BONURA, Celestino

CALA', Cinzia

FASCIANA, Teresa Maria Assunta

GIAMMANCO, Anna

PALMERI A.

PISTOIA D

VELLA A

Archivio istituzionale della ricerca - Università di Palermo

Induction of IL-8 productionby Helicobacter pylori strainswith different cagA genotypeand oipA functional status.Giammanco A.*, Calà C.*, Bonura C.*, Fasciana T.*, Pistoia D.*, Vella A.*, Palmeri A.**Departement of Sciences for Health Promotion,Section of Microbiology, University of PalermoPalermo, Italy IL-8 is a potent neutrophil chemotactic and activating proinflammatory cytokine, thought to be related to the mucosal infiltration with neutrophils and mononuclear cells characteristic of the Helicobacter pylori-related gastritis, and suggested to have a role in H.pylori-associated gastroduodenal diseases. Its induction by H.pylori strains is increased if a functional cag pathogenicity island (PAI) is present in the H.pylori strains or if their outer inflammatory protein (oipA) gene is in the functional on-status. The cagA positivity, expression of the presence of the cag PAI, and the oipA on-status are characters usually considered to be well correlated with each other. During a recent study on the Helicobacter pylori virulence genotypes circulating in Western Sicily, Italy, we isolated some strains in which the presence of cagA was associated with the presence of babA2 and vacAs1 and vacAm1 alleles, but not with the oipA on-status, evaluated by DNA sequencing, on the basis of the number of the CT dinucleotide repeats in the 5’ region of the gene.  Mainly to obtain evidence of the phenotypic functional status of their oipA genes, the Sicilian strains were cocultured with AGS gastric cancer cells and the IL-8 production was assayed by ELISA. Results are discussed with respect to the hypothesis that mutations in the promoter region of the oipA gene can prevent the switch effect of the CT repeats on the expression of a functional open reading frame. ABSTRACT  The ability to stimulate interleukin-8 (IL-8) production in gastric cell cultures is largely considered by several Authors as indicative of, and responsible for, the H.pylori capacity to induce gastric  inflammation characterized by mucosal  infiltration with  neutrophils and mononuclear cells [1]. This capacity is closely related to the progression of H.pylori infection “in vivo” and its detection can be useful for the evaluation of H.pylori virulence. Among the microbial factors involved in IL-8 secretion, a main importance has been attributed to the genes of the cag pathogenicity island (PAI), whose presence, revealed by the cytotoxin-associated gene (cagA), is associated with a more severe clinical outcome, and whose encoded proteins enhance the bacterial virulence not only by altering protein tyrosine phosphorylation but also by increasing host cell cytokine production. A higher IL-8 secretion is usually induced by cagA+ than by cagA- H.pylori strains, although, in vivo, some cagA- infections can be associated with severe gastric cellular infiltration and, in vitro, significant levels of IL-8 can be produced by some cagA- strains in cell lines as MKN45, AGS and KATO III [1]. Because of the last observations, the presence has been suggested of virulence factors other than cag PAI involved in IL-8 production and, because in vitro experiments indicate that IL-8 is produced from the epithelial cells only after viable H.pylori are attached to the cells, the possibility was evaluated that some bacterial outer membrane proteins (OMPs) are also responsible for a pro-inflammatory activity. In fact, a H.pylori OMP,  specifically the OipA (outer inflammatory protein-A), has been proposed to be an important virulence factor associated with enhanced IL-8 secretion and increased inflammation both in vitro and in vivo [1] [2] [3].  The functional status of  OipA is regulated by the slipped-strand repair mechanism based on the number of the CT dinucleotide repeats in the 5’ region of the oipA gene (switch on = functional and switch off = non-functional) and, currently, the presence of a functional OipA protein can be predicted by the PCR-based sequencing of the signal region of the gene. Isolates that contain the cag PAI typically also have oipA with functional status “on” [1] [2] [4].   As the strong correlation of oipA frame status with cagA status can make difficult to establish the relationship of oipA status to pathogenicity, interesting observations could be obtained by assays performed on the rare isolates not exhibiting such type of relationship. Here results are shown of IL-8 titration tests carried out on AGS gastric cancer cell line supernatants after infection with 32 H.pylori clinical strains recently isolated in Palermo, Sicily, in a study in which it was observed that the presence of  cagA  was not always associated with OipA on-status.           INTRODUCTIONMATERIALS AND METHODS  H.pylori strains Thirtytwo H.pylori strains were examined, originally isolated from biopsy samples of 30 patients who had undergone endoscopy for gastric symptoms (13 with inactive chronic gastritis CG, 7 with active chronic gastritis CGA, 9 with active chronic gastritis and gastric or duodenal peptic ulcer CGA+PU and only 1 with gastric cancer GC). The isolated strains, stored to -80°C,  were seeded on Columbia agar medium (Oxoid, Basingstoke, Hampshire, England) added with 7% horse blood and 0.4 % of selective supplement. The plates were incubated at 37°C under microaerobic conditions (CampyGen Oxoid) for 3 days. H.pylori bacteria had been previously identified on the basis of characteristic colony morphology, appearance on Gram staining, rapid urea hydrolysis, positive catalase, oxidase production and the API Campy Kit (bioMérieux) [5].  Extraction of bacterial DNA Genomic DNA was extracted from bacterial suspensions in sterile distilled water (200 μl) boiled for 10 min, and centrifuged for 5 min at 14,000 x g. Aliquots of 50 ng of the genomic DNA were used for PCRs.  Genotyping of H.pylori DNA from each strain was used for amplify: ureaseA, cagA, vacA, babA2 and oipA, using the specific primers [6], [7], [8], [9]. PCR was carried out in a 100 μl mixture containing two to four μl of each DNA solution, 10 mM Tris-HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 200 μM dNTPs, 200 nM of each primer, and 2.5 U of Ampli Taq Gold polymerase (Applied Biosystems). The amplification was performed in a Perkin-Elmer ThermoCycler 2400 under the following conditions: 10 min at 95°C, followed by 40 cycles at 94°C for 45 sec, 56°C for 45 sec, and 72°C for 45 sec, and a final extension at 72°C for 5 min. PCR products  were analyzed after electrophoresis on a 2% agarose gel. To determine the expression status of oipA gene, a PCR-sequencing-based methodology   was   applied   to   detect  the  correct  number  of  CT-dinucleotide  repeats [4] [8].  Cell colture and H.pylori coinfection  AGS human gastric epithelia cells were grown into 24 well-plates (1x105 cells/ml) in Ham’s F12 mediun supplemented with 10% fetal bovine serum (FBS), at 37°C in a 5% CO2 atmosphere for 48h.  Next, the medium was aspirated from wells,  serum-free F12 medium was added, and the plates were  incubated for an additional 24h.  At the same time H.pylori isolates were grown in Columbia agar medium for 48h and reseeded on new plates  for more 24h. For   IL-8 stimulation, AGS cells were cocultured with H.pylori suspensions  at 0.9 MacFarland torbidity (Densimat BioMerieux). After cocoltivation for 6h and 24h, the cell culture supernatant was collected, centrifuged for 5 min at 14,000 x g to remove particulates and stored at -80°C until IL-8 production assay [10], [11].  IL-8 assay The amount of IL-8 in each sample was measured by an enzyme-linked immunosorbent assay using the  Quantikine-Human CXCL8/IL-8 kit (R&D Systems) following the manufacturer’s instructions.  CG = inactive chronic gastritisCGA = active chronic gastritisCGA+PU = active chronic gastritis and gastric or duodenal peptic ulcerGC  = gastric cancer                                                    Gastric  disease*   No of patients         H. pylori Genotypes   CG  13           8  vacAs2m2cagA-         2  vacAs1m2cagA-         1  vacAs1m2cagA+         2  vacAs1m1cagA+   CGA   7           5  vacAs1m1cagA+         1  vacAs1m1cagA-         1  vacAs1m2cagA+    GCA+PU   9          5    vacAs1m1cagA+         2    vacAs1m2cagA+         1    vacAs2m2cagA- (antrum)         1   vacAs1m2cagA+ (corpus)         1 vacAs1s2m1m2cagA+   GC  1            1  vacAs1m2cagA+  ** Tab.1 Relationship  between  gastric  disease  and H.pylori cagA vacA and babA2 genotypes in 30 Sicilian patients included in the study.*** two different strains from a singol patients            Strain reference  Sequence of the signal peptide coding region No. of CT repeats oipA status cagA status D13 ATGAAAAAAGCCCTCTTACTAACTCTCTCTCTCT............. CGTT 6  on - 8 ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCT............... CGTT 6  on - D40 ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCT............... CGTT 6  on - 3DA ATGAAAAAAACTCTTTTA.........CTCTCTCTCTCT............... CGTT a 6  off - V28C ATGAAAAAAACTCTTTTA.........CTCTCTCTCTCTCTCTCT.  CGTT a 9  off - V28A ATGAAAAAAACTCTTTTA.........CTCTCTCTCTCTCT........ CGTT a 7  off - V17 ATGAAAAAAGCCCTCTTA........CTCTCTCTCTTTCTCT...... CGTT b 5+2 on - V08 ATGAAAAAAGCTCTTTTA.........CTCTCTCTCTCTCTCT...... CGTT c 8  on - D56 ATGAAAAAAACTCTTTTA.........CTCTCTCTCTCTCTCT...... CGTT c 8  on - 401 ATGAAAAAAGCTCTCTCTCTAACTCTCTCTCT................... CGTT 5  off - E01 ATGAAAAAAACTCTCTTACTAACTCTCTCTCTCTCTCT...... CGTT 8  off - 5 ATGAAAAAAGCTCTCTTA........CTCTCTCTCTCTCTCT...... CGTT c 8  on + D41 ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCT............... CGTT 6  on + 202 ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCT............... CGTT 6  on + D14 ATGAAAAAAGCCCTCTTACTAACTCTCTCTCTCT..............  CGTT 6  on + D44 ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCT............... CGTT 6  on + D51 ATGAAAAAAGCCCTCTTACTAACTCTCTCTCTCT.............. CGCT 6  on + 201 ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCTCTCTCT. CGTT 9  on + V18 ATGAAAAAAGCTCTCTTA........CTCTCTCTCTCTCTCT...... CGTT c 8  on + 102 ATGAAAAAAGCTCTTTTA.........CTCTCTCTCTTTCTCT...... CGTT b 5+2 on + V03 ATGAAAAAAGCCCTCTTA........CTCTCTCTCTTTCTCT...... CGTT b 5+2 on - V14A ATGAAAAAAGCCCTCTTACTAACTCTCTCTCT................... TGTT 5  off - V14C ATGAAAAAAGCCCTCTTACTAACTCTCTCTCTCT.............. CGTT 6  on + D55 ATGAAAAAAACTCTTTTA.........CTCTCTCTCTCT............... CGTT a 6  off + D30 ATGAAAAAAGCTCTCTTACTAACTCTCTTTTTCT CGTT d 3+1 on + D39 ATGAAAAAAGTTCTATTA.........CTCTCTCTCTCTCTCT...... CGTT c 8  on + 203 ATGAAAAAAGCCCTCTTA........CTCTCTCTCTTTCTCT...... CGTT b 5+2 on + 206 ATGAAAAAAGCCCTCTTA........CTCTCTCTCTCTCTCT CGTT c 8  on + 303 ATGAAAAAAGTTCTATTA.........CTCTCTCTCTCTCTCT...... CGTT c 8  on + 105 ATGAAAAAAGCTCTTTTA.........CTCTCTCTCTTTCTCT...... CGTT b 5+2 on + 103 ATGAAAAAAGTTCTATTA.........CTCTCTCTCTCTCT.......... CGTT a 7  off + K ATGAAAAAAGCCCTCTTACTAACTCTCTCTCTCT.............. CGTT 6  on + a = ORF with six, seven or nine repeats is out of frame due to deletion of CTAA sequenceb = ORF with seven CT repeats and one TT insertion is in frame due to deletion of CTAA sequencec = ORF with eight CT repeats is in frame due to deletion of CTAA sequenced = ORF with four CT repeats and two TT insertion without deletion of CTAA sequence is in frameAnalises  based on R. de Jonge [1] and T. Ando [2]Tab.2: Variations in the signal-sequence coding  region of the oipA gene and cagA status in 32 H.pyloristrains from Sicily, Italy                                            IL-8 assay No. of patient   Strain reference  Genotypes   oipA status  6h  pg/ml   24h  pg/ml  1 D13 vacAs2m2babA2+cagA- on 114,9 369,1 2 8 vacAs2m2babA2-cagA- on 60,6 140,6 3 D40 vacAs1m2babA2+cagA- on 37,8 121,7 4 3DA vacAs2m2babA2-cagA- off 107,6 247,4 V28 C vacAs2m2babA2-cagA- off 120,1 344,8 5 V28 A vacAs2m2babA2-cagA- off 35,7 121,5 6 V17 vacAs2m2babA2-cagA- on ND 80,8 7 V08 vacAs2m2babA2-cagA- on ND 107,8 8 D56 vacAs2m2babA2-cagA- on 33,7 374,8 9 401 vacAs1m2babA2-cagA- off 41,9 386,1 10 E01 vacAs2m2babA2-cagA- off ND 549,0 11 5 vacAs1m1babA2+cagA+ on 1158,2 1388,5 12 D41 vacAs1m1babA2+cagA+ on 523,7 1164,5 13 202 vacAs1m2babA-cagA+ on 742,9 1115,7 14 D14 vacAs1m1babA2+cagA+ on 1011,0 1867,9 15 D44 vacAs1m1babA2+cagA+ on 597,6 2326,1 16 D51 vacAs1m1babA2+cagA+ on 360,7 951,4 17 201 vacAs1m2babA2+cagA+ on 1566,2 2543,1 18 V18 vacAs1m1babA2-cagA+ on 325,8 545,6 19 102 vacAs1m1babA2+cagA+ on 476,8 788,6 20 V03 vacAs1m1babA+cagA- on 108,9 343,2 V14 A vacAs2m2babA2-cagA- off 88,4 279,5 21 V14 C vacAs1m2babA2+cagA+ on 789,5 1540,4 22 D55 vacAs1m1babA2+cagA+ off 1020,9 1427,8 23 D30 vacAs1m1babA2+cagA+ on 256,2 308,7 24 D39 vacAs1m1babA2+cagA+ on ND 2115,6 25 203 vacAs1m2babA2+cagA+ on 3832,3 1787,1 26 206 vacAs1m2babA2+cagA+ on 442,7 593,5 27 303 vacAs1m1babA2+cagA+ on 1451,1 1237,3 28 105 vacAs1m1babA2+cagA+ on 603,1 1506,4 29 103 vacAs1s2m1m2babA2-cagA+ off 970,3 2004,8 30 K vacAs1m2babA2-cagA+ on 1028,0 885,9 ND= not determinedTab.3: IL-8 stimulation by 32 H.pylori strains  characterized by different genotypes and oipA statusREFERENCE [1] Yamaoka Y.et al. A Mr 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori. Proc.Natl.Acad.Sci. USA 2000; 97: 7533-7538   [2] Yamaoka Y. et al. Importance of Helicobacter pylori oipA in clinical presentation, gastric inflammation, and mucosal interleukin 8 production.   Gastroenterology 2002; 123: 414-424.  [3] Kudo T. et al. Correlation between Helicobacter pylori OipA protein expression and oipA gene switch status. J.Clin.Microbiol 2004; 42: 2279-2281  [4] Ando T. et al. Polymorphisms of Helicobacter pylori HP0638 reflect geographic origin and correlate with cagA status. J.Clin.Microbiol 2000 40: 239-246.  [5] DM. Jones et al. Campylobacter like organisms on the gastric mucosa: culture, histological, and serological studies. J Clin. Pathol. 1984; 37: 1002-6.  [6] Mravak-Stipetic M. et al Detection of Helicobacter pylori in various oral lesions by nested polymerase chain reaction (PCR).. J. Oral Pathol Med 1998; 27: 1-3  [7] J. C. Atherton et al Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Journal of Biological Chemistry 1995; 28: 17771-77   [8] R. de Jonge et al. The functional status of the Helicobacter pylori sabB adhesin as putative marker for disease outcome. Helicobacter 2004 9: 158-164  [9] C-F. Zambon et al. Helicobacter pylori babA2, cagA, and s1 vacA genes work synergistically in causing intestinal metaplasia. J. Clin. Pathol. 2003; 56: 287-291  [10] A. Reyes-Leon et al. Heterogeneity in the Activity of Mexican Helicobacter   pylori Strains in Gastric Epithelial Cells and Its Association with Diversity in  the cagA Gene. Infect. Immun. 2007; 75: 3445-54  [11] R. H. Argent et al. Determinants and Consequences of Different Levels of CagA Phosphorylation for Clinical Isolates of Helicobacter pylori. Gastroenterology 2004; 127:514-523    

Induction of IL-8 production by Helicobacter pylori strains with different cagA genotype and oipA functional status.

https://iris.unipa.it/retrieve/handle/10447/77693/79866/Riga.pdf

Induction of IL-8 production by Helicobacter pylori strains with different cagA genotype and oipA functional status.

Abstract

Similar works

Full text

Available Versions

Archivio istituzionale della ricerca - Università di Palermo