There are few reports on Blastocystis spp. infections in invertebrate hosts namely,

cockroaches. Due to their close proximity to humans especially to their dwellings prompted

this study as these organisms could possibly play a role in human transmission. A total of 151

cockroaches consisted predominantly of nymph and adult stages were captured from several

types of dwellings in the state of Perak and Selangor, Malaysia. Approximately half (40.4%) of

the cockroach intestinal contents screened were positive and were found associated to two

main factors, host-stage and types of dwellings. The granular and vacuolated forms were the

most common cell form found in the in vitro cultures and were morphologically similar to B.

hominis. However, the surface coat observed was thick with an electron lucent area observed

in the central vacuole. The isolates grew in room temperature but optimal growth was

observed at a 24ºC similar to the reptilian Blastocystis with a high number of cells were

recovered. Using the DNA barcoding method, two isolates were identified as ST3 (allele 56),

one isolate was consider as the new subtype with close relation to allele 11

A., Rajamanikam

K., Suresh

M.K.N., Mohd Khalid

M.N., Nur Asyiqin

M.T., Farah Haziqah

P., Chandrawathani

S.N., Mohd Zain

Repository@USM

741Tropical Biomedicine 34(3): 741–745 (2017)Short CommunicationCurrent status of Blastocystis in cockroachesFarah Haziqah, M.T.1, Nur Asyiqin, M.N.1, Mohd Khalid, M.K.N.2, Suresh, K.3, Rajamanikam, A.3,Chandrawathani, P.4 and Mohd Zain, S.N.1*1Institute of Biological Sciences, Faculty of Sciences, University of Malaya, 50603 Kuala Lumpur, Malaysia2Molecular Diagnostics and Protein Unit, Specialised Diagnostics Centre, Institute for Medical Research,Jalan Pahang, 50588 Kuala Lumpur, Malaysia3Department of Parasitology, Faculty of Medicine, University of Malaya, 50603 Kuala Lumpur, Malaysia4Disease Control Division, Ministry of Health, Level 3 Block E 10, Complex E, Precint 1, Federal GovernmentAdministrative Centre, 62590 Putrajaya, Malaysia*Corresponding author e-mail: nsheena@um.edu.myReceived 12 February 2017; received in revised form 29 May 2017; accepted 2 June 2017Abstract. There are few reports on Blastocystis spp. infections in invertebrate hosts namely,cockroaches. Due to their close proximity to humans especially to their dwellings promptedthis study as these organisms could possibly play a role in human transmission. A total of 151cockroaches consisted predominantly of nymph and adult stages were captured from severaltypes of dwellings in the state of Perak and Selangor, Malaysia. Approximately half (40.4%) ofthe cockroach intestinal contents screened were positive and were found associated to twomain factors, host-stage and types of dwellings. The granular and vacuolated forms were themost common cell form found in the in vitro cultures and were morphologically similar to B.hominis. However, the surface coat observed was thick with an electron lucent area observedin the central vacuole. The isolates grew in room temperature but optimal growth wasobserved at a 24ºC similar to the reptilian Blastocystis with a high number of cells wererecovered. Using the DNA barcoding method, two isolates were identified as ST3 (allele 56),one isolate was consider as the new subtype with close relation to allele 114.Cockroaches are common house pestthroughout the tropics. These arthropodsare notorious mechanical vectors to manydiseases and have worldwide distribution,infesting many types of dwelling. It isbelieved that cockroaches may be areservoir to a range of pathogens such asStaphylococcus and Streptococcus andBlastocystis.  There are only few reportson the isolation of Blastocystis fromcockroaches. The occurrence of Blastocystisin the American cockroach (Periplanetaamericana) was reported in Singapore withhigh infection in cockroaches caught fromsewage tanks (Zaman et al., 1993). However,low occurrence of Blastocystis was reportedin cockroaches from urban human dwellingsin Malaysia (Suresh et al., 1997). After a gapof almost a decade, Yoshikawa et al. (2007)studied the ultrastructure by electronmicroscope and the SSU rRNA genes weresequenced. The present study is the firstto screen Blastocystis in cockroachesrecovered from various types of dwellingsas well as isolate subtype characterizationusing a vital new tool; DNA barcodingmethods.Cockroaches were captured from urbandwellings and structures namely, drainagesystem, residential homes and grocery storesfrom two urban locations; Ipoh, Perak andPuchong, Selangor. The cockroaches weretrapped using sticky traps and/or barehandedtechnique. Each specimen was transferred742into a sterile container, transported to thelaboratory and anaesthetised at 4°C for 10min. The host-stage for each specimen wasnoted prior to dissection. Dissection wascarried out under sterile conditions in whichthe sides of the abdomen were cut on eitherside of the anus and the complete gut wereremoved posteriorly. The contents were thenremoved and stored in a container prior tothe in vitro culture method using Jones’medium supplemented with 10% heat-activated horse serum (Suresh & Smith,2004). The contents of the culture wereexamined after 24 hours incubation at bothroom temperature and 37°C. The positiveisolates were stained with 10% Giemsastain and the ultrastructure studied usingtransmission electron microscopy aspreviously described (Chandrasekaran etal., 2014).Genomic DNA was then extracted with aQiagen stool extraction kit following themanufacturer’s instructions. A Blastocystis-specific primer, BhRDr (GAGCTTTTTAACTGCAACAACG; Scicluna et al., 2006) waspaired with eukaryote-specific primer, RD5(ATCTGGTTGATCCTGCCAGT; Clark, 1997)and used, in a single step PCR reaction, toamplify a 600 bp region of 18S rRNA. ThePCR was performed in a 25 µl volumecontaining 1.0 mM of dNTPs, 0.5 mM ofeach primer, 1 x PCR buffer, 2.5 mM MgCl,1 U Taq DNA Polymerase (recombinant)(FERMENTAS, USA) and 5 µl of genomicDNA. PCR conditions consisted of an initialdenaturing step of 94°C for 1 minute, followedby 30 cycles of 94°C for 1 minute, 59°C for1 minute and 72°C for 1 minute, followedby a final elongation step of 72°C at 2minutes (Thermo Cycler Bio-Rad, USA). PCRproducts were visualized on a 1.5% agarosegel prior to purification and cycle sequencingby a local commercial company. Sequencingdata were checked using Seq Scanner 2software (Applied Biosystems) for qualityand subsequently were edited to removelow quality bases and primer sequencesusing BioEdit software (http://www.mbio.ncsu.edu/bioedit/bioedit.html). Next, theedited sequences were queried against theBlastocystis 18S rRNA database (http://www.publmst.org/blastocystis) (Roberts et al.,2013).Statistical analyses were carried outusing the Statistical Package for the SocialSciences (SPSS) 21.0 software package. Chi-square analysis carried out to determinewhether infections were associated to eitherextrinsic or intrinsic factors. A probabilityvalue of less than 0.05 was consideredstatistically significant.This study records moderate infection(40.4%, n=115) in these invertebratescompared to previous studies. Statisticalanalyses found significant associationbetween infection with host-stage (χ2 =21.877, [df] = 1, P = 0.000), with higherinfections in nymphs 58.2% (46/79) comparedto adults 20.8% (15/72). Typically, nymphs aresimilar to adults, except for the absence ofthe wings, genitalia and also body colouring.Nymphs also differed in their feedingbehaviour. According to Richter & Barwolf(1994), nymphs of P. americana took largermeals during the first three days post-moult.This behaviour suggests that nymphs werehighly exposed to infection while foragingfor food.Blastocystis infections were also foundassociated to types of dwellings. Highinfections were noted for cockroachescaptured from grocery stores compared toresidential homes and drainage system.The abundance of starchy foods, sweetsubstances and meat product attractedthe arthopods to come out from hidingsuch as sewers and toilets to forage inthese dwellings. Zaman et al. (1993)reported infection incidences up to 80% incockroaches and attributed the infectionsto type of habitats i.e. sewage tanks.The in vitro cultures of cockroachisolates contained mostly vacuolar formsranging in size from 7 to 14 µm (Fig. 1A). Onoccasion, granular forms were also observedmeasuring between 9 to 20 µm in which thegranules were prominent and refractile (Fig.1B). It was also noted that the isolates grewat both 25°C and 37°C. However, cell growthwas optimal at room temperature with highernumber of cells recovered compared toisolates incubated at 37°C. As previously743Figure 1. Blastocystis isolated from cockroach. A) Vacuolar form and B) Granular form.Figure 2. Surface structure of Blastocystis from cockroach. (a) Smooth surface (b) Coarse andfolded surface.described, some Blastocystis organisms inpoikilothermal animals may have originatedfrom homoiothermal hosts (Yoshikawa etal., 2004).Scanning electron images showed thatmajority of the cells possessed a smoothsurface (Fig. 2A) similar to asymptomatichuman isolates whereas, some cells showedcoarse and folded surface (Fig. 2B) asseen in IBS isolates (Ragavan et al., 2014).Meanwhile, transmission electron micro-graph showed high electron dense materialwas observed in the central vacuole (Fig. 3A)indicating high lipid storage. According toZierdt & Williams (1974), the highly electrondense material were granules to form thegranular form and suggested that the centralbody probably acts as a form of energystorage for cell growth. Besides, cockroachisolates showed thicker cell membranemeasuring between 214.31 to 248.03 nm(Fig. 3B). It is high likely that this surfacecould be sticky and may influence in theadherence of Blastocystis. In human, thethicker surface coat shown by theultrastructural study in IBS isolates couldinfluence cytopathic effect of Blastocystistowards the intestinal lining of the gut(Ragavan et al., 2014).Yoshikawa et al. (2007) demonstratedthat SSU rRNA sequences of  four Blastocystisisolates from cockroaches  grouped togetherto record a new clade that branched earlywithin the Blastocystis lineage. Whileamphibian and reptilian isolates wereseparately located at different positions with744an amphibian/reptilian clade (clade VIII)emerging immediately after the divergenceof the cockroach clade (clade X) (Yoshikawaet al., 2007). However, using the DNAbarcoding method, two isolates wereidentified as ST3 which was never reportedprior to this study in this species. ST3 isthe most common subtype in humansexclusively in patients with IBS (Alfellani etal., 2013; Ramírez et al., 2014) and in otheranimal hosts such as non-human primates(Pertrás^ ová et al., 2011), giraffe (Alfellaniet al., 2013), goats (Tan et al., 2013). Withrepresentation among humans, non-primates,insects and artiodactyls, ST3 clearly has avery wide host range. In addition,  this studyalso records one isolate to be most likely anew subtype closely related to allele 114.Acknowledgements. The authors wouldlike to thank Ministry of Education (ER011-2012A) and University of Malaya (RG110/11SUS) for funding this study.REFERENCESAlfellani, M.A., Jacob, A.S., Perea, N.O.,Krecek, R.C., Taner-Mulla, D., Verweij,J.J., Levecke, B., Tannich, E., Clark, C.G.& Stensvold, C.R. (2013). Diversity anddistribution of Blastocystis sp. subtypesin non-human primates. Parasitology140(8): 966-971.Chandrasekaran, H., Govind, S.K., Panchad-charam, C., Bathmanaban, P., Raman,K. & Thergarajan, G. (2014). High lipidstorage in vacoular forms of subtype 6Blastocystis sp. in ostrich. Parasites andVectors 7: 469-475.Clark, C.G. (1997). Extensive geneticdiversity in Blastocystis hominis.Molecular Biochemical Parasitology87: 79-83.Petrás^   ová, J., Uzlíková, M., Kostka, M.,Petr zelková, K.J., Huffman, M.A. &Modr´ y, D. (2011). Diversity and hostspecicity of Blastocystis in syntopicprimates on Rubondo Island, Tanzania.International Journal of Parasitology41: 1113-1120.Ragavan, N.D., Suresh, K.G., Tan, T.C. &Mahadeva, S. (2014). Phenotypicvariation in Blastocystis sp. ST3.Parasites and Vectors 7: 404-413.Ramírez, J.D., Sánchez, L.V., Bautista, D.C.,Corredor, A.F., Flórez, A.C. & Stensvold,C.R. (2014). Blastocystis subtypesdetected in humans and animals fromColombia. Infection, Genetics andEvolution 22: 223-228.Richter, K. & Barwolf, D. (1994). Behavioral-changes are related to molt regulation inthe cockroach, Periplaneta americana.Physiological entomology 19(2): 133-138.Figure 3. Electron micrograph of Blastocystis from cockroach. (a) Central vacuole with high electrondense materials. (b) Measurement of the surface coat. Abbreviations: CV, central vacuole; N, Nucleus.745Roberts, T., Stark, D., Harkness, J. & Ellis,J. (2013). Subtype distribution ofBlastocystis isolates from a variety ofanimals from New South Wales,Australia. Veterinary Parasitology 196:85-89.Scicluna, S.M., Tawari, B. & Clark, G. (2006).DNA barcoding of Blastocystis. Protist157:77-85.Suresh, K., Mark, J.W., Chuong, L.S.,Ragunathan, T. & Init, I. (1997). Sac-likepouches in Blastocystis from thehouse lizards (Cosymbotus platyurus).Parasitology Research 83: 523-525.Suresh, K. & Smith, H. (2004). Comparisonof methods for detecting Blastocystishominis. European Journal of ClinicalMicrobiology and Infection Diseases 23:509-511.Tan, T.C., Tan, P.C., Sharma, R., Sugnaseelan,S. & Suresh, K.G. (2013). Genetic diversityof caprine Blastocystis from PeninsularMalaysia. Parasitology Research 112(1):85-89.Yoshikawa, H., Morimoto, K., Nagashima, M.& Miyamoto, N. (2004). A survey ofBlastocystis infection in anuran andurodele amphibians. Veterinary Para-sitology 122: 91-102.Yoshikawa, H., Wu, Z., Howe, J., Hashimoto,T., Ng, G.C. & Tan, K.S.W. (2007). Ultra-structural and phylogenetic studies onBlastocystis isolates from cockroaches.Journal of Eukaryotic Microbiology54(1): 33-37.Zaman, V., Ng, G.C., Suresh, K., Yap, E.H. &Singh, S. (1993). Isolation of Blastocystisfrom the cockroach (Dictyoptera:Blattidae). Parasitology Research 79: 73-74.Zierdt, C.H. & William, R.L. (1974).Blastocystis hominis: Axeniccultivation. Experimental Parasitology36: 233-243.

Short Communication - Current status of Blastocystis in cockroaches

http://eprints.usm.my/38093/1/Current_status_of_Blastocystis_in_cockroaches.pdf

Short Communication - Current status of Blastocystis in cockroaches

Abstract

Similar works

Full text

Available Versions

Repository@USM