Background: For the first time we tested an association between the human multidrug resistance gene 1 (MDR1) polymorphisms (SNPs) and idiopathic pulmonary fibrosis (IPF). Several MDR1 polymorphisms are associated with pathologies in which they modify the drug susceptibility and pharmacokinetics. Materials and Methods: We genotyped three MDR1 polymorphisms of 48 IPF patients and 100 control subjects with Italian origins. Results: No evidence of association was detected. Conclusion: There are 50 known MDR1 SNPs, and their role is explored in terms of the effectiveness of drug therapy. We consider our small-scale preliminary study as a starting point for further research

Ambra Girardi

Angela Maria Grazia Pacilli

Gabriella Mattei

Luca Scapoli

Marcella Martinelli

Maria Teresa Rodia

Paolo Carbonara

Rossella Solmi

Journal of Research in Medical Sciences

PubMed

MARTINELLI, MARCELLA

SCAPOLI, LUCA

PACILLI, ANGELA MARIA GRAZIA

CARBONARA, PAOLO

GIRARDI, AMBRA

MATTEI, GABRIELLA

RODIA, MARIA TERESA

SOLMI, ROSSELLA

Archivio istituzionale della ricerca - Alma Mater Studiorum Università di Bologna

Journal of Research in Medical Sciences| January 2015 | 941234567891011121314151617181920212223242526272829303132333435363738394041424344454647484950515253545512345678910111213141516171819202122232425262728293031323334353637383940414243444546474849505152535455Human Multidrug Resistance 1 gene polymorphisms and Idiopathic Pulmonary FibrosisMarcella Martinelli1,2, Luca Scapoli1,2, Angela Maria Grazia Pacilli1, Paolo Carbonara1, Ambra Girardi1,2, Gabriella Mattei1,2, Maria Teresa Rodia1,2, Rossella Solmi1,21Department of Experimental, Diagnostic and Specialty Medicine (DIMES), Unit of Histology, Embryology and Applied Biology and 2Centre of Molecular Genetics, CARISBO Foundation, University of Bologna, ItalyBackground: For the fi rst time we tested an association between the human multidrug resistance gene 1 (MDR1) polymorphisms (SNPs) and idiopathic pulmonary fi brosis (IPF). Several MDR1 polymorphisms are associated with pathologies in which they modify the drug susceptibility and pharmacokinetics.  Materials and Methods: We genotyped three MDR1 polymorphisms of 48 IPF patients and 100 control subjects with Italian origins. Results: No evidence of association was detected.  Conclusion: Th ere are 50 known MDR1 SNPs, and their role is explored in terms of the eff ectiveness of drug therapy. We consider our small-scale preliminary study as a starting point for further research. Key words: Idiopathic pulmonary fi brosis, multidrug resistance 1 gene, polymorphismAddress for correspondence: Dr. Rossella Solmi, Dipartimento di Medicina Specialistica, Diagnostica e Sperimentale, Via Belmeloro, 8, 40126 Bologna, Italy. E-mail: rossella.solmi@unibo.itReceived: 29-10-2013; Revised: 04-10-2014; Accepted: 12-12-2014Several drugs have not been evaluated as P-gp substrates, so additional unidentifi ed substances could be transported by the P-gp across cell membrane.Furthermore, variations in P-gp expression and function are associated with the pathology susceptibility[5] and have important consequences in therapeutic outcome and disease progression.[6] By now, 50 single nucleotide and 3 insertion/deletion polymorphisms have been mapped in the MDRl gene.[7] To evaluate MDR1 as possible risk factor for IPF, we analyzed the three most commonly studied MDR1 polymorphisms in our case record.MATERIALS AND METHODSBetween 2008 and 2013, 48 consecutive Italian patients with IPF (31 males and 17 females) were enrolled for this study at the Respiratory Division, Sant’Orsola Hospital, University of Bologna. Diagnosis of IPF was made according to ATS/ERS guidelines of 2011.A total of 100 healthy volunteers (50 males and 50 females), were enrolled as controls. The study was approved by the Ethical Committee of Sant’Orsola-Malpighi General Hospital and complied with the ethical principles for medical research involving human subjects of the Helsinki declaration. WriĴ en informed consent was obtained from all patients and healthy controls INTRODUCTIONAnti-infl ammatory, anti-fi brosis, immunosuppressive t r e a t m e n t s  ( a z a t h i o p r i n e ,  c o r t i c o s t e r o i d s , cyclophosphamide) or antioxidant strategies and other therapeutic agents targeting fibrogenesis (interferons, antagonists of cytokines, growth factors or their receptors and angiogenic agents) are useless for idiopathic pulmonary fi brosis (IPF).[1] No studies have considered a possible relationship between the human multidrug resistance 1 gene (MDR1) polymorphisms and the therapy outcome in IPF.Multidrug resistance 1 gene is expressed in epithelial cells of a certain number of organs, including the lung.[2] The MDR1 phenotype is acquired after administration of drugs[3] and when expressed, it extrudes chemotherapeutic substances from cells causing the ineff ectiveness of the treatment.[2]The MDR1 encodes for a plasma membrane MDR protein, the P-glycoprotein (P-gp)[2] that functions as an energy-dependent membrane effl  ux pump to maintain cytoplasmic concentrations steady.[3] P-gp drags out of the cell a number of substances with diverse chemical structures. It is not clear how P-gp recognizes and transports and hence various range of compounds, but it is not based on simply chemical structure.[4]JRMS_1081_13R2  AP done on 20150121SHORT COMMUNICATIONHow to cite this article: Martinelli M, Scapoli L, Pacilli A.M.G, Carbonara P, Girardi A, Mattei G, Rodia M.T, Solmi R. Human Multidrug Resistance 1 gene polymorphisms and Idiopathic Pulmonary Fibrosis. J Res Med Sci 2015;20:???-??.1234567891011121314151617181920212223242526272829303132333435363738394041424344454647484950515253545512345678910111213141516171819202122232425262728293031323334353637383940414243444546474849505152535455Martinelli et al.: MDR1 polymorphisms and IPFJournal of Research in Medical Sciences | January 2015 |95beforehand. Peripheral blood samples were drawn from each individual and DNA extraction was performed using the GenElute Blood Genomic DNA kit (Sigma, Milan, Italy).Three single-nucleotide polymorphisms (SNPs) mapping respectively on exon 12 (1236C>T; rs1128503), 21 (2677G>T/A; rs2032582), and 26 (3435C>T; rs1045642) of MDR1 gene were selected. Polymorphism selection was based on data available from published investigations. Among all known gene variation, we selected three SNPs that were previously found associated with other pathologies, thus having higher chances to directly alter gene function or to be linked with susceptibility variation.Each polymorphism was amplified by polymerase chain reaction using flanking primers (supplementary data: additional fi le 1) and products incubated with a restriction endonuclease, BsuRI, GsaI and DpnII (CABRU, Milan, Italy), respectively. Fragments were separated by 10% polyacrylamide gel electrophoresis, subsequently stained with ethidium bromide (supplementary data: additional fi le 2). To assess the accuracy of the genotyping outputs, one-third of randomly selected samples were blindly tested by a second operator.The distribution of genotypes in both probands and control groups was tested for deviations from the Hardy-Weinberg equilibrium using Pearson’s Chi-square test. Association analyses were performed with the Unphased software v3.1.5 in a Windows Vista operative system.[8] This included a tests for both allele and genotype association, as well as odds ratio calculation, which was shown in relation to a single reference allele or genotype.Two and three SNPs combinations were considered for haplotype analysis. Since the likelihood ratio statistics may be sensitive to rare haplotypes, a frequency threshold of 0.02 was adopted. An overall association analysis, that tested whether any haplotypes are associated (global P value), as well as a specifi c test for each haplotype,  was carried out.RESULTSGenotype frequency in cases and controls were distributed accordingly with the Hardy-Weinberg equilibrium law.Allele frequency was similar in case and control groups at all the tested loci. No evidence of the association between IPF and MDR1 genotypes was detected [Table 1].Multilocus approach could be more sensitive than single locus analysis. For this reason, two and three locus haplotypes were tested for association with IPF. Both the global and the single haplotype tests for association rejected the hypothesis of the association between MDR1 polymorphisms and IPF (data not shown).DISCUSSIONC1236T, G2677T/A and C3435T are the most commonly studied among the 50 known MDR1 gene SNPs in disease conditions and diff erent populations. We did not fi nd any differences about the frequencies of these three MDR1 polymorphisms between IPF patients and control subjects in our Italian case study. The relatively low number of patients examined could be the cause of false negative results, especially if MDR1 had minor eff ects on risk to develop IPF. Moreover, additional untyped polymorphisms could have an eff ect on IPF risk. This is only the start point to evaluate the role of the MDR1 SNPs in IPF considering the large amount of SNPs to analyze and the diff erences determined by the  Table 1: Case-control association analysis between MDR1 SNPs and IPFSNP ID Allele/genotypeIPF caseControl IPF-frequencyCo-frequencyChi-squareP OR (CI)rs1128503 C 58 111 0.60 0.56 0.64 0.42 ReferenceT 38 89 0.40 0.44 0.82 (0.50-1.34)CC 18 33 0.38 0.33 0.67 0.72 ReferenceCT 22 45 0.46 0.45 0.90 (0.42-1.93)TT 8 22 0.17 0.22 0.67 (0.25-1.80)rs2032582 T 57 108 0.59 0.54 0.76 0.38 ReferenceA 39 92 0.41 0.46 0.80 (0.49-1.32)TT 17 32 0.35 0.32 1.07 0.59 ReferenceTA 23 44 0.48 0.44 0.98 (0.45-2.1)AA 8 24 0.17 0.24 0.63 (0.23-1.69)rs1045642 C 52 100 0.54 0.50 0.45 0.50 ReferenceT 44 100 0.46 0.50 0.85 (0.52-1.38)CC 14 29 0.29 0.29 1.31 0.52 ReferenceCT 24 42 0.50 0.42 1.18 (0.53-2.67)TT 10 29 0.21 0.29 0.71 (0.27-1.87)IPF = Idiopathic pulmonary fi brosis; OR = Odds ratio; CI = Confi dence interval; MDR1 = Multidrug resistance 1 gene; SNPs  = Single-nucleotide polymorphisms1234567891011121314151617181920212223242526272829303132333435363738394041424344454647484950515253545512345678910111213141516171819202122232425262728293031323334353637383940414243444546474849505152535455Martinelli et al.: MDR1 polymorphisms and IPFJournal of Research in Medical Sciences| January 2015 | 9612345678910111213141516171819202122232425262728293031323334353637383940414243444546474849505152535455variety of ethnic populations.[9] In fact, signifi cant diff erences in the frequencies of MDR1 haplotypes have been found among Caucasian, African-American, and Asian-American population.[6] We believe that further understanding of the correlation between the MDR1 genetic variations and the physiology and biochemistry of P-gp may be critically important for the development of new treatment modalities and personalized pharmacotherapy for patients with IPF.AUTHOR’S CONTRIBUTIONThe authors’ contributions were as follows: M. M. and S. R. conceived and designed the study; P. A.M.G., C. P. and R. S. were responsible for the sample collection; M. M., G. A., M. G., R. M.T., and S. R. conducted the research; S. L. was responsible for the data analysis and interpretation; S. R. wrote the manuscript; M. M. and S. L. were responsible for the critical revision of the manuscript.ACKNOWLEDGMENTSThis work is funded by University of Bologna (M. M. and S. R. R.F.O. 2012).REFERENCES1.  Farkas L, Gauldie J, Voelkel NF, Kolb M. Pulmonary hypertension and idiopathic pulmonary fi brosis: A tale of angiogenesis, apoptosis, and growth factors. Am J Respir Cell Mol Biol 2011;45:1-15.2. Cao L, Owsianik G, Jaspers M, Janssens A, Cuppens H, Cassiman JJ, et al. Functional analysis of CFTR chloride channel activity in cells with elevated MDR1 expression. Biochem Biophys Res Commun 2003;304:248-52.3. Comerford KM, Wallace TJ, Karhausen J, Louis NA, Montalto MC, Colgan SP. Hypoxia-inducible factor-1-dependent regulation of the multidrug resistance (MDR1) gene. Cancer Res 2002;62:3387-94.4. Seelig A. How does P-glycoprotein recognize its substrates? Int J Clin Pharmacol Ther 1998;36:50-4.5. Mealey KL. Therapeutic implications of the MDR-1 gene. J Vet Pharmacol Ther 2004;27:257-64.6. Woodahl EL, Ho RJ. The role of MDR1 genetic polymorphisms in interindividual variability in P-glycoprotein expression and function. Curr Drug Metab 2004;5:11-9.7. Li YH, Wang YH, Li Y, Yang L. MDR1 gene polymorphisms and clinical relevance. Yi Chuan Xue Bao 2006;33:93-104.8. Dudbridge F. Likelihood-based association analysis for nuclear families and unrelated subjects with missing genotype data. Hum Hered 2008;66:87-98.9. Al-Mohizea AM, Alkharfy KM, Bagulb KM, Alghamdi AM, Al-Jenoobi FI, Al-Muhsen S, et al. Genetic variability and haplotype profi le of MDR1 in Saudi Arabian males. Mol Biol Rep 2012;39:10293-301.Additional fi le 1: Characteristics of polymorphismsSNP ID Primer sequences 5’-3’ Nucleotide changeaLocation Tab Restriction enzymers1128503 For TTGAATGAAGAGTTTCTGATGTTTT 1236C>T Exon 12 45°C BsuRIRev CTCTGCATCAGCTGGACTGTrs2032582 For TGTTGTCTGGACAAGCACTGA 2677G>T Exon 21 55°C GsaIRev TGTGAAGACAATGGCCTGAArs1045642 For GGCTCCGAGCACACCTGGGCA 3435C>T Exon 26 59°C DpnIIRev GGCCAGAGAGGCTGCCACATGCTaMajor allele/minor; bAnnealing temperature; Conditions of amplifi cation for 35 cycles were 30 s at 94°C, 30 s at specifi c Tab, 30 s at 72°C and fi nal extension for 8 min at 72°C; SNP: Single-nucleotide polymorphismaMajor allAdditional fi le 2: Electrophoretic pattern on 10% acrylamide gel of multidrug resistance 1 gene polymerase chain reaction-restriction fragment length polymorphism genotyping assays: a) 1236C>T rs1128503 (exon 12), the PCR product of 237 bp has two restriction sites, b) 2677 G>T/A rs2032582 (exon 21), c) 3435C>T rs1045642 (exon 26). Numbers on the side represent fragments’ length expressed in base pairs.Source of Support: Nil, Confl ict of Interest: No confl ict of interests.

English

Human Multidrug Resistance 1 gene polymorphisms and Idiopathic Pulmonary Fibrosis

Directory of Open Access Journals

http://creativecommons.org/licenses/by-nc-sa/3.0

Human Multidrug Resistance 1 gene polymorphisms and Idiopathic Pulmonary Fibrosis

Abstract

Similar works

Full text

Available Versions

Archivio istituzionale della ricerca - Alma Mater Studiorum Università di Bologna

Directory of Open Access Journals