De Spiegelaere, Ward

Malatinková, Eva

O'Doherty, Una

Van Nieuwerburgh, Filip

Vandekerckhove, Linos

English

Ghent University Academic Bibliography

Proviral HIV is a candidate virological marker to monitor the HIV reservoir in patients. Recent data revealed that repetitive sampling Alu-HIV PCR on patient samples correlates with quantitative coculture assays, indicating that integrated HIV DNA correlates to the amount of replication competent HIV. Although promising, the workflow and data analysis of the assay is complex and hinders a wide use. Here, we provide an improved data analysis based on binomial and Poisson statistics analogous to digital PCR. This method enables absolute quantification without a standard dilution curve and includes confidence interval estimation. ACKNOWLEDGEMENTS: This study was supported by ViiV Healthcare and the HLAB-17 antibody was provided by Becton Dickinson CONCLUSIONS:  The proposed methodology provides a more efficient workflow as preparation of the standard curve in the classical Alu-HIV is time consuming and requires frequent validation. In addition, the implementation of confidence intervals permits an improved qualitative analysis of the data and provides a statistical base for the required number of technical replicates. 6h International Workshop on HIV Persistence, Reservoirs and Eradication Strategies, 3-6 December 2013, Miami, Florida, USA Quantification of integrated HIV DNA by repetitive sampling Alu-HIV PCR and Poisson statistics  De Spiegelaere Warda, Malatinkova Evaa, Van Nieuwerburgh Filipb, O’Doherty Unac, Vandekerckhove Linosa  Affiliations: a) HIV Translational Research Unit, Department of Internal Medicine, Ghent University, Belgium; b) Department of Pharmaceutics, Ghent University, Belgium; c) Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, USA BACKGROUND Methods Poisson statistics were used to assess the binomial data of positive to negative reactions from the 42 replicate Alu-HIV PCR. Confidence intervals were calculated using a modified Poisson method, designed for data from ≥40 replicates. The raw data of Alu-HIV PCRs on standard dilutions and on samples of HIV infected patients (N=47) were analyzed with the modified Poisson method and with the classical method of analysis (the % positive method) and these data were compared. Proviral HIV is a candidate virological marker to monitor the HIV reservoir in patients. Recent data revealed that repetitive sampling Alu-HIV PCR on patient samples correlates with quantitative coculture assays, indicating that integrated HIV DNA correlates to the amount of replication competent HIV. Although promising, the workflow and data analysis of the assay is complex and hinders a wide use. Here, we provide an improved data analysis based on binomial and Poisson statistics analogous to digital PCR. This method enables absolute quantification without a standard dilution curve and includes confidence interval estimation. blablabla name  sequence Ta °C nM  HLA 57:01 193F exon 2 forward CGCGAGTCCGAGGATGGC 61 500 HLA 57:01 319R exon 2 reverse GGAGCGCGATCCGCAGGTTCT 61 500 HLA 57:01 exon 2 probe probe /5'FAM/AACATGAAGGCCTCCGCGCAGACTTA/3'IABkFQ/ 61 20 HLA 57:01 345F exon 3 forward GTCTCACATCATCCAGGTGACGT 61 500 HLA 57:01 419R exon 3 reverse GACTGGTCATGCCCGCGGAG 61 500 HLA B57:01 exon 3 probe probe /5'FAM/ACGTCGCAGCCATACATCACCTGGATGATGT/3'IABkFQ/ 61 20 RPP30 forward AGATTTGGACCTGCGAGCG 61 500 RPP30 reverse GAGCGGCTGTCTCCACAAGT 61 500 RPP30 probe probe /5'HEX/TTCTGACCTGAAGGCTCTGCGCG/3'IABkFQ/ 61 200 Ward.DeSpiegelaere@UGent.be Table 1: Primers and probes used for real-time PCR detection of HLA-B*57:01.  Results blablabla )pˆ-ln(1 -=nqpkpˆˆˆCIWald  )4ˆˆ(kn kn2 X  CI222122Wilsonnkqpknk

Quantification of integrated HIV DNA by repetitive sampling Alu-HIV PCR and Poisson statistics

https://biblio.ugent.be/publication/5704817/file/5704821.pdf

Quantification of integrated HIV DNA by repetitive sampling Alu-HIV PCR and Poisson statistics

Abstract

Similar works

Full text

Available Versions

Ghent University Academic Bibliography