Co-chaperone proteins that share the Bcl-2-associated athanogene (BAG) domain are characterized by their interaction with a variety of partners, such as heat shock proteins (Hsp), steroid hormone receptors, Bcl-2, Raf-1 and others, involved in
regulating protein folding and a number of cellular processes,
including proliferation and apoptosis. Among BAG family
members there is BAG3, also known as CAIR-1 or Bis. BAG3 forms a complex with Hsp70,1,2,4,6 a protein able to modulate
apoptosis by interfering with cytochrome c release, apoptosome assembly and other events in the death process. In addition, BAG3 polypeptide binds to phospholipase C-g (PLC-g)4 or Bcl-2
protein.3,5 Due to such interaction with more than one
apoptosis-modulating factor, BAG3 can participate in apoptosis regulation. Indeed, its hyperexpression can decrease apoptosis induced via Bax or Fas in the human epithelial cell line HeLa3 or
by IL-3 deprivation in the murine hematopoietic cell line 32D.5
Furthermore, we recently showed that BAG3 downmodulation
enhances the apoptotic response to chemotherapy in human
primary B chronic lymphocytic leukemia cell

AMELIO T.

BONELLI P.

FESTA M.

LEONE A.

LEROSE R.

MARTIRE G.

PAGLIUCA M. G.

PETRELLA, Antonello

ROMANO M. F.

ROSATI, ALESSANDRA

TURCO, Maria Caterina

VENUTA S.

English

Archivio della Ricerca - Università di Salerno

deregulation, such as mutational inactivation of SOC1, shouldalso be investigated.AcknowledgementsWe express our sincere thanks to Dr Junjiro Tsuchiyama for theNK-YS cell line and all medical and nursing staff in theDepartment of Medicine, Queen Mary Hospital for the provisionof expert medical care.CS Chim1KY Wong2F Loong2G Srivastava21University Department of Medicine, QueenMary Hospital, The University of Hong Kong,Hong Kong; and2Department of Pathology, Queen MaryHospital, The University of Hong Kong,Hong KongReferences1 Sanchez-Beato M, Sanchez-Aguilera A, Piris MA. Cell cyclederegulation in B-cell lymphomas. Blood 2003; 101: 1220–1235.2 Ward AC, Touw I, Yoshimura A. The Jak–Stat pathway innormal and perturbed hematopoiesis. Blood 2000; 95:19–29.3 Alexander WS. Suppressors of cytokine signaling (SOCS) in theimmune system. Nat Rev Immunol 2002; 2: 410–416.4 Wu C, Sun M, Liu L, Zhou GW. The function of the protein tyrosinephosphatase SHP1 in cancer. Gene 2003; 306: 1–12.5 Chim CS, Liang R, Tam C, Kwong YL. p15 and p16 promotermethylation in acute promyelocytic leukemia. J Clin Oncol 2001;19: 2033–2040.6 Nagai H, Naka T, Terada Y, Komazaki T, Yabe A, Jin E et al.Hypermethylation associated with inactivation of the SOCS1 gene,a JAK/STAT inhibitor, in human hepatoblastomas. J Hum Genet2003; 48: 65–69.7 Oka T, Ouchida M, Koyama M, Ogama Y, Takada S, Nakatani Yet al. Gene silencing of the tyrosine phosphatase SHP1 gene byaberrant methylation in leukemias/lymphomas. Cancer Res 2002;62: 6390–6394.8 Veillette A, Latour S, Davidson D. Negative regulation ofimmunoreceptor signaling. Annu Rev Immunol 2002; 20:669–707.BAG3 protein regulates stress-induced apoptosis in normal and neoplastic leukocytesLeukemia (2004) 18, 358–360. doi:10.1038/sj.leu.2403219Published online 20 November 2003TO THE EDITORCo-chaperone proteins that share the Bcl-2-associated athano-gene (BAG) domain are characterized by their interaction with avariety of partners, such as heat shock proteins (Hsp), steroidhormone receptors, Bcl-2, Raf-1 and others, involved inregulating protein folding and a number of cellular processes,including proliferation and apoptosis.1–2 Among BAG familymembers there is BAG3, also known as CAIR-1 or Bis.2–6 BAG3forms a complex with Hsp70,1,2,4,6 a protein able to modulateapoptosis by interfering with cytochrome c release, apoptosomeassembly and other events in the death process.7–15 In addition,BAG3 polypeptide binds to phospholipase C-g (PLC-g)4 or Bcl-2protein.3,5 Due to such interaction with more than oneapoptosis-modulating factor, BAG3 can participate in apoptosisregulation. Indeed, its hyperexpression can decrease apoptosisinduced via Bax or Fas in the human epithelial cell line HeLa3 orby IL-3 deprivation in the murine hematopoietic cell line 32D.5Furthermore, we recently showed that BAG3 downmodulationenhances the apoptotic response to chemotherapy in humanprimary B chronic lymphocytic leukemia cells.16Oxidative stress can induce apoptosis by the effect of reactiveoxygen species (ROS) on the permeability of the mitochondrialmembrane, with subsequent release of cytochrome c, formationof the apoptosome complex and activation of caspases.9,17 Theactivation of p53 and stress kinases also contributes to theapoptotic response.17 A vast series of antineoplastic compoundsgenerate stress signals, evoking apoptotic responses in neoplas-tic cells.18 Owing to its interaction with Hsp70,1,2,4,6 BAG3could interfere at several levels in this cascade of events,possibly modulating the death process.We investigated whether BAG3 levels could influence theapoptotic response of human leukocytes to oxidative stress. Forthis purpose, we first analyzed the apoptotic response of thehuman myeloid cells U937 to the glutathione- depriving agentdiethylmaleate (DEM).19 To interfere with BAG3 proteinsynthesis, we used BAG3-specific antisense phosphorothioateoligodeoxynucleotides (ODN) (TGCATCATGGGCGAGTGGG-TGGCGG, antisense 1; GCTCATGCTGGGTTGGGGTCTG,antisense 2; ATTAAAGGCGGGGGTGACGTGG, antisense 3;TGCATCATGGGCGAGTGGGTGGC, antisense 4);16 controlnonsense (TTATATTCTATTATATTTATGAACTCC, nonsense 1;CCTCGTAACCACCGACCTCAAT, nonsense 2; GCTTATGGAG-GATTGAGGTTGG, nonsense 3; GCTTATGGAGGATTGA-GGTTGGG, nonsense 4) ODN were used as controls.16 Asshown in Figure 1, addition of the antisense, but not controlnonsense, ODN appreciably downmodulated BAG3 proteinlevels. On the other hand, ODN did not appear to influence thelevels of the unrelated protein Bcl-2 (Figure 1). The ODN wereadded to cultures of U937 cells, in the presence or absence ofDEM, for 20 h and apoptosis was analyzed. DEM-stimulatedcells showed o36% of apoptosis; a similar percentage wasobserved in cultures with control ODN, while apoptotic cellswere 460% in cultures with BAG3-antisense ODN (Figure 2).Similar results were obtained in experiments with primaryperipheral blood mononuclear cells (PBMC) from normaldonors. As verified by intracellular immunofluorescence, theaddition of antisense, but not control nonsense, ODN reducedby 450% the mean intensity of fluorescence observed withBAG3-specific antibody. As a control, the intensities offluorescence obtained with anti-a-tubulin antibody were com-parable in cultures with or without ODN. When PBMC werecultured with DEM, alone or in combination with ODN, for24 h, apoptosis induced by DEM was increased (from 20% up to37%) by the addition of antisense, but not control, oligos(Figure 3). Similar results were obtained in experiments withReceived 19 August 2003; accepted 15 October 2003; Publishedonline 20 November 2003Correspondence: Professor MC Turco, Dipartimento di ScienzeFarmaceutiche (DIFARMA), University of Salerno, Italy; Fax: þ 39089962828; E-mail: mcturco@unisa.itCorrespondence358LeukemiaPBMC from at least three different donors. Therefore, BAG3downmodulation appeared to enhance DEM-induced apoptosisin either U937 cells or PBMC.These findings indicate for the first time that apoptosisinduced by oxidative stress is regulated by BAG3 protein. Takentogether with our previous results, concerning an enhancementof fludarabine-induced B-CLL apoptosis by BAG3 antisenseODN,16 these data establish an antiapoptotic role of BAG3 inhuman leukocytes. The present evidence provide two novelpieces of information. First, BAG3 regulates the apoptoticresponse not only to chemotherapy,16 but also to oxidativestress, supporting the relation between the two pathways.18Second, it regulates cell survival not only in neoplastic,16 butalso in normal leukocytes (PBMC). In this respect, the role ofBAG3 in the apoptosis of normal and neoplastic hematopoieticprogenitors deserves investigation, to evaluate the potentialeffects of BAG3-targeting antineoplastic therapies.Modulation of BAG3 protein levels does not affect basal cellsurvival, but instead response to a pro-apoptotic stimulus(Figure 2 and Romano et al.16), hence interfering with molecularevents subsequent to apoptosis triggering. BAG3 interacts withHsp70,1,2,4,6 a protein able to bind apoptosome componentsand other elements of the apoptotic cascade,7–15 stronglysuggesting its positive cooperation with Hsp70 in apoptosisdownmodulation. Notably, like Hsp70, BAG3 gene expressionis stimulated by stress,20 appearing to be part of a homeostaticloop that controls cell survival in response to stress stimuli.Besides Hsp70, other potential partners of BAG3 in apoptosismodulation have to be considered. Indeed, BAG domain-carrying proteins can interact with various heat shock proteins,some of which, like Hsp90, Hsp60 and Hsp27, have beenreported to interfere with apoptosis events.15 Furthermore,different proteins, including enzymes, such as phospholipaseC, involved in apoptosis control, the antiapoptotic Bcl-2 proteinor signal transducers, like Raf, have been reported to bind BAGfamily members.1–2 In particular, BAG3 carries a proline-richdomain, able to interact with SH3-type structures1,6. Finally, theBAG3/Hsp70 complex has recently been shown to participate inthe proteasome – mediated degradation of intracellular pro-teins.21 It is therefore likely that BAG3 protein can influence theactivity of more than one factor involved in the apoptoticBAG3Bcl-2CtrlDEMnonsense+ DEMBAG3 antisense+ DEMFigure 1 Effect of BAG3-specific antisense oligodeoxynucleotideson BAG3 protein levels in U937 cells. U937 cells were plated at adensity of 5 105/ml and cultured for 15 h without or with DEM(Sigma, St Louis, MO, USA) (1.2 mM) and/or BAG3 antisense or controlnonsense phosphorothioate ODN16 (5mM). Then, cell extracts wereobtained and 50mg of protein were analyzed in Western blot with theindicated antibodies.16,20 Similar results were obtained with any of theantisense or nonsense ODN used.10004080120160200101 102 103 104 100 101 102 103 104 100 101 102 103 104100 101 102 103 104 100 101 102 103 104 100 101 102 103 1040408012016020004080120160200040801201602000408012016020004080120160200Relative cell numberCtrlDEM2% 1% 1%35% 32% 61%none   controlnonsense   BAG3antisenseDNA contentFigure 2 Effect of anti-BAG3 antisense oligodeoxynucleotides on DEM-induced apoptosis in U937 cells. U937 cells were cultured for 20 hwith or without BAG3 antisense or control nonsense phosphorothioate oligodeoxynucleotides (5mM) and treated with DEM (1.2 mM). Then cellapoptosis was analyzed by cell permeabilization and PI staining.16 Similar results were obtained in atleast four different experiments and with anyof the antisense or nonsense ODN used.Correspondence359Leukemiaprocess, and might in this respect constitute to the cell aversatile tool in contrasting death signals.P Bonelli1A Petrella2A Rosati2MF Romano3R Lerose2MG Pagliuca2T Amelio4M Festa2G Martire4S Venuta5MC Turco2A Leone21Tumour Institute ‘‘Fondazione Sen. Pascale’’Naples, Italy;2Dipartimento di Scienze Farmaceutiche(DIFARMA) University of Salerno, Italy;3Dipartimento di Biochimica e BiotecnologieMediche (DBBM) and Area di Ematologia(DACM) University of Naples ‘Federico II’, Italy;4Dipartimento di Scienze e Tecnologie perl’Ambiente ed il Territorio (DiSTAT) University ofMolise, Italy;5Dipartimento di Medicina Sperimentale eClinica (DMSC) University of Catanzaro, ItalyReferences1 Takayama S, Xie Z, Reed JC. An evolutionary conserved family ofHsp70/hsc70 molecular chaperone regulators. J Biol Chem 1999;274: 781–786.2 Takayama S, Reed JC. Molecular chaperone targeting and regulationby BAG family proteins. Nat Cell Biol 2001; 3: E237–E241.3 Lee J-H, Takahashi T, Yasuhara N, Inazawa J, Kamada S, TsujimotoY. Bis, a Bcl-2-binding protein that synergizes with Bcl-2 inpreventing cell death. Oncogene 1999; 18: 6183–6190.4 Doong H, Price J, Kim YS, Gasbarre C, Probst J, Liotta LA et al.CAIR-1/BAG-3 forms an EGF-regulated ternary complex withphospholipase C-gamma and Hsp70/Hsc70. Oncogene 2000; 19:4385–4395.5 Antoku K, Maser RS, Scully Jr WJ, Delach SM, Johnson DE.Isolation of Bcl-2-binding proteins that exhibit homology withBAG-1 and suppressor of death domains protein. Biochem BiophysRes Commun 2001; 286: 1003–1010.6 Doong H, Vrailas A, Kohn EC. What’s in the ‘BAG’? A functionaldomain analysis of the BAG-family proteins. Cancer Lett 2002;188: 25–32.7 Mosser DD, Caron AW, Bourget L, Denis-Larose C, Masiie B. Roleof the human heat shock protein hsp70 in protection against stress-induced apoptosis. Mol Cell Biol 1997; 17: 5317–5327.8 Jaattela M, Wissing D, Kokholm K, Kallunki T, Egeblad M. Hsp70exerts its anti-apoptotic function downstream of caspase-3-likeproteases. EMBO J 1998; 17: 6124–6134.9 Li CY, Lee JS, Ko YG, Kim JL, Seo JS. Heat shock protein 70inhibits apoptosis downstream of cytochrome c release andupstream of caspase-3 activation. J Biol Chem 2000; 275:25665–25671.10 Creagh EM, Carmody RJ, Cotter TG. Heat shock protein 70 inhibitscaspase-dependent and –independent apoptosis in Jurkat T cells.Exp Cell Res 2000; 257: 58–66.11 Beere HM, Wolf BB, Cain K, Mosser DD, Mahboubi A, Kuwana Tet al. Heat-shock protein 70 inhibits apoptosis by preventingrecruitment of procaspase-9 to the Apaf-1 apoptosome. Nat CellBiol 2000; 2: 469–475.12 Saleh A, Srinivasula SM, Balkir L, Robbins PD, Alnemri ES.Negative regulation of the Apaf-1 apoptosome by Hsp70. Nat CellBiol 2000; 2: 476–483.13 Mosser DD, Caron AW, Bourget L, Meriin AB, Sherman MY,Morimoto RI et al. The chaperone function of hsp70 is required forprotection against stress- induced apoptosis. Mol Cell Biol 2002;20: 7146–7159.14 Ravagnan L, Gurbuxani S, Susin SA, Maisse C, Daugas E, ZamzamiN et al. Heat-shock protein 70 antagonizes apoptosis-inducingfactor. Nat Cell Biol 2001; 3: 839–843.15 Beere HM. Stressed to death: regulation of apoptotic signal-ing pathways by the heat shock proteins. Sci STKE 2001; 93:RE1.16 Romano MF, Festa M, Pagliuca G, Lerose R, Bisogni R, Chiurazzi Fet al. BAG3 protein controls B-chronic lymphocytic leukemia cellapoptosis. Cell Death Differ 2003; 10: 383–385.17 Benhar M, Engelberg D, Levitzki A. ROS, stress-activatedkinases and stress signaling in cancer. EMBO Rep 2002; 3:420–425.18 Herr I, Debatin KM. Cellular stress response and apoptosis incancer therapy. Blood 2001; 98: 2603–2614.19 O’Neill S, O’Neill AJ, Conroy E, Brady HR, Fizpatrick JM,Watson RW. Altered caspase expression results in delayedneutrophil apoptosis in acute pancreatitis. J Leukoc Biol. 2000;68: 15–20.20 Pagliuca MG, Lerose R, Cigliano S, Leone A. Regulation by heavymetals and temperature of the human BAG-3 gene, a modulator ofHsp70 activity. FEBS Lett. 2003; 541: 11–15.21 Doong H, Rizzo K, Fang S, Kulpa V, Weissman AM, Kohn EC.CAIR-1/BAG-3 Abrogates Heat Shock protein-70 chaperonecomplex-mediated protein degradation: Accumulation OF poly-ubiquitinated Hsp90 client proteins. J Biol Chem 2003; 178:28490–28500.100040801201602000408012016020004080120160200101 102 103 104 100 101 102 103 104 100 101 102 103 104Relative cell numberCtrlDEM1% 2% 3%100040801201602000408012016020004080120160200101 102 103 104 100 101 102 103 104 100 101 102 103 10419% 20% 37%none  controlnonsense   BAG3antisenseDNA contentFigure 3 Effect of anti-BAG3 antisense oligodeoxynucleotides on BAG3 protein levels in normal human peripheral blood leukocytes. HumanPBMC were obtained from normal donors’ heparinized samples by centrifugation through a Ficoll–Hypaque (ICN Flow, Opera, Italy) densitygradient at 400 g for 30 min. PBMC (1 106/ml) were cultured in 10% FCS-RPMI with DEM (1.2 mM) and/or the BAG3 antisense or controlnonsense phosphorothioate ODN (5mM) for 24 h. Then, cell apoptosis was analyzed by cell permeabilization and PI staining. Similar results wereobtained in atleast three different experiments and with any of the antisense or nonsense ODN used.Correspondence360Leukemia

BAG3 protein regulates stress- induced apoptosis in normal and neoplastic leukocytes

BAG3 protein can influence the activity of more than one factor involved in the apoptotic process in human leukemia, and might in this respect constitute a versatile tool to target apoptosis

BONELLI P

ROSATI A

LEROSE R

PAGLIUCA MG

AMELIO T

FESTA M

MARTIRE G

VENUTA S

TURCO MC

PETRELLA, ANTONELLO

ROMANO, MARIA FIAMMETTA

Archivio della ricerca - Università degli studi di Napoli Federico II

BAG3 protein regulates stress-induced apoptosis in normal and neoplastic leukocytes.

https://www.iris.unisa.it/bitstream/11386/1849953/1/Bonelli%20%202004%20.pdf

BAG3 protein regulates stress- induced apoptosis in normal and neoplastic leukocytes

Abstract

Similar works

Full text

Available Versions

Archivio della Ricerca - Università di Salerno

Archivio della ricerca - Università degli studi di Napoli Federico II