Infectious Bovine Rhinotracheitis, caused by Bovine Herpesvirus-1 (BoHV-1) maintains

latency in trigeminal nerve ganglia of bovine. The sero-positive bull infected with BoHV-1 secretes

the virus through semen intermittently, when the immune system is compromised. Sera from bulls

housed at different bull stations were analyzed using gE protein specific IDEXX Kit, which showed

78.69% positivity. Each batch of semen from sero-positive bull was investigated further for presence

of virus in semen by Real Time-PCR technique for validation of presence of virus in the frozen semen

doses using gB specific primers and probe, which showed 0.968 % semen batches positive. This study

showed that despite high sero prevalence in bull, the semen excretes very negligible amount of the

virus indicating the subtypes circulating in farms of West Bengal, India is assumed to be respiratory

type

Joyjit Mitra

Rudradev Mukherjee

Santanu Panda

Shamindra Nath Sarkar

Sumit Chowdhury

Swarup Bakshi

Directory of Open Access Journals

113ISSN  2277- 470X (Print), ISSN 2319-247X (Online)Website: www.animalmedicalresearch.orgExplor Anim Med Res,Vol.6, Issue - 1, 2016, p. 113-118Research  ArticlePREVALENCE  OF  BOVINE  HERPES  VIRUS - 1  INORGANIZED  FARMS  OF  WEST  BENGAL,  INDIASumit Chowdhury*, Joyjit Mitra, Shamindra Nath Sarkar, Santanu Panda,Swarup Bakshi1,  Rudradev Mukherjea2Received 11 January 2016, revised 18 May 2016Assistant Directors, 1 Deputy Director and   2Joint Director, ARD,   Institute of Animal Health &Veterinary Biologicals (R&T), 37 Belgachia Road, Kolkata -700037, West Bengal, India.*Corresponding author. e– mail: drsumit07@rediffmail.com.ABSTRACT: Infectious Bovine Rhinotracheitis, caused by Bovine Herpesvirus-1 (BoHV-1) maintainslatency in trigeminal nerve ganglia of bovine. The sero-positive bull infected with BoHV-1 secretesthe virus through semen intermittently, when the immune system is compromised. Sera from bullshoused at different bull stations were analyzed using gE protein specific IDEXX Kit, which showed78.69% positivity.  Each batch of semen from sero-positive bull  was investigated further for presenceof virus in semen by Real Time-PCR technique for validation of presence of virus in the frozen semendoses using gB specific primers and probe, which showed 0.968 % semen batches positive. This studyshowed that despite high sero prevalence in bull, the semen excretes very negligible amount of thevirus indicating the subtypes circulating in farms of West Bengal, India is assumed to be respiratorytype.Key words: IBR, BoHV-1, gB, Prevalence, West Bengal, India.INTRODUCTIONBovine Herpes Virus-1(BoHV-1) is asignificant pathogen in cattle, which causesrespiratory disease, abortion, and infrequently,encephalitis in calf (Wyler et al., 1989). Likeother members of herpesviridae, it maintainslatency in the trigeminal ganglion of infectedanimals. Cattle of all ages and breeds aresusceptible to infection from introduction ofinfected animals in herd (Rock 1993 and 1994).The virus is transmitted through nasal, ocularand semen to healthy animals in farm (Kendrickand McEntree 1987). The virus is also spreadedthrough semen of infected bulls either throughnatural insemination, as well as, throughartificial insemination (Masri et al., 1996).In West Bengal, BoHV-1 is a major problemof cattle and buffalo as reported to beserologically positive. Therefore it is aprerequisite to validate a suitable laboratory testprotocol to screen frozen semen straw so thatvirus excreted through semen can be stopped.In accordance with the World Organisation ofAnimal Health (Office International desÉpizooties: OIE) Manual (2010), there is norestriction regarding the maintenance of114Exploratory Animal and Medical Research, Vol.6, Issue 1, June, 2016BoHV-1 sero-positive bulls in semen stationsbut it is mandatory for screening of BoHV-1 ineach batch of semen from these bulls fordistribution of frozen semen  in field . Theroutine method for detection of BoHV-1 inbovine semen is virus isolation in cell cultureis one of the prescribed tests of the OIE forinternational trade. However, this method haslimitations, such as sensitivity, time and cost.Hence, in the present study, we performed realtime PCR by amplifying gB gene of BoHV-1to estimate prevalence of BoHV-1 in the semenof IBR-sero positive bulls as per OIE guideline.METERIALS  AND  METHODSCollection and processing of serum Blood samples were collected aseptically inevacuated collection tubes (VAKU-8) fromdifferent age group of breeding bulls fromdifferent frozen semen bull station farms ofWest Bengal, India during 2015-2016. We usedsingle container for single animal to preventcross contamination. After collection bloodsamples were kept for 3 hours in room tempfor clotting and getting maximum volume ofserum. After that the blood samples were keptat 4°C over-night for serum separation. Finallysera were separated and poured in serum vialsunder the laminar hood and were kept at -24°Cfor further study.Competitive ELISA against gEglycoproteinCompetitive ELISA was performed fordetection of antibody against gE glycoproteinof BoHV-1, as per manufactures’ protocol(IDEEX KIT, Switzerland). First, the antigencoated plate was removed from the pouch andall the reagents and plate are brought to roomtemperature (18°-25°C). Then sample positionwere recorded in the X check software usingrelevant template. Thereafter 50 µl of thesample diluent was added to each well bypipette along with 50 µl negative control and50 µl positive controls in duplicate inappropriate wells.  Fifty micro litre samples induplicate were added in rest of the wells. Thenthe plate was incubated for 12-18 hours at 18°C-26°C under tightly sealed condition in a shakingincubator to avoid any evaporation. After thateach well was washed with 300 µl of washsolution for five times and the plate is firmlytapped onto absorbent material to removeresidual wash fluid from each well. Thereafter100 µl of conjugate was dispensed into eachwell. After that the plate was incubated for 30minutes at room temperature (18-25 °C). Thenwells were washed with 300 µl of wash solutionfive times as mentioned above. Then 100 µl ofTMB substrate solution was dispensed into eachwell. After that the plate was incubated for 10minutes at room temperature (18-25 °C) in dark.Then 100 µl of stop solution was dispensed intoeach well to stop the reaction. Finally, theabsorbance is measured at 650 nm and the resultwas analysed using X Check software.Real Time PCR for detection of BoHV-1 Extraction of DNA from semen samples:Two frozen semen straws from each batch ofsero-positive bulls were processed. DuplicatePCR amplifications were carried out induplicate for each DNA preparation to ensuredetection of DNA in samples containing lowlevels of virus. The reaction was performed ina single tube by adding the followingcomponents in a screw top 1.5 ml tubes: Chelex100 sodium (Sigma) (10% w/v in distilleddeionised water) 100 µl, Proteinase K (10 mg/ml, Sigma) - 11.5 µl, DL-Dithiothreitol (1 M,115Sigma) - 7.5 µl, Nuclease-free water - 90 µl,Semen sample - 10 µl. Then the componentswere mixed by pipetting and kept for incubationat 56°C for 30 minutes and then vortexed athigh speed for 10 seconds. Subsequently, thetubes are incubated in a boiling water bath for8 minutes and then vortexed at high speed for10 seconds.  The tubes are centrifuged at 10,000g for 3 minutes.  The supernatant is transferredinto a new micro-tube and can be used directlyfor PCR, or stored at –20°C.Real-time PCR of gB gene of BoHV-1The PCR reaction mixtures were preparedin duplicates in 25 µl volume using with thefollowing components: 2X PlatinumQuantitative PCR Super Mix-UDG - 12.5 µl,gB specific forward & reverse primer (4.5 µM)- 1 µl each, Probe (3 µM) - 1 µl, nuclease freewater - 5.5 µl and 5 µl of the DNA extracted ast mplate as per the OIE guideline (Table 2).  Thecycle was set as one cycle each at 50°C for 2minutes and at   95°C for 2 minutes followedby two steps 45 cycles at 95°C for 15 secondsand at 60°C for 45 seconds respectively.The threshold level is usually set accordingto the manufacturers’ instructions for theselected analysis software used. Alternatively,virus isolation of negative semen samples fromsero-negative animals was run exhaustively(e.g. up to 55 amplification cycles) to determinethe background reaction associated with theTotal no. Total no. of (%) Total no. of Total no. of (%)of animals positive animals batches positive batches27 24 88.89 1706 14 0.82118 88 74.57 673 09 1.36113 91 80.53 409 05 1.22258 203 78.69 2788 27 0.968ParametersOrganized Farm-1Organized Farm-2Organized Farm-3Competitive ELISA (gE) Real Time PCRTable 1. Prevalence of BoHV-1 virus, as detected by serology and Real Time PCR inWest Bengal.Sl. No Name of the Sequence(5’-3’) Binding position Productprimer/probe on BoHV-1 Size (bp)for  gB gene genome1. Forward Primer TGTGGACCTAAACCTCACGGT 57499-575192. Reverse Primer GTAGTGTCGTCGAGCAGACCC 57595-57575 973. Taq Man Probe5’FAM & AGGACCGCGAGTTCTTGCCGC 57525-575453’TAMRATable 2. Primers and Probe used for detection of BoHV-1 by Real Time PCR.Prevalence of Bovine Herpes Virus - 1 inn  organized  Farms of  West Bengal, India116Exploratory Animal and Medical Research, Vol.6, Issue 1, June, 2016detection system used. Any sample that has acycle threshold (Ct) value equal or less than 40is regarded as positive. Any sample that showsno Ct value is regarded as negative. Negativecontrol and no template control should have noCt values.RESULTS  AND  DISCUSSIONA total of 258 number sera samples werecollected from three semen stations of WestBengal which showed 203 positive animals(78.69%). Each and every batch of frozen semenfrom all the bulls positive by ELISA was testedby real time PCR. Total 2788 frozen semenstraws were tested by gB gene specific primersand probes which showed 27 batches positive(0.968%) (Fig. 1, Table 1). Peculiarities of BoHV-1 is that it maintainsl tency in trigeminal nerve ganglia (Pastorelet al., 1984). The virus breaks the latency afterexposure to the corticosteroid treatment orhostile environment when the immunity falls.It has been also found that BoHV-1 excreteshigher titre of virus during the primary phaseof infection than later phase infection when theshedding is intermittent (Bitsch 1973). Severaltechniques such as virus isolation in MDBK celllines, immune electron microscopy and PCRtargeting various genes of the virus have beentried for the detection of BoHV-1 in bovinesemen. Although virus isolation in MDBK celllines remains the gold standard for detection ofthe virus, this method has limitations withregard to sensitivity, cytotoxicity of semen.Various PCR methods have been reported to beuseful for detection of the virus. However, PCRFig. 1. Real Time PCR for BoHV-1 detection using gB specific primer probes.117inhibitory substances in bovine semen interferewith the amplification of the target DNA.Therefore, attempts have been made tostandardise and validate a real-time PCR todetect BoHV-1 in bovine frozen semen fromnaturally infected cattle and buffalo (Wanget al., 2007).  As per Rana et al., (2011) forproduction of bovine frozen semen, all thebatches from semen donating bulls positive inELISA must be screened through real-time PCRfor distribution of IBR virus free semen forArtificial Insemination purpose in field.In the present study, a pair of gB gene-specific published primers designed to detectviral DNA of all BoHV-1 strains, includingsubtypes 1.1 and 1.2, were used foramplification of the highly conserved 97 bpfragment of gB gene augmented with the useof a 5´nuclease oligo-probe (TaqMan) for thedetection of amplified products.  PCRamplification of tenfold serial dilutions of thepositive BHV-1 virus spiked with semennegative in BoHV-1 produced mean Ct valueof  27.02, 30. 27 and 32.45 up to 1: 1000dilutions which supports the OIE guideline.  Thepositive samples showed the Ct value with inthe mean 38.42. The   semen samples showingCt value up to 40 was included as positivesamples and above that it was regarded asnegative sample. The results from this studyindicate that the real-time PCR assay offersgreater sensitivity and will be valuable indetecting low titre of virus in extended semensamples.CONCLUSIONThe present study clearly indicated thatthough high sero prevalence of BoHV-1 semendonating bulls, the virus is excreted in very lowfrequency through semen. Further investigationrequires establishing the subtypes of the virusexcreted through semen by cloning andsequencing of gC gene of the virus.ACKNOWLEDGEMENTThe authors are thankful to the Director,Animal Husbandry and Veterinary Services,Govt. of West Bengal and Additional Director,ARD, Institute of Animal Health and VeterinaryBiologicals (R&T), Belgachia, Kolkata forproviding all the facilities to carry out this work.REFERENCESBitsch V (1973)   Infectious BovineRhinotracheitis Virus infection in bulls, with specialreference to preputial infection. Appl Microbiol 26:337-343.Kendrick JW, McEntree K (1987) The effect ofartificial insemination with semen contaminatedwith IBR–IPV virus. Cornell Vet  57: 3-11.Masri SA, Olson W, Nguyen PT, Prins S, DeregtD (1996) Rapid detection of bovine herpesvirus 1 inthe semen of infected bulls by a nested polymerasechain reaction assay. Can J Vet Res  60: 100-107.Pastoret PP, Thiry E, Brochier B, Derboven G,Vandevogle H (1984) The role of latency in theepizootiology of infectious bovine rhinotracheitis.In  Latent   herpesvirus  infection  in  veterinarymedicine (G. Wittmann, R. Gaskell & H.J. Rzhia,eds.). Martinus Nijhoff, The Hague. 191-209.Rana SK, Kota SNLS, Samayam PNR, Rajan S,Srinivasan VA (2011) Use of real-time polymerasechain reaction to detect Bovine Herpes Virus-1 infrozen cattle and buffalo semen in India. VeterinariaItaliana 43(3): 313-322.Prevalence of Bovine Herpes Virus - 1 inn  organized  Farms of  West Bengal, India118Exploratory Animal and Medical Research, Vol.6, Issue 1, June, 2016Rock DL (1993) The molecular basis of latentinfections by alpha herpesviruses. Sem Virol4: 157–165.Rock DL (1994) Latent infection with bovineherpesvirus type 1. Sem Virol  5: 233–240.Wang J, O’Keefe J, Orr D, Loth L, Banks M,Wakeley P, West D, Card R, Ibata G, Van MaanenK, Thoren P, Isaksson M, Kerkhofs P  (2007)Validation of a real-time PCR assay for thedetection of bovine herpes virus 1 in bovine semen.J Virol Methods 144: 103-108.World Organization for Animal Health (OfficeInternational des Épizooties: OIE) (2010). Manualof diagnostic tests and vaccines for terrestrial animals6th Ed. OIE Paris. 752-767.Wyler R, M Engels M Schwyzer (1989) Infectiousbovine rhinotracheitis/ vulvovaginitis (BHV-1). 1–72. Cited in  Wittman G (ed.), Herpesvirus diseasesof cattle, horses, and pigs. Developments inVeterinary medicine. Kluwer Academic Publishers,Boston.*Cite this article as:  Chowdhury S, Mitra J, Sarkar SN, Panda S, Bakshi S, Mukherjea  R(2016)  Prevalence of Bovine Herpes Virus - 1 in organized farms of West Bengal, India.Explor Anim Med Res  6(1): 113-118.

PREVALENCE OF BOVINE HERPES VIRUS - 1 IN ORGANIZED FARMS OF WEST BENGAL, INDIA

http://www.animalmedicalresearch.org/Vol.6_Issue-1_June_2016/Sumit%20Choudhury.pdf

PREVALENCE OF BOVINE HERPES VIRUS - 1 IN ORGANIZED FARMS OF WEST BENGAL, INDIA

Abstract

Similar works

Full text

Available Versions

Directory of Open Access Journals