Based on the most conserved region of the MADS box, a pair of degenerate primers were designed and used to amplify the genomic DNA of groundnut (cv. JL 24). The results indicate that an amplified fragment, related to flower development, showed a high homology to the MADS-box protein of Arabidopsis thaliana. This study laid the foundation for obtaining the full length of the MADS-box gene in groundnu

Anjaiah, V

Hai-teng, T A O

Mei, Y

Shan-lin, Y U

Sharma, K K

Shuangling, LI

Yan, R

ICRISAT Open Access Repository

30 IAN 25, 2005Subrahmanyam P, McDonald D, Waliyar F, Reddy LJ,Nigam SN, Gibbons RW, Ramanatha Rao V, Singh AK,Pande S, Reddy PM and Subba Rao PV. 1995. Screeningmethods and sources of resistance to rust and late leaf spot ofgroundnut. Information Bulletin no. 47. Patancheru 502 324,Andhra Pradesh, India: International Crops Research Institutefor the Semi-Arid Tropics. 24 pp.Subrahmanyam P, Mehan VK and McDonald D. 1980.Research on fungal diseases of groundnut at ICRISAT. Pages193–198 in Proceedings of the International Workshop onGroundnuts, 13–17 Oct 1980, ICRISAT Center, India.Patancheru 502 324, Andhra Pradesh, India: InternationalCrops Research Institute for the Semi-Arid Tropics.Subramanian S, Gurtu RS, Nageswara Rao RC and NigamSN. 2000. Identification of DNA polymorphism in cultivatedgroundnut using random amplified polymorphic DNA (RAPD)assay. Genome 43:656–660.Varman PV. 1999. A foliar disease resistant line developedthrough interspecific hybridization in groundnut (Arachishypogaea). Indian Journal of Agricultural Sciences 69:67–68.An Effective Method for Cloning ofPartial MADS-box Genes Related toFlower Development in GroundnutYuan Mei1, KK Sharma2,*, V Anjaiah2, LI Shuang-ling1, TAO Hai-teng1, REN Yan1 and YU Shan-lin1(1. Shandong Peanut Research Institute, Shandong, Qingdao266100, China; 2. ICRISAT, Patancheru 502 324, AndhraPradesh, India)*Corresponding author: k.sharma@cgiar.orgThe key genes in the developmental control of eukaryotesare often members of a very limited number of multigenefamilies which encode transcription factors. Such homeoboxgenes have been thought to act as homeotic selectorgenes that are involved in differentiating different bodyregions from each other, probably by activating orrepressing different sets of downstream genes in differentparts of the body (Theissen et al. 2000). Recent studieshave provided insight that inflorescence and flowerdevelopment in higher eudicotyledonous flowering plantsare determined by a network of regulatory genes whichare organized in a hierarchical fashion (Theissen andSaedler 1998). In this, the late- and early-flowering genesare triggered by environmental factors such as day length,light quality and temperature.The MADS-box is a highly conserved sequence motiffound in the family of transcription factors. The conserveddomain was recognized after the first four members of thefamily were identified as MCM1, AGAMOUS, DEFICIENSand SRF (serum response factor). The name MADS wasconstructed from the “initials” of these four “founder”proteins on which the definition of this gene family isbased (Schwarz-Sommer et al. 1990). The MADS-boxgenes of plants are scattered throughout the entire plantgenomes (Theissen et al. 2000) and by now, over ahundred MADS-box sequences have been found inspecies from all eukaryotics. MADS-domain proteins,like many other eukaryotic transcription factors, have amodular structural organization (Shore and Sharrocks1995). The family of MADS-domain proteins has beensubdivided into several distinct subfamilies. MostMADS-domain factors play important roles in plantdevelopmental processes. Prominently, the MADS-boxgenes in flowering plants are the “molecular architects”of flower morphogenesis (Coen and Meyerowitz 1991,Angenent et al. 1995).The MADS domain is by far the most highly conservedregion of proteins (Purugganan et al. 1995). Based on themost conserved sequence region of the MADS box, a pairof degenerate primers were designed and used to amplifythe genomic DNA of groundnut (Arachis hypogaea) inthis study. The results indicate that an amplified fragmentshowed a high homology to the MADS-box protein ofArabidopsis thaliana. This study laid the foundation forobtaining the full length of MADS-box gene in groundnut.Materials and methodsSeeds of groundnut cultivar JL 24 were planted in potsand maintained in the greenhouse. Genomic DNA wasisolated from the young leaves by using the methoddescribed by Porebski et al. (1997) and Puchooa (2004).Based on conserved amino acids found in the MADSdomain of plant MADS-box genes, degenerate primerswere designed to amplify the MADS-box gene homologues.The two forward primers used were MADSF1, 5’-A T G G G ( A T C G ) ( A C ) G ( A T C G ) G G ( A T C G )AA(AG)AT (ACG)GA-3’ and MADSF2, 5’-(ATCG)TG(CT)GA(CT)GC(ATCG)GA(AG)GA(AG)GT(ATCG)GC-3’ and the two reverse primers were MADSR1, 5’-GC(ATCG)AC(CT)TC(ATCG)GC(AG)TC(CT)AA-3’and MADSR2, 5’-GC(ATCG)AC(CT)TC(ATCG)GC(AG)TC(CT)CA(ATCG) AG-3’. A 50-μl PCR (polymerasechain reaction) contained 50 ng genomic DNA, 25 pmolIAN 25, 2005 31of each degenerate primer, 0.1 mM of each dNTP, and1X Reaction Buffer (including 2.0 mM MgSO4).Touchdown PCR was used to amplify the expectedfragment. The reaction was heated at 94°C for three min,then 1.5 unit of Taq DNA polymerase (New EnglandBioLabs) was added to each reaction tube. Ten cycles ofamplification were carried out, with denaturation at 94°Cfor 50 sec, annealing at 61°C to 50°C for 50 sec andextension at 72°C for 60 sec. The annealing temperatureof the reaction was decreased 2°C every second cyclefrom 61°C to a “touchdown” at 50°C. Subsequently, allthe reaction tubes underwent thirty cycles with theannealing temperature at 50°C, followed by a finalextension at 72°C for 10 min. PCR products of theexpected size were excised from agarose gels and clonedinto pGEM-T easy vector (Promega). The clones wereconfirmed by PCR and restriction enzyme digestion priorto sequencing. The sequences were aligned with nucleotidesequences in GeneBank by using MegaBlast searchprogram (http://www.ncbi.nlm.nih.gov).Results and discussionA 130 bp of the expected fragment named ApMADS1was obtained by PCR amplification by using the primersMADSF1 and MADSR2 (Fig. 1). ApMADS1 wasrecovered from agarose gel and cloned into pGEM-Teasy vector. Positive clones were confirmed by colonyPCR and EcoRI digestion (Fig. 2) and sequenced. Figure3 shows the nucleotide sequences and deduced amino-acidsequences. When alignment was carried out using theGeneBank nucleotide database and Megablast searchprogram, ApMADS1 was 79% homologous to MADS-box transcription factor HAM137 from sunflowerFigure 2. Clones confirmation by PCR amplification (A) using forward and reverse primer of M13 and EcoRI digestion (B) – Lanes 1,3, 4: Clone containing expected fragment; Lane 2: 100 bp DNA Ladder.Figure 1. PCR amplification of fragment with expected size –Lane 1: JL 24; Lane 2: 100 bp DNA Ladder; Lane 3: Control(sterile distilled water).32 IAN 25, 2005A E V  CCGAGGTGG F C K R G N G L L K K A Y E L S V L C DTTTTGCAAGCGCGGAAATGGTCTTCTCAAGAAAGCTTATGAGTTATCTGTGCTGTGTGACG M G R G K I E I K R I E N T T N R Q V TATGGGGCGTGGGAAGATAGAGATCAAGAGGATTGAGAACACTACAAATCGCCAAGTAACC (Helianthus annuus). When discontiguous MegaBlastand Refseq_RNA were chosen, ApMADS1 showedidentity ranging from 79% to 84% with 26 MADS-boxmRNA. It can be concluded that ApMADS1 is a kind ofMADS-box gene in groundnut.Homology cloning method is effective and efficient,and used widely for gene cloning as confirmed by theresult in this study. Compared with common homologycloning method, genomic DNA was used as the templatefor PCR amplification in this study. Therefore, thismethod is more simple and cheaper. Based on thesequence of ApMADS1, specific primers were designedand used for the amplification of 5’ and 3’ RACE. Someexpected fragments from 5’ and 3’ RACE were obtained.Further work on the characterization of putative genes iscurrently ongoing. Our results indicated that the homologycloning method based on genomic DNA is feasible forMADS-box gene cloning in groundnut. The availabilityof such genes can be used to study the control of floralpatterning thus providing an ideal genetic tool kit to studythe diversification of flower architecture and its possiblealteration through genetic engineering (Pavan Prakashand Kumar 2002).Acknowledgments. This work was carried out at the GeneticTransformation Laboratory of ICRISAT, Patancheru, India.We thank D Srinivas Reddy for his useful suggestionsand SN Nigam for helpful discussions. The fundingsupport in part by the Natural Science Fund of ShandongProvince and HarvestPlus Global Challenge Program onBiofortification is gratefully acknowledged.ReferencesAngenent GC, Franken J, Busscher M, van Dijken A, vanWent JL, Dons HJ and van Tunen AJ. 1995. A novel class ofMADS-box gene is involved in ovule development in petunia.Plant Cell 7:1569–1582.Figure 3. Nucleotide sequences and deduced amino acid sequences (shaded regions indicate the position of forward and reverse primers).Coen ES and Meyerowitz EM. 1991. The war of the whorls:genetic interactions controlling flower development. Nature353:31–37.Pavan Prakash A and Kumar P. 2002. PkMADS1 is a novelMADS box gene regulating adventitious shoot induction andvegetative shoot development in Paulownia kawakamii. ThePlant Journal 29:141–151.Porebski S, Bailey LG and Bernard RB. 1997. Modificationof a CTAB DNA extraction protocol for plants containing highpolysaccharide and polyphenol components. Plant MolecularBiology Reporter 15:8–15.Puchooa D. 2004. A simple, rapid and efficient method for theextraction of genomic DNA from lychee (Litchi chinensisSonn.). African Journal of Biotechnology 3:253–255.Purugganan MD, Rounsly SD, Schmidt RJ and Yanofsky M.1995. Molecular evolution of flower development: diversificationof the plant MADS-box regulatory gene family. Genetics140:345–356.Schwarz-Sommer Z, Huijser P, Nacken W, Saedler H andSommer H. 1990. Genetic control of flower development byhomeotic genes in Antirrhinum majus. Science 250:931–936.Shore P and Sharrocks AD. 1995. The MADS-box family oftranscription factors. European Journal of Biochemistry229:1–13.Theissen G, Becker A, Di Rosa A, Kanno A, Kim JT,Munster T, Winter K-U and Saedler H. 2000. A short historyof MADS-box genes in plants. Plant Molecular Biology42:115–149.Theissen G and Saedler H. 1998. Molecular architects ofplant body plans. Progress in Botany 59:227–256.

An effective method for cloning of partial MADS-box genes related to flower development in groundnut

http://oar.icrisat.org/3212/1/IAN_25_31-33_2005.pdf

An effective method for cloning of partial MADS-box genes related to flower development in groundnut

Abstract

Similar works

Full text

Available Versions

ICRISAT Open Access Repository