
Microbiol. 2010, 76, 2335-2344.
[15] C. T. Walsh, M. G. Acker, A. A. Bowers, J. Biol. Chem. DOI:
10.1074/jbc.R110.135970
[16] W. Li, J. E. Leet, H. A. Ax, D. R. Gustavson, D. M. Brown, L. Turner, K.
Brown, J. Clark, H. Yang, J. Fung-Tomc, K. S. Lam, J. Antibiot. (Tokyo) 2003,
56, 226-231.
[17] K. C. Nicolaou, S. H. Lee, A. A. Estrada, M. Zak, Angew. Chem. Int. Ed. Engl.
2005, 44, 3736-2740.
[18] L. Xu, A. K. Farthing, Y. J. Shi, P. T. Meinke, K. Liu, J. Org. Chem. 2007, 72,
7447-7450.
[19] W. Li, S. Huang, X. Liu, J. E. Leet, J. L. Cantone, K. S. Lam, Bioorg. Med.
Chem. Lett. 2008, 18, 4051-4053.
[20] M. Wei, S. Wang, Y. Fang, Y. Chen, Bioresour. Technol. 2010, 101, 3617-3622.
[21] S. B. Singh, K. Herath, N. X. Yu, A. A. Walker, N. Conors, Tetrahedron Lett.
2008, 49, 6265-6268.
[22] J. Deng, M. Wei, B. Yu, Y. Chen, Appl. Microbiol. Biotechnol. 2010, 87,
757-764.
[23] S. J. Booker, R. M. Cicchillo, T. L. Grove, Curr. Opin. Chem. Biol. 2007, 11,
543-552.
[24] M. Kriek, F. Martins, M. R. Challand, A. Croft, P. L. Roach, Angew. Chem. Int.
Ed. Engl. 2007, 46, 9223-9226.
[25] T.J. Oman, & van der Donk, W.A. Nat. Chem. Biol. 2009, 6, 9-18.
[26] E.W. Schmidt, BMC Biol. 2010, 8, 83-86.
[27] Y. Ding, Y. Yu, H. Pan, H. Guo, Y. Li, W. Liu, Mol. Biosyst. 2010, 6,
1180-1185.
[28] R. Boyce, P. Chilana, T. M. Rose, Nucleic Acids Res. 2009, 37, W222-W228.
[29] J. Sambrook, Molecular cloning - a laboratory manual, 3rd ed. (Eds.: J.
Sambrook, D.W. Russell), Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York, 2001.
11
Supporting Information
Simple Reverse Genetics Approach to Elucidating the
Biosynthetic Pathway of Complex Thiopeptide Nocathiacin
Maochen Wei, Jing Deng, Shuzhen Wang, Nan Liu, and Yijun Chen*
Contents
1.
2.
Table S1 Oligonucleotide sequences of primers used in PCR amplification
Table S2 Oligonucleotide sequences of primers used in genome walking
3. Figure S1 Primer design according to the conserved motifs of NosN in the
biosynthetic genes of nosiheptide.
4. Figure S2 Primer design according to the conserved motifs of NosO in the
biosynthetic genes of nosiheptide.
5. Figure S3 Primer design according to the conserved motifs of NosL in the
biosynthetic genes of nosiheptide.
12
Gene[a] Primer Sequence (5’to 3’)[b] Conserved motifs[c]
NocA Forward TCGTGCACCACCTGCGAGTG SCTTCEC
Reversed GCACTCGCAGGTGGTGCACGA SCTTCEC
NocB Reversed1 GGGATGTCCGTCACCcartcrcaraa FCDWVQAIP
Reversed2 GCTGGCCGTGCCGCCGCCCCAG YWGGGT
NocC Reversed1 CGCCTGCGCGGCyttnggrtcnc RDPKAAQA
NocE Forward GTACGTCTCGCGGTCGTAGctytcytgraa FQESYDRETY
Table S1. [a] NocA, precursor peptide of nocathiacin; NocB, tailoring enzyme close to
the downstream of NocA; NocC, tailoring enzyme close to the downstream of NocB;
NocE, tailoring enzyme close to the upstream of NocA.
[b] IUB (degenerated bases) code was used for degenerated base positions: N =
A+C+G+T; Y = C+T; R = A+G.
[c]Conserved amino acid sequences obtained from the alignments of related enzymes
in nosiheptide biosynthetic genes with other homologous sequences.
Gene[a] Primer Sequence (5’to 3’)[b] Direction
NocC Down-outer GCCTGCTGGCAGACCTGGCGGTCGGGTAG Downstream
Down-inner CATCCGTCGCGCATCACCGGCCGCTTGCTG Downstream
NocE Up1-outer GGCTTCGAGCGGGTCTACTTCAACAT Upstream
Up1-inner CGAGATCGACGTGCTCGCCGAGTGGG Upstream
Up2-outer AGGCGATCGGCCTGGCGGGCGTCATCAGC Upstream
Up2-inner GACTCGCAGGCCCGCAACGAGGAGACGAC Upstream
Random primers
Semi-1 GCCAATTCCGGATNGAYKSNGGNTC Universal walker primer
Semi-2 GCCTTAAGGCCTANGARMSNCCNAG Universal walker primer
Semi-3 CGGTTAAGGCCTANYTCSKNGANGC Universal walker primer
Semi-4 GCCAATTCCGGATNSAGYMNCTNCG Universal walker primer
Table S2. [a] NocC, tailoring enzyme close to the downstream of NocB; NocE,
tailoring enzyme close to the upstream of NocA.
[b] IUB (degenerated bases) code was used for degenerated base positions: N =
A+C+G+T; S = C+G; Y = C+T; M = A+C; R = A+G; K = T+G
13
Figure S1. Cop, coproporphyrinogen III oxidase (Nonomuraea sp. WU8817); Tlm,
Tlm orf11 (Streptoalloteichus hindustanus); SAM, SAM-dependent oxidase or methyl
transferase (Streptomyces flavoviridis). Blue, conserved motifs for primer designs.
14
Figure S2. Tsr, thiostrepton (Streptomyces laurentii); Sio, Siomycin (Streptomyces
sioyaensis). Blue, conserved motif for primer design.
15
Figure S3. Biotin, Biotin and thiamin synthesis associated (Anaerocellum
thermophilum DSM 6725); ThiH, Thiamine biosynthesis protein ThiH (Clostridium
tetani E88). Blue, conserved motif for primer design.


Simple reverse genetics approach to elucidating the biosynthetic pathway of complex thiopeptide nocathiacin

http://precedings.nature.com/documents/4740/version/1

Simple reverse genetics approach to elucidating the biosynthetic pathway of complex thiopeptide nocathiacin

Abstract

Similar works

Full text

Available Versions

Nature Precedings