During 2011-2013, dolphin morbillivirus was molecularly identified in 4 stranded fin whales from the Mediterranean Sea. Nucleoprotein, phosphoprotein, and hemagglutinin gene sequences of the identified strain were highly homologous with those of a morbillivirus that caused a 2006-2007 epidemic in the Mediterranean. Dolphin morbillivirus represents a serious threat for fin whales

BEFFAGNA, GIORGIA

Casalone, Cristina

CENTELLEGHE, CINZIA

Cocumelli, Cristiano

Denurra, Daniele

Di Francesco, Cristina Esmeralda

Di Guardo, Giovanni

MAZZARIOL, SANDRO

Pautasso, Alessandra

Pintore, Antonio

Povinelli, Michele

Terracciano, Giuliana

Emerging Infectious Diseases

English

PubMed

Archivio istituzionale della ricerca - Università di Padova

Original Citation:Mediterranean Fin Whales (Balaenoptera physalus) Threatened by Dolphin MorbilliVirusPublisher:Published version:DOI:Terms of use:Open Access(Article begins on next page)This article is made available under terms and conditions applicable to Open Access Guidelines, as described athttp://www.unipd.it/download/file/fid/55401 (Italian only)Availability:This version is available at: 11577/3177556 since: 2020-03-16T22:04:08Z10.3201/eid2202.150882Università degli Studi di PadovaPadua Research Archive - Institutional RepositorySandro Mazzariol, Cinzia Centelleghe,  Giorgia Beffagna, Michele Povinelli,  Giuliana Terracciano, Cristiano Cocumelli, Antonio Pintore, Daniele Denurra,  Cristina Casalone, Alessandra Pautasso,  Cristina Esmeralda Di Francesco,  Giovanni Di GuardoDuring	 2011–2013,	 dolphin	 morbillivirus	 was	 molecularly	identified	in	4	stranded	fin	whales	from	the	Mediterranean	Sea.	 Nucleoprotein,	 phosphoprotein,	 and	 hemagglutinin	gene	sequences	of	the	identified	strain	were	highly	homolo-gous	with	those	of	a	morbillivirus	that	caused	a	2006–2007	epidemic in the Mediterranean. Dolphin morbillivirus repre-sents	a	serious	threat	for	fin	whales.Fin whales (Balaenoptera physalus) living in the Medi-terranean Sea belong to a population that is part of the Atlantic stock (1). For feeding purposes, these whales tend to concentrate in specific areas, one of which is Pelagos Sanc-tuary, the widest protected marine area for sea mammals in the Mediterranean Basin between Italy, France, and Monaco. In Pelagos Sanctuary and, in general, in the entire Mediter-ranean Sea, fin whales are considered vulnerable because of several anthropogenic threats, the most common of which are ship strikes, chemical pollution, and noise (2–4).Postmortem investigations on well-preserved whale carcasses are necessary to gain evidence-based insight into the effect these threats have on fin whales; thus, the car-casses of all large cetaceans found stranded along the Ital-ian coastline are systematically examined to determine the cause of death. Because morbillivirus infections have been detected during these postmortem investigations, we con-ducted a study to determine the effect of this natural threat on the Mediterranean fin whale population.The StudyDuring 2006–2014, a total of 23 fin whales were found stranded along the coast of Italy. We systematically con-ducted full necropsies and microscopy- and molecular-based analyses on 9 (39%) carcasses that were in good conservation status. Of these 9 fin whales, 2 were juveniles and 2 were calves found during January 2011–February 2013 along the coasts of Tuscany, Sardinia, and Liguria, Italy. These young whales showed pathologic, immunohis-tochemical (IHC), biomolecular, and/or serologic evidence of dolphin morbillivirus (DMV) infection (Table 1) (5–9); however, not all of these cases were spatially or tempo-rally related to known fatal DMV-associated outbreaks that occurred during 2006–2014 (online Technical Appendix Figure 1, http://wwwnc.cdc.gov/EID/article/22/2/15-0882-Techapp1.pdf). Moreover, in October 2013, a newborn male fin whale was found stranded alive on Elba Island (Tuscany); the whale died after a few hours, and postmor-tem investigations conducted within 24 hours of death yielded biomolecular and IHC evidence of DMV infec-tion. Viral genome, antigen, or both were found in several tissues, along with a parasitic infection and a generalized lymphocytic depletion. Hyperimmune rabbit anti–rinder-pest virus serum (provided by Pirbright Institute, Pirbright, UK) (10) was used to detect morbillivirus antigens; only circulating monocytes and tissue macrophages in brain and thymus stained positively (Figure 1).DMV genome was detected in brain, lung, spleen, and thymus from the newborn whale; viral RNA was extracted from these tissues by using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). Primer DMV2 (11) and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) were used to synthesize cDNA; primer and viral RNA were incubated at 42°C for 60 min followed by 70°C for 5 min. Amplification was performed by using prim-ers DMV-N1 and DMV-P2 (11) and Phusion Hot Start II DNA Polymerase (Thermo Scientific) with the following PCR conditions: 30 s at 98°C; 35 cycles of 10 s at 98°C, 30 s at 62°C, 1 min at 72°C; and 10 min at 72°C. Next, the DNA fragments obtained from lung and cerebral cDNA were purified, cloned into the plasmid vector pCR-Blunt II-TOPO (Invitrogen, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions, and then sequenced.Sequences from 5 lung and 4 cerebral plasmidic colonies were analyzed. Programs in the DNASTAR Mediterranean Fin Whales  (Balaenoptera physalus)  Threatened by Dolphin MorbilliVirus302	 Emerging	Infectious	Diseases	•	www.cdc.gov/eid	•	Vol.	22,	No.	2,	February	2016Author	affiliations:	University	of	Padova,	Padua,	Italy	 (S.	Mazzariol,	C.	Centelleghe,	G.	Beffagna,	M.	Povinelli);	Istituto	Zooprofilattico	Sperimentale	del	Lazio	e	della	Toscana,	Rome,	Italy	(G.	Terracciano,	C.	Cocumelli);	Istituto	Zooprofilattico	 Sperimentale della Sardegna, Sassari, Italy (A. Pintore,  D.	Denurra);	Istituto	Zooprofilattico	Sperimentale	del	Piemonte,	Liguria e Valle d’Aosta, Turin, Italy (C. Casalone, A. Pautasso); University	of	Teramo	Faculty	of	Veterinary	Medicine,	Teramo,	Italy	(C.E.	Di	Francesco,	G.	Di	Guardo)DOI:	http://dx.doi.org/10.3201/eid2202.150882Mediterranean	Fin	Whales	and	Dolphin	MorbillivirusLasergene software package (http://www.dnastar.com/ t-dnastar-lasergene.aspx) were used to edit, assemble, and translate sequences. This technique enabled identification of a 1,355-bp DNA fragment from the newborn whale that encompassed partial nucleoprotein and phosphoprotein genes (i.e., the N1-P2 consensus fragment; GenBank acces-sion no. KR337460). This fragment, from lung and cerebral samples, showed 98.89% sequence homology with the com-plete DMV genome (GenBank accession no. AJ608288) and 99.85% sequence homology with a DMV strain identified in long-finned pilot whales (Globicephala melas) that were affected by the 2006–2007 epidemic in the Mediterranean (GenBank accession no. HQ829972). Amino acid changes in KR337460, compared with AJ608288, are shown in Figure 2. The same DNA fragment was recovered from the new-born whale’s spleen and thymus by using the PCR protocol mentioned above (online Technical Appendix Figure 2).Viral hemagglutinin (H) protein mediates DMV entry into host cells by specifically binding with the whale’s signaling lymphocyte activation molecule (SLAM)/CD150; thus, we also investigated variations in the H gene of the newborn whale by using the previously de-scribed cloning procedures for cerebral cDNA with 3 new overlapping primers pairs (Table 2; Figure 2). This technique enabled identification of a 1,699-bp DNA frag-ment encompassing a partial H gene sequence; 116 bp at the beginning of the gene were missing. The H con-sensus fragment, obtained from the cDNA clone for each primer pair, showed 99.41% sequence homology with the complete DMV genome (GenBank accession no. AJ608288) and 99.94% sequence homology with the DMV strain identified in long-finned pilot whales (GenBank accession no. HQ829972). We also identified 2 aa changes: the previously reported p.Val164Ala (11) and a novel variation, p.Ala451Thr, located within the H protein region (residues 382–582) involved in SLAM bind-ing (Figure 2) (12). This variation was previously reported in other related morbilliviruses (13) and does not control any change in the tertiary structure of H antigen, as deter-mined by using the SWISS-MODEL (http://swissmodel. expasy.org/) modeling program.ConclusionsThe results of our direct (IHC and biomolecular) and indi-rect (serologic) testing provide evidence of DMV infection or exposure in 5 (55%) of 9 fin whales that were found stranded off the Mediterranean Coast during 2011–2013. 	 Emerging	Infectious	Diseases	•	www.cdc.gov/eid	•	Vol.	22,	No.	2,	February	2016	 303   Table 1. Demographic	data	and	examination	results	for	5	dolphin morbillivirus–positive fin whales stranded off the Mediterranean Sea, 2011–2013* Whale no., sex/length, m† Stranding date Closest DMV outbreak Dolphin morbillivirus–positive samples, by test RT-PCR‡ IHC analysis‡ VN 1,	M/17 2011	Oct	25 Dec	2010–Jun	2011 Liver, spleen, lungs ND ND 2,	F/10 2011	Nov	3 Dec	2010–Jun	2011 Liver, spleen, lymph nodes, skeletal muscle Negative ND 3,	M/10 2011	Nov	20 Dec	2010–Jun	2011 Negative ND Positive 4,	F/15 2013	Mar	19 Jan–Apr	2013 Lymph nodes ND Negative 5,	F/5 2013	Oct	11 Jan–Apr	2013 Brain, lungs, spleen, thymus Brain, thymus Negative *IHC,	immunohistochemical;	ND,	not	done; RT-PCR,	reverse	transcription	PCR;	VN,	virus	neutralization †Whales 1 and 4 were juveniles; whales 2 and 3 were calves. ‡Tissues routinely examined for morbillivirus: lung, liver, spleen, kidney, prescapular and pulmonary lymph nodes, brain, thymus (if available), tonsils, and skeletal muscle.  Figure 1.	Mayer	hematoxylin	counterstained	tissue	samples	from	a	newborn	fin	whale	stranded	off	the	Mediterranean	Sea,	October	2013.	A)	Brain	tissue	showing	positive	immunostaining	for	morbillivirus antigen in macrophages in the meningeal space. B) Fin	whale	thymus	showing	positive	immunostaining	for	morbillivirus	antigen	in	thymocytes	and	macrophages.	For	both	samples,	morbillivirus was detected by immunohistochemical analysis, using a	rabbit	hyperimmune	anti–rinderpest	virus	serum	(provided	by	Pirbright	Institute,	Pirbright,	UK)	(10).	Original	magnification	×40.	Scale	bars	indicate	50	μm.DISPATCHESThese 5 infected whales correspond to 21.7% of the 23 whales stranded along the Italian coastline during 2006–2014. The other 4 examined whales showed no evidence of morbillivirus infection. The range of DMV-susceptible host species has progressively expanded (5), as highlighted by the recent report of DMV infection in a captive com-mon seal (Phoca vitulina) during the 2011 outbreak (14). This expansion, combined with spread of DMV through the transplacental route, resulting in virus colonization of the thymus in fetuses, could represent DMV survival strategies among cetacean populations. In addition, our data argue in favor of an epidemic cluster of fatal DMV among the Mediterranean fin whale population, even though, on the basis of the amino acid sequence of the SLAM/CD150 viral receptor, this species is not included among those suscep-tible to DMV epidemics (5,12).Although the single amino acid substitution, p.Ala451Thr, did not cause substantial variations in the structure of H antigen, the effect of the variation on protein functions is unclear. Recent studies showed that similar amino acid changes could affect virulence and infectivity of different Canine distemper virus (family Paramyxoviridae, genus Morbillivirus) strains, but such changes are often neutralized by compensatory muta-tions that preserve the biologic activity of H protein (15). Furthermore, despite the high sequence homology observed between N, P, and H genes of the DMV strain identified in the newborn fin whale in our study and in the 304	 Emerging	Infectious	Diseases	•	www.cdc.gov/eid	•	Vol.	22,	No.	2,	February	2016Figure 2.	Genomic	organization	of	the	dolphin	morbillivirus	(GenBank	accession	no.	KR337460)	isolated	from	a	newborn	fin	whale	found	stranded	on	Elba	Island,	Italy,	October	2013.	Boxes	in	first	row	indicate	amino	acid	changes	identified	in	each	gene;	asterisks	indicate	nonsynonymous	amino	acid	substitutions.	Boxes	in	the	second	row	indicate	the	morbillivirus	gene	structure;	horizontal	lines	indicate	noncoding	sequences.	Boxes	in	the	third	row	indicate	the	total	length	of	the	2	analyzed	virus	fragments,	and	their	sequences	are	shown,	respectively,	in	boxes	in	the	bottom	row.	N,	nucleoprotein	gene;	P/V/C,	phosphoprotein	gene	with	nonstructural	proteins	V	and	C;	H,	hemagglutinin	gene;	F,	fusion	gene;	L,	large	protein	gene.	Primers	DMV-N1	and	DMV-P2	(11)	were	used	to	amplify	a	1,355-bp	nt	sequence	(left	box	in	bottom	row)	representing	partial	portion	of	N	gene	and	P/V/C	gene	(shown	in	uppercase	letters);	lowercase	letters	indicate	noncoding	sequences.	Three	overlapping	primer	pairs	were	used	to	amplify	a	1,699-bp	nt	sequence	(right	box	in	bottom	row)	representing	the	entire	H	gene.	Underlined	bases	indicate	nucleotide	variations	from	the	complete	DMV	sequence	(GenBank	accession	no.	AJ608288).	The	distribution	of	amino	acid	changes	identified	in	each	gene	are	shown	in	the	top	row.   Table 2. Primers designed on dolphin morbillivirus isolate used for the total hemagglutinin gene sequence analysis of the virus detected	in	the	newborn	fin	whale* Primer Nucleotide	position Sense sequence, 53 Fragment	length,	bp DMV-10F 7206–7226 GGGTGTGCTAGCCGTTATGT 718 DMV-10R 7904–7924 TTCGTCCTCATCAATCACCA 718 DMV	11F 7799–7891 CCGAACCTGATGATCCATTT 612 DMV-11R 8391–8411 CGTAAATGTCCATCCCTGCT 612 DMV-12F 8290–8309 AACCGGATCCCAGCTTATG 800 DMV-12R 9070–9090 CCAGGTGCACTTCAGGGTAT 800 *Isolate GenBank	accession	no.	AJ608288. Annealing	temperature	for	all	primers	was	56°C. DMV,	dolphin	morbillivirus;	F,	forward;	R,	reverse.   Mediterranean	Fin	Whales	and	Dolphin	Morbillivirusisolates recovered from DMV-affected cetaceans during the 1990–1992 and the 2006–2007 epidemics (GenBank accession no. AJ608288), we cannot exclude that more prominent differences occurred in virus genes encoding for both structural and nonstructural proteins responsible for virulence and pathogenicity (e.g., P/V/C and fusion genes) (5); the simultaneous occurrence of primary struc-ture differences, if any, in the SLAM/CD150 receptor should also be taken into account (5,12). In conclusion, although further studies are needed to elucidate the com-plex virus–host interaction dynamics and the putative in-fluence exerted by environmental factors, DMV should be regarded as one of the major threats for the conservation of fin whales within the Mediterranean Sea.AcknowledgmentsWe thank Bruno Cozzi and Maristella Giurisato for storing and delivering samples and Giuseppe Palmisano and Emanuele Zanetti for their support during necropsies in the field.This study was partially funded by the Italian Ministry of  the Environment.Dr. Mazzariol is currently assistant professor in veterinary pathology at the University of Padova, Padua, Italy. His primary research interests are diseases of marine mammals, with a special emphasis on those affecting large whales.References  1. Bérubé M, Aguilar A, Dendanto D, Larsen F, Notarbartolo di Sciara G, Sears R, et al. Population genetic structure of North Atlantic, Mediterranean Sea and Sea of Cortez fin whales,  Balaenoptera physalus (Linnaeus 1758): analysis of  mitochondrial and nuclear loci. Mol Ecol. 1998;7:585–99.   http://dx.doi.org/10.1046/j.1365-294x.1998.00359.x  2. Panigada S, Pesante G, Zanardelli M, Capoulade F, Gannier A,  Weinrich MT. Mediterranean fin whales at risk from fatal ship strikes. Mar Pollut Bull. 2006;52:1287–98.  http://dx.doi.org/ 10.1016/j.marpolbul.2006.03.014  3. Pinzone M, Budzinski H, Tasciotti A, Ody D, Lepoint G,  Schnitzler J, et al. POPs in free-ranging pilot whales, sperm whales and fin whales from the Mediterranean Sea: influence of  biological and ecological factors. Environ Res. 2015;142:185–96.  http://dx.doi.org/10.1016/j.envres.2015.06.021  4. Castellote M, Clark CW, Lammers MO. Acoustic and behavioral changes by fin whales (Balaenoptera physalus) in response to  shipping and airgun noise. Biol Conserv. 2012;147:115–22.  http://dx.doi.org/10.1016/j.biocon.2011.12.021  5. Van Bressem MF, Duignan PJ, Banyard A, Barbieri M,  Colegrove KM, De Guise S, et al. Cetacean morbillivirus: current knowledge and future directions. Viruses. 2014;6:5145–81.  http://dx.doi.org/10.3390/v6125145  6. Casalone C, Mazzariol S, Pautasso A, Di Guardo G, Di Nocera F, Lucifora G, et al. Cetacean strandings in Italy: an unusual mortality event along the Tyrrhenian Sea coast in 2013. Dis Aquat Organ. 2014;109:81–6. http://dx.doi.org/10.3354/dao02726  7. Di Guardo G, Di Francesco CE, Eleni C, Cocumelli C, Scholl F, Casalone C, et al. Morbillivirus infection in cetaceans stranded along the Italian coastline: pathological, immunohistochemical  and biomolecular findings. Res Vet Sci. 2013;94:132–7.  http://dx.doi.org/10.1016/j.rvsc.2012.07.030  8. Mazzariol S, Marcer F, Mignone W, Serracca L, Goria M, Marsili L, et al. Dolphin Morbillivirus and Toxoplasma gondii coinfection in a Mediterranean fin whale (Balaenoptera physalus). BMC  Vet Res. 2012;8:20. http://dx.doi.org/10.1186/1746-6148-8-20  9. Profeta F, Di Francesco CE, Marsilio F, Mignone W, Di Nocera F,  De Carlo E, et al. Retrospective seroepidemiological  investigations against Morbillivirus, Toxoplasma gondii and  Brucella spp. in cetaceans stranded along the Italian  coastline (1998–2014). Res Vet Sci. 2015;101:89–92.  http://dx.doi.org/10.1016/j.rvsc.2015.06.00810. Yang WC, Pang VF, Jeng CR, Chou LS, Chueh LL. Morbilliviral  infection in a pygmy sperm whale (Kogia breviceps) from Taiwanese waters. Vet Microbiol. 2006;116:69–76. http://dx.doi.org/10.1016/ j.vetmic.2006.03.01411. Bellière EN, Esperón F, Sánchez-Vizcaíno JM. Genetic comparison among dolphin morbillivirus in the 1990–1992 and 2006–2008 Mediterranean outbreaks. Infect Genet Evol. 2011;11:1913–20.12. Ohishi K, Ando A, Suzuki R, Takishita K, Kawato M,  Katsumata E, et al. Host-virus specificity of morbilliviruses predicted by structural modeling of the marine mammal SLAM, a receptor. Comp Immunol Microbiol Infect Dis. 2010;33:227–41. http://dx.doi.org/10.1016/j.cimid.2008.10.00313. Blixenkrone-Møller M, Bolt G, Jensen TD, Harder T, Svansson V.  Comparative analysis of the attachment protein gene (H) of dolphin morbillivirus. Virus Res. 1996;40:47–55. http://dx.doi.org/ 10.1016/0168-1702(95)01254-014. Mazzariol S, Peletto S, Mondin A, Centelleghe C, Di Guardo G, Di Francesco CE, et al. Dolphin morbillivirus infection in a captive harbor seal (Phoca vitulina). J Clin Microbiol. 2013;51:708–11. http://dx.doi.org/10.1128/JCM.02710-1215. Sattler U, Khosravi M, Avila M, Pilo P, Langedijk JP,  Ader-Ebert N, et al. Identification of amino acid substitutions with compensational effects in the attachment protein of canine  distemper virus. J Virol. 2014;88:8057–64. http://dx.doi.org/ 10.1128/JVI.00454-14Address for correspondence: Sandro Mazzariol, Department of Comparative Biomedicine and Food Science, University of Padova, AGRIPOLIS, Viale dell’Università 16, 35020, Legnaro (PD), Italy; email: sandro.mazzariol@unipd.it	 Emerging	Infectious	Diseases	•	www.cdc.gov/eid	•	Vol.	22,	No.	2,	February	2016	 305Emerging Infectious Diseases accepts thoughtful essays, short stories, or poems on philosophical issues related to science, medical practice, and human health. Topics may include science and the human condition, the unan-ticipated side of epidemic investigations, or how people perceive and cope with infection and illness. This section is intended to evoke compassion for human suffering and to	expand	the	science	reader’s	literary	scope.	Manuscripts	are selected for publication as much for their content (the experiences	they	describe)		as	for	their	literary	merit.Another Dimension

Mediterranean Fin Whales (Balaenoptera physalus) Threatened by Dolphin MorbilliVirus

Sandro Mazzariol

Cinzia Centelleghe

Giorgia Beffagna

Michele Povinelli

Giuliana Terracciano

Cristiano Cocumelli

Antonio Pintore

Daniele Denurra

Cristina Casalone

Alessandra Pautasso

Cristina Esmeralda Di Francesco

Giovanni Di Guardo

Crossref

Mediterranean Fin Whales (<i>Balaenoptera physalus</i>) Threatened by Dolphin MorbilliVirus

Mazzariol, S

Centelleghe, C

Beffagna, G

Povinelli, M

Terracciano, G

Cocumelli, C

Pintore, A

Denurra, D

Casalone, C

Pautasso, A

DI FRANCESCO, Cristina Esmeralda

DI GUARDO, Giovanni

Archivio della Ricerca - Università degli Studi di Teramo

Sandro Mazzariol, Cinzia Centelleghe,  Giorgia Beffagna, Michele Povinelli,  Giuliana Terracciano, Cristiano Cocumelli, Antonio Pintore, Daniele Denurra,  Cristina Casalone, Alessandra Pautasso,  Cristina Esmeralda Di Francesco,  Giovanni Di GuardoDuring	 2011–2013,	 dolphin	 morbillivirus	 was	 molecularly	identified	in	4	stranded	fin	whales	from	the	Mediterranean	Sea.	 Nucleoprotein,	 phosphoprotein,	 and	 hemagglutinin	gene	sequences	of	the	identified	strain	were	highly	homolo-gous	with	those	of	a	morbillivirus	that	caused	a	2006–2007	epidemic in the Mediterranean. Dolphin morbillivirus repre-sents	a	serious	threat	for	fin	whales.Fin whales (Balaenoptera physalus) living in the Medi-terranean Sea belong to a population that is part of the Atlantic stock (1). For feeding purposes, these whales tend to concentrate in specific areas, one of which is Pelagos Sanc-tuary, the widest protected marine area for sea mammals in the Mediterranean Basin between Italy, France, and Monaco. In Pelagos Sanctuary and, in general, in the entire Mediter-ranean Sea, fin whales are considered vulnerable because of several anthropogenic threats, the most common of which are ship strikes, chemical pollution, and noise (2–4).Postmortem investigations on well-preserved whale carcasses are necessary to gain evidence-based insight into the effect these threats have on fin whales; thus, the car-casses of all large cetaceans found stranded along the Ital-ian coastline are systematically examined to determine the cause of death. Because morbillivirus infections have been detected during these postmortem investigations, we con-ducted a study to determine the effect of this natural threat on the Mediterranean fin whale population.The StudyDuring 2006–2014, a total of 23 fin whales were found stranded along the coast of Italy. We systematically con-ducted full necropsies and microscopy- and molecular-based analyses on 9 (39%) carcasses that were in good conservation status. Of these 9 fin whales, 2 were juveniles and 2 were calves found during January 2011–February 2013 along the coasts of Tuscany, Sardinia, and Liguria, Italy. These young whales showed pathologic, immunohis-tochemical (IHC), biomolecular, and/or serologic evidence of dolphin morbillivirus (DMV) infection (Table 1) (5–9); however, not all of these cases were spatially or tempo-rally related to known fatal DMV-associated outbreaks that occurred during 2006–2014 (online Technical Appendix Figure 1, http://wwwnc.cdc.gov/EID/article/22/2/15-0882-Techapp1.pdf). Moreover, in October 2013, a newborn male fin whale was found stranded alive on Elba Island (Tuscany); the whale died after a few hours, and postmor-tem investigations conducted within 24 hours of death yielded biomolecular and IHC evidence of DMV infec-tion. Viral genome, antigen, or both were found in several tissues, along with a parasitic infection and a generalized lymphocytic depletion. Hyperimmune rabbit anti–rinder-pest virus serum (provided by Pirbright Institute, Pirbright, UK) (10) was used to detect morbillivirus antigens; only circulating monocytes and tissue macrophages in brain and thymus stained positively (Figure 1).DMV genome was detected in brain, lung, spleen, and thymus from the newborn whale; viral RNA was extracted from these tissues by using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). Primer DMV2 (11) and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) were used to synthesize cDNA; primer and viral RNA were incubated at 42°C for 60 min followed by 70°C for 5 min. Amplification was performed by using prim-ers DMV-N1 and DMV-P2 (11) and Phusion Hot Start II DNA Polymerase (Thermo Scientific) with the following PCR conditions: 30 s at 98°C; 35 cycles of 10 s at 98°C, 30 s at 62°C, 1 min at 72°C; and 10 min at 72°C. Next, the DNA fragments obtained from lung and cerebral cDNA were purified, cloned into the plasmid vector pCR-Blunt II-TOPO (Invitrogen, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions, and then sequenced.Sequences from 5 lung and 4 cerebral plasmidic colonies were analyzed. Programs in the DNASTAR Mediterranean Fin Whales  (Balaenoptera physalus)  Threatened by Dolphin MorbilliVirus302	 Emerging	Infectious	Diseases	•	www.cdc.gov/eid	•	Vol.	22,	No.	2,	February	2016Author	affiliations:	University	of	Padova,	Padua,	Italy	 (S.	Mazzariol,	C.	Centelleghe,	G.	Beffagna,	M.	Povinelli);	Istituto	Zooprofilattico	Sperimentale	del	Lazio	e	della	Toscana,	Rome,	Italy	(G.	Terracciano,	C.	Cocumelli);	Istituto	Zooprofilattico	 Sperimentale della Sardegna, Sassari, Italy (A. Pintore,  D.	Denurra);	Istituto	Zooprofilattico	Sperimentale	del	Piemonte,	Liguria e Valle d’Aosta, Turin, Italy (C. Casalone, A. Pautasso); University	of	Teramo	Faculty	of	Veterinary	Medicine,	Teramo,	Italy	(C.E.	Di	Francesco,	G.	Di	Guardo)DOI:	http://dx.doi.org/10.3201/eid2202.150882Mediterranean	Fin	Whales	and	Dolphin	MorbillivirusLasergene software package (http://www.dnastar.com/ t-dnastar-lasergene.aspx) were used to edit, assemble, and translate sequences. This technique enabled identification of a 1,355-bp DNA fragment from the newborn whale that encompassed partial nucleoprotein and phosphoprotein genes (i.e., the N1-P2 consensus fragment; GenBank acces-sion no. KR337460). This fragment, from lung and cerebral samples, showed 98.89% sequence homology with the com-plete DMV genome (GenBank accession no. AJ608288) and 99.85% sequence homology with a DMV strain identified in long-finned pilot whales (Globicephala melas) that were affected by the 2006–2007 epidemic in the Mediterranean (GenBank accession no. HQ829972). Amino acid changes in KR337460, compared with AJ608288, are shown in Figure 2. The same DNA fragment was recovered from the new-born whale’s spleen and thymus by using the PCR protocol mentioned above (online Technical Appendix Figure 2).Viral hemagglutinin (H) protein mediates DMV entry into host cells by specifically binding with the whale’s signaling lymphocyte activation molecule (SLAM)/CD150; thus, we also investigated variations in the H gene of the newborn whale by using the previously de-scribed cloning procedures for cerebral cDNA with 3 new overlapping primers pairs (Table 2; Figure 2). This technique enabled identification of a 1,699-bp DNA frag-ment encompassing a partial H gene sequence; 116 bp at the beginning of the gene were missing. The H con-sensus fragment, obtained from the cDNA clone for each primer pair, showed 99.41% sequence homology with the complete DMV genome (GenBank accession no. AJ608288) and 99.94% sequence homology with the DMV strain identified in long-finned pilot whales (GenBank accession no. HQ829972). We also identified 2 aa changes: the previously reported p.Val164Ala (11) and a novel variation, p.Ala451Thr, located within the H protein region (residues 382–582) involved in SLAM bind-ing (Figure 2) (12). This variation was previously reported in other related morbilliviruses (13) and does not control any change in the tertiary structure of H antigen, as deter-mined by using the SWISS-MODEL (http://swissmodel. expasy.org/) modeling program.ConclusionsThe results of our direct (IHC and biomolecular) and indi-rect (serologic) testing provide evidence of DMV infection or exposure in 5 (55%) of 9 fin whales that were found stranded off the Mediterranean Coast during 2011–2013. 	 Emerging	Infectious	Diseases	•	www.cdc.gov/eid	•	Vol.	22,	No.	2,	February	2016	 303   Table 1. Demographic	data	and	examination	results	for	5	dolphin morbillivirus–positive fin whales stranded off the Mediterranean Sea, 2011–2013* Whale no., sex/length, m† Stranding date Closest DMV outbreak Dolphin morbillivirus–positive samples, by test RT-PCR‡ IHC analysis‡ VN 1,	M/17 2011	Oct	25 Dec	2010–Jun	2011 Liver, spleen, lungs ND ND 2,	F/10 2011	Nov	3 Dec	2010–Jun	2011 Liver, spleen, lymph nodes, skeletal muscle Negative ND 3,	M/10 2011	Nov	20 Dec	2010–Jun	2011 Negative ND Positive 4,	F/15 2013	Mar	19 Jan–Apr	2013 Lymph nodes ND Negative 5,	F/5 2013	Oct	11 Jan–Apr	2013 Brain, lungs, spleen, thymus Brain, thymus Negative *IHC,	immunohistochemical;	ND,	not	done; RT-PCR,	reverse	transcription	PCR;	VN,	virus	neutralization †Whales 1 and 4 were juveniles; whales 2 and 3 were calves. ‡Tissues routinely examined for morbillivirus: lung, liver, spleen, kidney, prescapular and pulmonary lymph nodes, brain, thymus (if available), tonsils, and skeletal muscle.  Figure 1.	Mayer	hematoxylin	counterstained	tissue	samples	from	a	newborn	fin	whale	stranded	off	the	Mediterranean	Sea,	October	2013.	A)	Brain	tissue	showing	positive	immunostaining	for	morbillivirus antigen in macrophages in the meningeal space. B) Fin	whale	thymus	showing	positive	immunostaining	for	morbillivirus	antigen	in	thymocytes	and	macrophages.	For	both	samples,	morbillivirus was detected by immunohistochemical analysis, using a	rabbit	hyperimmune	anti–rinderpest	virus	serum	(provided	by	Pirbright	Institute,	Pirbright,	UK)	(10).	Original	magnification	×40.	Scale	bars	indicate	50	μm.DISPATCHESThese 5 infected whales correspond to 21.7% of the 23 whales stranded along the Italian coastline during 2006–2014. The other 4 examined whales showed no evidence of morbillivirus infection. The range of DMV-susceptible host species has progressively expanded (5), as highlighted by the recent report of DMV infection in a captive com-mon seal (Phoca vitulina) during the 2011 outbreak (14). This expansion, combined with spread of DMV through the transplacental route, resulting in virus colonization of the thymus in fetuses, could represent DMV survival strategies among cetacean populations. In addition, our data argue in favor of an epidemic cluster of fatal DMV among the Mediterranean fin whale population, even though, on the basis of the amino acid sequence of the SLAM/CD150 viral receptor, this species is not included among those suscep-tible to DMV epidemics (5,12).Although the single amino acid substitution, p.Ala451Thr, did not cause substantial variations in the structure of H antigen, the effect of the variation on protein functions is unclear. Recent studies showed that similar amino acid changes could affect virulence and infectivity of different Canine distemper virus (family Paramyxoviridae, genus Morbillivirus) strains, but such changes are often neutralized by compensatory muta-tions that preserve the biologic activity of H protein (15). Furthermore, despite the high sequence homology observed between N, P, and H genes of the DMV strain identified in the newborn fin whale in our study and in the 304	 Emerging	Infectious	Diseases	•	www.cdc.gov/eid	•	Vol.	22,	No.	2,	February	2016Figure 2.	Genomic	organization	of	the	dolphin	morbillivirus	(GenBank	accession	no.	KR337460)	isolated	from	a	newborn	fin	whale	found	stranded	on	Elba	Island,	Italy,	October	2013.	Boxes	in	first	row	indicate	amino	acid	changes	identified	in	each	gene;	asterisks	indicate	nonsynonymous	amino	acid	substitutions.	Boxes	in	the	second	row	indicate	the	morbillivirus	gene	structure;	horizontal	lines	indicate	noncoding	sequences.	Boxes	in	the	third	row	indicate	the	total	length	of	the	2	analyzed	virus	fragments,	and	their	sequences	are	shown,	respectively,	in	boxes	in	the	bottom	row.	N,	nucleoprotein	gene;	P/V/C,	phosphoprotein	gene	with	nonstructural	proteins	V	and	C;	H,	hemagglutinin	gene;	F,	fusion	gene;	L,	large	protein	gene.	Primers	DMV-N1	and	DMV-P2	(11)	were	used	to	amplify	a	1,355-bp	nt	sequence	(left	box	in	bottom	row)	representing	partial	portion	of	N	gene	and	P/V/C	gene	(shown	in	uppercase	letters);	lowercase	letters	indicate	noncoding	sequences.	Three	overlapping	primer	pairs	were	used	to	amplify	a	1,699-bp	nt	sequence	(right	box	in	bottom	row)	representing	the	entire	H	gene.	Underlined	bases	indicate	nucleotide	variations	from	the	complete	DMV	sequence	(GenBank	accession	no.	AJ608288).	The	distribution	of	amino	acid	changes	identified	in	each	gene	are	shown	in	the	top	row.   Table 2. Primers designed on dolphin morbillivirus isolate used for the total hemagglutinin gene sequence analysis of the virus detected	in	the	newborn	fin	whale* Primer Nucleotide	position Sense sequence, 53 Fragment	length,	bp DMV-10F 7206–7226 GGGTGTGCTAGCCGTTATGT 718 DMV-10R 7904–7924 TTCGTCCTCATCAATCACCA 718 DMV	11F 7799–7891 CCGAACCTGATGATCCATTT 612 DMV-11R 8391–8411 CGTAAATGTCCATCCCTGCT 612 DMV-12F 8290–8309 AACCGGATCCCAGCTTATG 800 DMV-12R 9070–9090 CCAGGTGCACTTCAGGGTAT 800 *Isolate GenBank	accession	no.	AJ608288. Annealing	temperature	for	all	primers	was	56°C. DMV,	dolphin	morbillivirus;	F,	forward;	R,	reverse.   Mediterranean	Fin	Whales	and	Dolphin	Morbillivirusisolates recovered from DMV-affected cetaceans during the 1990–1992 and the 2006–2007 epidemics (GenBank accession no. AJ608288), we cannot exclude that more prominent differences occurred in virus genes encoding for both structural and nonstructural proteins responsible for virulence and pathogenicity (e.g., P/V/C and fusion genes) (5); the simultaneous occurrence of primary struc-ture differences, if any, in the SLAM/CD150 receptor should also be taken into account (5,12). In conclusion, although further studies are needed to elucidate the com-plex virus–host interaction dynamics and the putative in-fluence exerted by environmental factors, DMV should be regarded as one of the major threats for the conservation of fin whales within the Mediterranean Sea.AcknowledgmentsWe thank Bruno Cozzi and Maristella Giurisato for storing and delivering samples and Giuseppe Palmisano and Emanuele Zanetti for their support during necropsies in the field.This study was partially funded by the Italian Ministry of  the Environment.Dr. Mazzariol is currently assistant professor in veterinary pathology at the University of Padova, Padua, Italy. His primary research interests are diseases of marine mammals, with a special emphasis on those affecting large whales.References  1. Bérubé M, Aguilar A, Dendanto D, Larsen F, Notarbartolo di Sciara G, Sears R, et al. Population genetic structure of North Atlantic, Mediterranean Sea and Sea of Cortez fin whales,  Balaenoptera physalus (Linnaeus 1758): analysis of  mitochondrial and nuclear loci. Mol Ecol. 1998;7:585–99.   http://dx.doi.org/10.1046/j.1365-294x.1998.00359.x  2. Panigada S, Pesante G, Zanardelli M, Capoulade F, Gannier A,  Weinrich MT. Mediterranean fin whales at risk from fatal ship strikes. Mar Pollut Bull. 2006;52:1287–98.  http://dx.doi.org/ 10.1016/j.marpolbul.2006.03.014  3. Pinzone M, Budzinski H, Tasciotti A, Ody D, Lepoint G,  Schnitzler J, et al. POPs in free-ranging pilot whales, sperm whales and fin whales from the Mediterranean Sea: influence of  biological and ecological factors. Environ Res. 2015;142:185–96.  http://dx.doi.org/10.1016/j.envres.2015.06.021  4. Castellote M, Clark CW, Lammers MO. Acoustic and behavioral changes by fin whales (Balaenoptera physalus) in response to  shipping and airgun noise. Biol Conserv. 2012;147:115–22.  http://dx.doi.org/10.1016/j.biocon.2011.12.021  5. Van Bressem MF, Duignan PJ, Banyard A, Barbieri M,  Colegrove KM, De Guise S, et al. Cetacean morbillivirus: current knowledge and future directions. Viruses. 2014;6:5145–81.  http://dx.doi.org/10.3390/v6125145  6. Casalone C, Mazzariol S, Pautasso A, Di Guardo G, Di Nocera F, Lucifora G, et al. Cetacean strandings in Italy: an unusual mortality event along the Tyrrhenian Sea coast in 2013. Dis Aquat Organ. 2014;109:81–6. http://dx.doi.org/10.3354/dao02726  7. Di Guardo G, Di Francesco CE, Eleni C, Cocumelli C, Scholl F, Casalone C, et al. Morbillivirus infection in cetaceans stranded along the Italian coastline: pathological, immunohistochemical  and biomolecular findings. Res Vet Sci. 2013;94:132–7.  http://dx.doi.org/10.1016/j.rvsc.2012.07.030  8. Mazzariol S, Marcer F, Mignone W, Serracca L, Goria M, Marsili L, et al. Dolphin Morbillivirus and Toxoplasma gondii coinfection in a Mediterranean fin whale (Balaenoptera physalus). BMC  Vet Res. 2012;8:20. http://dx.doi.org/10.1186/1746-6148-8-20  9. Profeta F, Di Francesco CE, Marsilio F, Mignone W, Di Nocera F,  De Carlo E, et al. Retrospective seroepidemiological  investigations against Morbillivirus, Toxoplasma gondii and  Brucella spp. in cetaceans stranded along the Italian  coastline (1998–2014). Res Vet Sci. 2015;101:89–92.  http://dx.doi.org/10.1016/j.rvsc.2015.06.00810. Yang WC, Pang VF, Jeng CR, Chou LS, Chueh LL. Morbilliviral  infection in a pygmy sperm whale (Kogia breviceps) from Taiwanese waters. Vet Microbiol. 2006;116:69–76. http://dx.doi.org/10.1016/ j.vetmic.2006.03.01411. Bellière EN, Esperón F, Sánchez-Vizcaíno JM. Genetic comparison among dolphin morbillivirus in the 1990–1992 and 2006–2008 Mediterranean outbreaks. Infect Genet Evol. 2011;11:1913–20.12. Ohishi K, Ando A, Suzuki R, Takishita K, Kawato M,  Katsumata E, et al. Host-virus specificity of morbilliviruses predicted by structural modeling of the marine mammal SLAM, a receptor. Comp Immunol Microbiol Infect Dis. 2010;33:227–41. http://dx.doi.org/10.1016/j.cimid.2008.10.00313. Blixenkrone-Møller M, Bolt G, Jensen TD, Harder T, Svansson V.  Comparative analysis of the attachment protein gene (H) of dolphin morbillivirus. Virus Res. 1996;40:47–55. http://dx.doi.org/ 10.1016/0168-1702(95)01254-014. Mazzariol S, Peletto S, Mondin A, Centelleghe C, Di Guardo G, Di Francesco CE, et al. Dolphin morbillivirus infection in a captive harbor seal (Phoca vitulina). J Clin Microbiol. 2013;51:708–11. http://dx.doi.org/10.1128/JCM.02710-1215. Sattler U, Khosravi M, Avila M, Pilo P, Langedijk JP,  Ader-Ebert N, et al. Identification of amino acid substitutions with compensational effects in the attachment protein of canine  distemper virus. J Virol. 2014;88:8057–64. http://dx.doi.org/ 10.1128/JVI.00454-14Address for correspondence: Sandro Mazzariol, Department of Comparative Biomedicine and Food Science, University of Padova, AGRIPOLIS, Viale dell’Università 16, 35020, Legnaro (PD), Italy; email: sandro.mazzariol@unipd.it	 Emerging	Infectious	Diseases	•	www.cdc.gov/eid	•	Vol.	22,	No.	2,	February	2016	 305Emerging Infectious Diseases accepts thoughtful essays, short stories, or poems on philosophical issues related to science, medical practice, and human health. Topics may include science and the human condition, the unan-ticipated side of epidemic investigations, or how people perceive and cope with infection and illness. This section is intended to evoke compassion for human suffering and to	expand	the	science	reader’s	literary	scope.	Manuscripts	are selected for publication as much for their content (the experiences	they	describe)		as	for	their	literary	merit.Another Dimension

Mediterranean fin whales (Balaenoptera physalus) threatened by Dolphin Morbillivirus

Mazzariol, Sandro

Centelleghe, Cinzia

Beffagna, Giorgia

Padua Research Archive

During 2011–2013, dolphin morbillivirus was molecularly identified in 4 stranded fin whales from the Mediterranean Sea. Nucleoprotein, phosphoprotein, and hemagglutinin gene sequences of the identified strain were highly homologous with those of a morbillivirus that caused a 2006–2007 epidemic in the Mediterranean. Dolphin morbillivirus represents a serious threat for fin whales

Directory of Open Access Journals

https://research.unite.it/bitstream/11575/92859/1/Mazzariol_et_al_Emerg_Infect_Dis_February_2016.pdf

Mediterranean Fin Whales (Balaenoptera physalus) Threatened by Dolphin MorbilliVirus

Abstract

Similar works

Full text

Available Versions

Archivio istituzionale della ricerca - Università di Padova

Crossref

Archivio della Ricerca - Università degli Studi di Teramo

Padua Research Archive

Directory of Open Access Journals