Biological sciences and related bioͲtechnology play a very important role in research projects concerning protection and preservation of cultural heritage for future generations.
In this work secondary metabolites of Burkholderia gladioli pv. agaricicola (Bga) ICMP 11096 strain and
crude extract of glycoalkaloids from Solanaceae plants, were tested against a panel of microorganisms
isolated from calcarenite stones of two historical bridges located in Potenza and in Campomaggiore (Southern Italy). The isolated bacteria belong to Bacillus cereus and Arthrobacter agilisspecies, while fungi
belong to Aspergillus, Penicillium, Coprinellus, Fusarium, Rhizoctonia and Stemphylium genera. Bga broth (unfiltered) and glycoalkaloids extracts were able to inhibit the growth of all bacterial isolates. Bga culture
was active against fungal colonies, while Solanaceae extract exerted bioͲactivity against Fusarium and Rhizoctonia gener

Bonomo, M. G

BUFO, Sabino Aurelio

SALZANO, Giovanni

Sasso, S

SCRANO, Laura

English

Archivio della Ricerca - Università della Basilicata

Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013 101SECONDARY METABOLITES: APPLICATIONS ON CULTURAL HERITAGE S. SASSO1,3, L. SCRANO2, M.G. BONOMO1, G. SALZANO1 and S.A. BUFO1 1 Department of Science 2 Department of European Cultures (DICEM) 3 Ph.D Programme “Bioecosystems and Biotechnologies” University of Basilicata Via dell’Ateneo Lucano 10, IT-85100, Potenza Italy SUMMARY Biological sciences and related bio technology play a very important role in research projects concerningprotection and preservation of cultural heritage for future generations.In this work secondary metabolites of Burkholderia gladioli pv. agaricicola (Bga) ICMP 11096 strain andcrude extract of glycoalkaloids from Solanaceae plants, were tested against a panel of microorganismsisolated from calcarenite stones of two historical bridges located in Potenza and in Campomaggiore(Southern Italy). The isolated bacteria belong to Bacillus cereus and Arthrobacter agilis species, while fungibelong to Aspergillus, Penicillium, Coprinellus, Fusarium, Rhizoctonia and Stemphylium genera. Bga broth(unfiltered) and glycoalkaloids extracts were able to inhibit the growth of all bacterial isolates. Bga culturewas active against fungal colonies, while Solanaceae extract exerted bio activity against Fusarium andRhizoctonia genera.Key words: cultural heritage, calcarenite stones, bio cleaning, glycoalkaloids, Burkholderia gladioli.INTRODUCTION Bio deterioration of cultural heritage is mainly due to different processes: biofilm formation,bio corrosion caused by organic and inorganic acids, redox processes on cations from the mineral lattice, physical penetration by microbial communities etc. [Gómez Alarcón et al. 1995;Warscheid and Braams 2000].Microorganism are able to colonize surface and internal part of art stones causing seriousdegradation problems. Fungal colonies can penetrate deeply contributing to their mechanicaldeterioration.These actions simultaneously allow the transport of water and nutrients through the porousmedium, facilitating the colonization and concomitantly triggering biochemical deteriorationof the interior of the stones [Gómez Alarcón and De La Torre 1994]. The bio deterioration ofartefacts commonly results from the complex interaction established among co existing physico chemical and biological activities [Warscheid and Braams 2000; McNamara and Mitchell2005].The maintenance and the conservation of cultural heritage can be carried out by using traditional chemicals, but many studies report that microorganisms are able to acquire chemicalresistance [Bingaman and Willingham, 1994; McFeters et al., 1995]. For this reason, frequently, several chemicals need to be combined in order to achieve effective organisms’ eradication.Today, biological sciences and related bio technology, can play a very important role in research projects concerning protection and preservation of cultural heritage for future generations. The study and knowledge of the complex interactions between colonizing organismsand chemical degradation processes represents a new and valuable tool for the preventiveand the specific maintenance of artefacts. 102Studies of microbial ecosystems on the artefacts have, only recently, put in a new light thebacterial world; these organisms, always confined to the role of deterioration agents, mayspecifically be useful as bioremediation agents [Fernandes, 2006].Sulphate and nitrate reducers bacteria are the only microorganisms used for the removal ofundesirable compounds (organic matter, crusts and mineral salts) from works of art: in anoxicconditions such bacteria are able to transform sulphate to hydrogen sulphide and nitrate tomolecular nitrogen, which are both gaseous. Preliminary studies report the partial cleaning ofblack crusts after a Desulfovibrio desulfuricans application on movable objects, like marblestatues [Gauri et al, 1989; Heselmeyer et al., 1991; Gauri et al., 1992; Cappitelli et al., 2006].Using the selected strain Pseudomonas stutzeri A29, able to reduce nitrate in anaerobic conditions, 90% nitrate removal after 30 hours of application at 28°C was obtained [Ranalli et al.,1996, 2000]. More recently Ranalli et al.[2005] applied selected bacteria to the frescoes ofCamposanto Monumentale of Pisa with some success.The goal of this work was to test natural bio cleaning products obtained from metabolism ofsome bacteria and of vegetal crops: these substances have a role in ecological function, including defence mechanism, are not harmful to human health, have a low environmental impact, highly selective and low cost.There is an extensive literature concerning insecticidal, nematicidal, fungicidal and phytotoxiceffects of active compounds produced by some bacteria and from Solanaceae plants [Brownand Morra 1997, Rosa and Rodrigues 1999, Elshafie et al., 2012, Ventrella et al., 2012].Accordingly, in this work we tested the effects of secondary metabolites produced byBurkholderia gladioli pv. agaricicola ICMP 11096 strain (Bga), an aerobic gram negative rodshaped bacterium, which has the ability to produce in vitro secondary metabolites with relevant biological activities, and glycoalkaloids, important bioactive secondary metabolites commonly found in Solanaceae plants. As concerning Burkholderia the integral broth containingcells and the cells free filtrate broth were used for assays.The antagonist capability of these substances was investigated against a panel of microorganisms isolated from the calcarenite stones of two bridges located in Potenza and in Campomaggiore (Southern Italy) (Figure 1).Figure 1. San Vito bridge in Potenza (a) and Della Vecchia bridge in Campomaggiore (b)  a bComm. Appl. Biol. Sci, Ghent University, 78/2, 2013 103MATERIALS AND METHODS Sampling, isolation and growth conditions Samples were taken by carefully scraping off stone material using sterile swabs and scalpel inaccording to the Italian Cultural Heritage Ministry Recommendation 3/80, and were re suspended in saline solution buffer (0.85% NaCl). Samples were duplicate and isolated by spreadplating on PCA medium. For each sample, different colonies were selected and purified bystreaking on PCA added with tetracycline hydrochloride (0.005 g/L) for fungi growth, and onPCA added with cicloxiamide (70 100 mg/L)) for bacteria growth. Colonies were examined formorphology, Gram reaction and catalase. Isolates were routinely cultivated in PCB and maintained frozen ( 80°C) in skim milk.DNA extraction The total DNA was extracted from bacterial isolates by using the Marmur method [1961] modified. The total DNA was extracted from fungal isolates by using the Raeder and Broda method[1985] modified. 25 ng of DNA were used for PCR amplification.16S rDNA amplification and sequencing Synthetic oligonucleotide primers fD1 (AGAGTTTGATCCTGGCTCAG) and rD1 (AAGGAGGTGATCCAGCC) were used to amplify the 16S rDNA. PCR mixture, and PCR amplification conditions were performed as previously reported [Bonomo et al., 2008]. The PCR products weresequenced and DNA similarity was performed with the Gene Bank and EMBL database. TheGene Bank accession numbers of the sequences are reported in Table 1.Internal transcribed spacer (ITS) region amplification As described previously [White et al., 1990], primers ITS1 and ITS4 were used to amplify specific ITS regions of fungal ribosomal genes. PCR mixture and amplification conditions wereperformed as described by White et al. [1990]. The PCR products were sequenced, and DNAsimilarity was performed with the Gene Bank and EMBL database.Antibacterial assay Burkholderia gladioli pv. agaricicola ICMP11096 (Bga), obtained from International Collectionof Microorganisms from Plant (ICMP), was used as reference strain and grown in King Agar B(KB) medium for 24 h at 30°C.The antibacterial activity of Bga and cell free filtrates of Bga was tested against all bacterialisolates by agar well diffusion method. The cell free filtrate of Bga was obtained by inoculumof 150 mL of liquid minimal mineral medium (MM) with 1.5 mL of bacterial suspension and,after incubation at 30°C for 5 days, the culture was filtered (Millipore, 0.20 µm) [Elshafie etal., 2012].Moreover, the antimicrobial activity of glycoalkaloids was also evaluated. Glycoalkaloids wereobtained by unripe berries of Solanum nigrum (European Black Nightshade) and extracted bythe method of Cataldi et al. [2005]. The extract was lyophilized and re suspended in water to 104obtain the stock solution of solamargine (principal component) at concentration of 500 µM.The agar media were inoculated with 60 µL of glycoalkaloids’ solution, or Bga culture broth orcell free filtrates of Bga, and after incubation for 3 days at 30°C the inhibition zone diameterswere measured in cm.Antifungal assay The antifungal activity of Bga and cell free filtrates of Bga was evaluated by diffusion method.Either Bga culture broth or cell free filtrate of Bga was inoculated in PCA plates containing 1cm2 of fungal disc. After 4 5 days of incubation at 30°C, the diameter of fungal colonies werescored and measured in cm.The fungitoxicity was expressed as percentage of growth inhibition (PGI) and calculated according to Zygaldo et al. [1994] formula:PGI (%) = 100(Gc Gt)/GcWhere: Gc represents the average diameter of fungi grown in PCA (control); Gt represents the averagediameter of fungi cultivated on the treated PCA dish containing the antagonistic bacteria or filtrate.RESULTS AND DISCUSSION Identified microorganisms On the basis of amplification and partial sequencing of 16S rDNA, we found that the bacterialisolated strains belong to Bacillus cereus and Arthrobacter agilis species, while fungi belong toAspergillus, Penicillium, Coprinellus Fusarium, Rhizoctonia, and Stemphylium genera.Table 1 describes the isolated bacterial strains, their molecular identification and the GeneBank accession numbers of sequences.Table 1. Molecular identification of bacterial strains isolated from the two bridgesStrain Identified as a Accession number A1I Bacillus cereus (98%) FJ763651.1 B3-1I Bacillus cereus (96%) EU857430.1 A22-2I Bacillus cereus (98%) EU661712.1 A15TI Bacillus cereus (98%) FJ435213.1 A3I Bacillus cereus (97%) EF382364.1 B3TIII Arthobacter agilis (97%) NR_026198.1 a % of similarity on the basis of partial sequencing of 16S rDNAInhibition activity The ability of Bga, cell free filtrate of Bga and glycoalkaloid extracts to inhibit the growth ofbacteria and fungi isolated on the two bridges was evaluated in this study.Results reported in Figure 2 proved that Bga broth and glycoalkaloids extracts were able toinhibit the growth of all bacterial isolates while cell free filtrate broth of Bga inhibited only thegrowth of several strains of Bacillus cereus. It was not active against Arthrobacter agilis.Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013 105Figure 2. Antibacterial activity of glycoalkaloids, Bga and cell free filtrate of BgaAs shown in Figure 3, Bga culture was more active against fungal colonies than the cell freefiltrate. The highest percentage of inhibition of Bga against fungal growth was observed versusPenicillium spp. (75%). The inhibition scale was Penicillium > Stemphylium vesicarium>Coprinellus> Aspergillus.Solanaceae extracts tested against Fusarium and Rhizoctonia genera (Figure 4) showed a partial activity, confirming results obtained by previous research work [Ventrella et al, 2012].Tests against other fungal colonies, isolated from the bridges, are in progress.00.511.522.5Inibition zone (cm)Bacteria testedGlycoalcaloids (cm) Bga(cm) Bga cell filtrate (cm) 106Figure 3: Antifungal activity of Bga and cell free filtrate of Bga Figure 4. Inhibitory activity of glycoalkaloids against Rhizoctonia solani strainsCONCLUSION Usually one of the first phases of the restoration of an artefact is the cleaning achievement,which allows the removal of the materials deposited on the surface. This action can causeirreversible damage on the structure, if it is not performed correctly. Then, it is necessary tocarry out a selective procedure, through the deposit removal, in accordance with the surfacezone features, by lightening or removing in depth, without direct contact with the originalmaterials. Bio cleaning by natural substances seems to meet these accuracy criteria.0.51.52.53.54.55.56.57.58.59.5growth (cm)Fungi testedControl (cm) Bga (cm) Bga cell filtrate (cm)Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013 107Bga and glycoalkaloids showed an interesting activity against a panel of microorganisms isolated from two calcareous bridges. Bga and Solanaceae extracts were more selective especially against bacteria belonging to Bacillus and Arthrobacter genera while cell filtrate of Bgashowed a lower activity. These result could be due to the Arthrobacter genus resistance towards a variety of contaminants [Benyehuda et al., 2003; Margesin and Schinner, 1997].Antifungal activity of these substances was less evident; probably, it could be due to the structural complexity of fungi.The high activity of glycoalkaloids confirmed results of previous works that tested these substances for agricultural purposes [Jonasson and Olsson, 1994; Sinden et al. 1980, 1986].The application of glycoalkaloids and metabolites of Bga on a cultural heritage could be aninnovative challenge and an effective alternative to synthetic biocides for the cultural heritagepreservation because it allows a homogeneous removal of the surface deposits preserving thesubstrate structure and favouring the maintenance of the dynamic equilibrium of the specificecosystem. LITERATURE BENYEHUDA G, COOMBS J, WARD PL, BALKWILL D, BARKAY T (2003): “Metal resistance among aerobicchemoheterotrophic bacteria from the deep terrestrial subsurface”. Canadian Journal of Microbiology, 49(2):151 156:BONOMO M.G., RICCIARDI A., ZOTTA T., PARENTE E., SALZANO G. (2008): “Molecular and technologicalcharacterization of lactic acid bacteria from traditional fermented sausages of Basilicata region(Southern Italy)”. Meat Science 80:1238–1248:BINGAMAN, W. W., WILLINGHAM G. L. (1994): “The Changing Regulatory Environment: EPA Registrationof a New Marine Antifoulant Active Ingredient”. International Biodeterioration and Biodegradation”34: 387 399:BROWN P.B., MORRA M.J. (2009): “Brassicaceae tissues as inhibitors of nitrification in soil”. J. Agric. FoodChem. 57:7707 7711:CAPPITELLI F., TONIOLO L., SANSONETTI A., GULOTTA D., RANALLI G., ZANARDIN E., SORLINI C. (2007):“Advantages of UsingMicrobial Technology over Traditional Chemical Technology in Removal of BlackCrusts from Stone Surfaces of Historical Monumentws”. Appl. Environ.Microbiol. 73 (17): 5671–5675:CATALDI T.R.I., LELARIO F. and BUFO S.A., (2005): “Analysis of tomato glycoalkaloids by liquid chromatography coupled with electrospray ionization tandem mass spectrometry”: Rapid Comm. Mass Spectrom.19 (21): 3103–3110:ELSHAFIE H.S., CAMELE I., RACIOPPI R., SCRANO L., IACOBELLIS N.S, BUFO S.A. (2012): “In Vitro antifungalactivity of Burkholderia gladioli pv. agaricicola against some phytopathogenic fungi”: Intern.J. of Mol.Sci., 13: 16291 16302:FERNANDES P. (2006): “Applied microbiology and biotechnology in the conservation of stone cultural heritage materials”: Appl Microbiol. Biotechnol 73: 291 296:GAURI, K., KULSHRESHTHA N.P., PUNURU A.R., CHOWDHURY A.N.(1989): “Rate of decay of marble in laboratory and outdoor exposure”. J. Materials Civil. Eng., 2:73 85:GAURI L. K., PARKS L., JAYNES J., ATLAS R. (1992): “Removal of sulphated crust frommarble using sulphatereducing bacteria”: Stone Conservation. An Overview of Current Research, Second Edition, EricDoehne and Clifford A. 160–165:GÓMEZ ALARCÓN G, DE LA TORREMA (1994): “Mechanisms of microbial corrosion on petrous materials”.Microbiologia 10: 111–120:GÓMEZ ALARCÓN G, CILLEROS B, FLORES M, LORENZO J (1995): “Microbial communities and alterationprocesses in monuments at Alcala de Henares, Spain”. Sci Total Environ 167:231–239:HESELMEYER K., FISCHER U., KRUMBEINW.E., WARSCHEID T., (1991) Application of Desulfovibrio vulgarisfor the bioconversion of rock gypsum crust into calcite, BIOforum:1/2: 89:JONASSON T., OLSSON K (1994): “The inßuence of glycoalkaloids, chlorogenic acid and sugars on the susceptibility of potato to wireworm”, Potato Res. 37: 205–216: 108MARGESIN R, SCHINNER F. (1997): “Heavy metal resistant Arthrobacter sp.-a tool for studying conjugational plasmid transfer between gram-negative and gram-positive bacteria”. JBasic Microbiol. 37(3):217 227:MARMUR (1961): “A procedure for the isolation of deoxyribonucleic acid from micro organism”: J. Mol.Biol. 3: 208 18:MCFETERS G. A., YU F. P., PYLE B. H., STEWART P. S. (1995): “Physiological methods to study biofilm disinfection”. Journal of Industrial Microbiology 15:333 338:MCNAMARA CJ, MITCHELL R (2005): “Microbial deterioration of historic stone”. Frontiers in Ecology andthe Environment 3:445–451:NORMAL 3/80 (1980) “Materiali Lapidei: Campionamento”: CNR ICR, Roma:RAEDER U., BRODA P. (1985): “Rapid preparation of DNA from filamentous fungi”, Letters in Applied Microbiology 1: 17 20:RANALLI G., COPPOLA R., SORRENTINO E., DELLAGLIO F., SORLINI C. (1996): “Evaluation par bioluminescence de la qualité microbiologique du lait pasteurise”. M.A.N., 14: 55 63:RANALLI G., PRINCIPI P., SORLINI C. (2000): “Bacterial aerosol emission fromwastewater treatment plants:culture methods and bio molecular tools”. Aerobiologia, 16: 39 46:Ranalli G., Alfano G., Belli C., Lustrato G., Colombini M.P., Bonaduce I., Zanardini E., Abbruscato P., Cappitelli F., Sorlini C. (2005): “Biotechnology applied to cultural heritage: biorestoration of frescoes usingviable bacterial cells and enzymes”. J Appl Microbiol 98:73–83:ROSA E.A.S., RODRIGUES P.M.F., 1999. Towards a more sustainable agriculture system: The effect of glucosinolates on the control of soil borne diseases. Journal of Horticultural Science and Biotechnology74, (6) 667 674.SINDEN S.L., SANFORD L.L., OSMAN S.F. (1980): “Glycoalkaloids and resistance to the Colorado potatobeetle in Solanum chacoense”, Bitter. Am. Potato J 57: 331–343:SINDEN S.L., SANFORD L.L., CANTELO W.W., DEAHL K.L. (1986): “Leptine glycoalkaloids and resistance tothe Colorado potato beetle (Coleoptera: Chrysomelidae) in Solanum chacoense”, Environ. Entomol.15: 1057–1062:VENTRELLA E., ZBIGNIEW A., EWA C., MARIOLA M.K., SCRANO L., BUFO S.A. (2012): “Secondary metabolities versus synthetic chemical pesticides: towards a better future”. Proceeding of 7th European conference on pesticides and related organic micropollutants in the environment, Porto (Portugal), 7 10October:ZYGADLO, J.A.: GUZMAN, C.A.: GROSSO, N.R. (1994): “Antifungal properties of the leaf oils of Tagetesminuta L., T. filifolia” Lag. J. Essent. Oil Res., 6: 617–621:WARSCHEID T., BRAAMS J. (2000): “Biodeterioration of stone: a review”. Int Biodeterior Biodegrad 46:343–368:WHITE T. J., BRUNS T., LEE S., TAYLOR J., IN: INNIS A., GELFAND D. H. AND SNINSKY J. J. (eds.), A, (1990):“Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, PCR Protocols”, Academic Press, San Diego, USpp: 315 322.

SECONDARY METABOLITES: APPLICATIONS ON CULTURAL HERITAGE

https://iris.unibas.it/bitstream/11563/98304/4/sasso%20%20et%20al%202013.pdf

SECONDARY METABOLITES: APPLICATIONS ON CULTURAL HERITAGE

Abstract

Similar works

Full text

Available Versions

Archivio della Ricerca - Università della Basilicata