Beals, T.

Broude, N.

Cherny, D.

Demidov, V.

Lane, D.

Nietupski, R.

Smith, J.

Smolina, I.

English

MPG.PuRe

ANALYTICALBIOCHEMISTRYAnalytical Biochemistry 347 (2005) 152–155www.elsevier.com/locate/yabioNotes & TipsHigh-density Xuorescently labeled rolling-circle amplicons for DNA diagnosticsIrina V. Smolina a, Dmitry I. Cherny b,1, Raymond M. Nietupski c, Thomas Beals c, James H. Smith c, David J. Lane c, Natalia E. Broude a,¤, Vadim V. Demidov a,¤a Center for Advanced Biotechnology, Boston University, Boston, MA 02215, USAb Max Planck Institute for Biophysical Chemistry, D-37077 Gottingen, Germanyc Hamilton Thorne Biosciences Inc., Beverly, MA 01915, USAReceived 15 March 2005Available online 21 June 2005Fluorescent labeling of nucleic acids with high densityis very important for a wide area of DNA- and RNA-based diagnostics [1–5], but it still remains a challenge.Indeed, chemical synthesis of oligonucleotides with mul-tiple Xuorophores is an elaborate and expensive proce-dure [6–8]. Branched probes tagged with numerousXuorophores can alleviate this problem [2,9], but specialcomplex assemblies are required in that case. Enzymaticsynthesis of high-density labeled polynucleotides fromXuorescently modiWed monomers by DNA polymerasesis another alternative. However, despite some progress inthis area, there are certain diYculties in enzymaticallygenerating long Xuorescent products using proceduresbased on primer extension [3,4,10–13].Rolling-circle ampliWcation (RCA),2 which is isother-mal DNA polymerase-driven cyclic replication of smallcircular DNA probes, is often used as an eYcientmethod to detect various analytes [14–16]. It wasassumed that the RCA mechanism is diVerent from that0003-2697/$ - see front matter   2005 Elsevier Inc. All rights reserved.doi:10.1016/j.ab.2005.06.002* Corresponding authors. Fax: +617 353 8501.E-mail addresses: nebroude@bu.edu (N.E. Broude), vvd@bu.edu (V.V. D1 On leave from the Institute of Molecular Genetics, Moscow, Russia. Present add2 Abbreviations used: RCA, rolling-circle ampliWcation; dNTP, deoxynucpair; kb, kilo base (thousand base pairs).3 The shape of an RCA-active circular DNA probe is quite distinct from theabrupt tense boundaries [14,17]. This constrained conWguration of replicating Dthe stiVness of DNA duplexes formed as a result of primer annealing and extetially straight up to 150 to 200 bp [18–21]. Therefore, we hypothesized that thconformation at the site of DNA replication (see Fig.2A), might facilitate inc4 We are aware that a number of research groups have tried to use Xuorestheir attempts. Yet, the lack of any published data on this topic prompted usforward and potentially useful diagnostic approach.5 In some cases, high-density labeling results in long but nonXuorescent reacof primer-extension reactions using linear DNA tem-plates.3 Based on that, we suggested that DNA polymer-ase during RCA might better tolerate Xuorescentlylabeled deoxynucleotide triphosphates (dNTPs) anddecided to investigate whether RCA can be employedfor direct generation of densely labeled ampliWcationproducts capable of intense Xuorescence.4We chose 29 DNA polymerase considering its well-known robust RCA activity [23–25] and the hydrophilic dyeCy3 with which high-density labeling could be achieved with-out serious Xuorescence quenching [8,26].5 All experimentswere performed with Cy3-dCTP and Cy3-dUTP, whichsubstituted dCTP and dTTP, respectively, and with 88-ntDNA minicircle carrying Salmonella sequence marker [27].Gel-electrophoretic analysis of RCA productsobtained in solution with complete substitution of twopyrimidine dNTPs with Cy3-tagged Xuorescent analogsshowed that the eYciency of synthesis was reduced ascompared to that with non-modiWed dNTPs Nevertheless,emidov).ress: Department of Biochemistry, Leicester University, Leicester LE1 7RH, UK.leotide triphosphate; EM, electron microscopy; nt, nucleotide; bp, base normal DNA replicative form in that it is overall very strained and featuresNA minicircles is caused by their small size (typically 6100 nt [15]) and bynsion along circular probes. The DNA duplexes are known to remain essen-is exceptional DNA structure, namely the “fold-back,” sharp-edged DNAorporation of Xuorescently modiWed nucleotides by DNA polymerase.cently modiWed dNTPs for direct labeling of RCA amplicons but gave up to perform our study to overcome disappointment in this rather straight-tion products due to self-quenching of closely located Xuorophores [22].Notes & Tips / Anal. Biochem. 347 (2005) 152–155 153the length of RCA amplicons reached 1 to 2 kb (10–20repeats) as compared with size standards (data notshown). Keeping in mind that multiply labeled DNAexhibits altered physicochemical properties, includinganomalous gel-electrophoretic mobility [10,12], wedecided to directly measure the length of RCA productsusing electron microscopy (EM). EM visualization ofCy3-labeled RCA products (Fig. 1A) showed that thelength of randomly chosen amplicons ranged from 400 bpto 3 kb (Fig. 1B), with the average size of 1.2 kb being inagreement with initial gel-electrophoretic estimations.Thus, these results mean that every RCA ampliconcarries several hundred Xuorophores, and the question iswhether Xuorescent signal is strong enough to bedetected using Xuorescence imaging instruments. Toanswer this question, we chose the surface-immobilizedRCA format, shown schematically in Fig. 2A, that usesbiotin–streptavidin interactions for primer immobiliza-tion. Based on the published data [23,29,30], we expectedthat RCA eYciency in heterogeneous systems would beclose to that in a homogeneous solution.Using conventional Xuorescent microscopy, wedetected RCA amplicons as the luminous dot-like objects,the number of which correlated with the amount of prim-ers immobilized onto a surface but was substantially lessthan expected (Fig. 2B). We reasoned that when usingXuorescent microscopy, we probably see only the brightestamplicons while the less intense and blurred signals arelost for analysis. To improve sensitivity and make assayapplicable for automation, we employed the Xuorescenceimaging scanner, allowing the measurement of total Xuo-rescence of RCA amplicons per speciWed area (Fig. 2C).Using this approach, we detected as few as 102 amplicons/mm2 (Fig. 2D), corresponding to the detection limit ofapproximately thousand analyte molecules.Thus, our study shows that direct incorporation of Xuo-rescently labeled dNTPs during RCA allows synthesis ofdensely labeled RCA amplicons, which can be detected withhigh sensitivity using Xuorescent scanning instruments.Although Xuorescently modiWed dNTPs decrease consider-ably the degree of RCA ampliWcation, high-density labelingcompensates for that and the assay still allows detectingdown to 103 molecules of the analyte. With normal dNTPs,a much higher, usually more than 103-fold, ampliWcationcan be achieved [24]. However, with postreplicative proce-dures it is diYcult to reach high-density labeling. Indeed,our studies of RCA reactions with normal dNTPs and pos-treplicative labeling of amplicons using dual-labeled hybrid-ization probes demonstrated somewhat better, butcomparable, sensitivity (Fig. 2D). When considering advan-tages of the proposed approach, we should note that thesurface-immobilized format with direct high-density Xuo-rescent labeling is well suited to high-throughput parallelanalysis on diagnostic arrays.6 If single-molecule sensitivity6 In fact, no extra probes or extra steps are required. On the contrary,traditional hybridization approaches require rather expensive “decora-tor” probes, hybridization/washing steps, and amplicon-collapsing pro-teins for greater brightness [23,31]. Note that in our case RCA ampliconsare single-stranded and thus are highly compact by themselves, as com-pared with partly double-stranded (stretched) probe-hybridized ampli-cons; therefore, there is no need to enhance their brightness. Anotherpositive feature of our approach is that we measure total signal with theXuorescence-integrating device (scanner), which is amenable to automa-tion and is less subjective than measuring single bright objects [23,31].Fig. 1. EM visualization of Cy3-labeled RCA amplicons. (A) Images of exemplary RCA amplicons generated in solution with 100% Cy3-dCTP andCy3-dUTP substitutions for corresponding dNTPs. (B) Histogram of lengths distribution for 53 RCA amplicons. A 5-phosphorylated 88-nt circu-larized probe carrying Salmonella genome sequences at its termini, 5pGCGCCTTTCCAGACGCTTACCAAGAGCAACTACACG AATTCTCGATTAGGTTACTGCGATTAGCACAAGC GCTGTCACCCTGTATCGC, was circularized by ligation with Taq DNA ligase in the presence ofbiotin–5N20GGAAAGGCGCGCGATACAGG (splint), also employed as a primer in RCA. Complex of the DNA minicircle and primer (109–1012mol of the complex in 50 l) was incubated at 37 °C overnight with 1 U of 29 DNA polymerase and 20 M dNTPs in the buVer containing 20 mMTris–HCl (pH 7.5), 10 mM MgCl2, 25 mM NaCl, and 5 mM dithiothreitol. dTTP and dCTP were completely substituted by their Cy3-Xuorescentanalogs. Gel-filtration puriWed RCA amplicons were annealed with the 88-nt complementary oligonucleotide for better visualization by EM. Sam-ples for electron microscopy were prepared as described in Ref. [28].154 Notes & Tips / Anal. Biochem. 347 (2005) 152–155is not an issue, direct RCA labeling and automated scan-ning of the arrays could be an assay of choice.In summary, we have reported that RCA with 29DNA polymerase and Cy3-labeled dNTPs is a simpletool for generation of high-density Xuorescently labeledamplicons. When biotinylated RCA primer is immobi-lized on streptavidin-covered glass slides, the assayemploying Xuorescent scanners can be used for directand sensitive quantitation of corresponding analyteswithout any hybridization probes.AcknowledgmentsWe thank Charles Lee for access to the Xuorescentscanner, Charles R. Cantor for comments on the manu-script, and Harry McCoy and Diarmaid H. Douglas-Hamilton for participating in discussions. This studywas supported by a sponsored research agreementbetween Boston University and Hamilton Thorne Bio-sciences Inc. (Charles Cantor, PI).References[1] J. Zimmermann, W. Ludwig, K.H. Schleifer, DNA polynucleotideprobes generated from representatives of the genus Acinetobacterand their application in Xuorescence in situ hybridization of envi-ronmental samples, Syst. Appl. Microbiol. 24 (2001) 238–244.[2] E. Manduchi, L.M. Scearce, J.E. Brestelli, G.R. Grant, K.H. Kaest-ner, C.J. Stoeckert Jr., Comparison of diVerent labeling methodsfor two-channel high-density microarray experiments, Physiol.Genom. 10 (2002) 169–179.[3] G. Giller, T. Tasara, B. Angerer, K. Muhlegger, M. Amacker, H.Winter, Incorporation of reporter molecule-labeled nucleotides byDNA polymerases: I. Chemical synthesis of various reporterFig. 2. Fluorescent microscopy of surface-immobilized Xuorogenic RCA amplicons. (A) Schematics of the RCA experiments. Note the unusual struc-ture of the rolling circle complex3. (B) Detection of RCA amplicons with Xuorescent microscope. A speciWed amount (10 l) of the DNA minicirclecomplex with the primer was spread onto approximately 1 cm2 area of streptavidin-covered glass slides (106 streptavidin molecules/pixel). After a fewminutes, 40 l of solution with all other reaction components was added. dTTP and dCTP were completely substituted by their Cy3-Xuorescent ana-logs. The spot was covered with the thin cover glass and Wxed with glue (rubber cement). The samples were incubated at 37 °C overnight; washed bysuccessively immersing the slides in (i) 2£SSC with 2% sodium dodecyl sulfate, (ii) 2£SSC with 50% formamide, (iii) 2£SSC, and (iv) 0.2£SSC; driedin air; and subjected to microscopy analysis with a Nikon E800 Xuorescent microscope (£20) (upper), and images were processed by ImageJ software(lower). Left to right: “no circle” control (background Xuorescence), approximately 100 amplicons/mm2, and approximately 1000 amplicons/mm2.(C) GenePix scanner images of the same slides (10 m resolution, ImageJ software). Images with 10 amplicons/mm2 look similar to the backgroundimages (not shown). (D) Total Xuorescence measured as a function of target load for RCA reactions with 100% Cy3-dCTP/Cy3-dUTP in the dNTPmixture (I) or for RCA reactions with all normal dNTPs and with the use of detector oligonucleotide tagged with Cy3 at both of its termini (II).Areas of 10 £ 10 mm (106 pixels) were analyzed using SigmaPlot software. Pixels with Xuorescence less that 200 FU were considered as backgroundand were not counted.Notes & Tips / Anal. Biochem. 347 (2005) 152–155 155group-labeled 2-deoxyribonucleoside-5-triphosphates, NucleicAcids Res. 31 (2003) 2630–2635.[4] T. Tasara, B. Angerer, M. Damond, H. Winter, S. Dorhofer, U.Hubscher, M. Amacker, Incorporation of reporter molecule-labeled nucleotides by DNA polymerases: II. High-density label-ing of natural DNA, Nucleic Acids Res. 31 (2003) 2636–2646.[5] A. Richter, C. Schwager, S. Hentze, W. Ansorge, M.W. Hentze, M.Muckenthaler, Comparison of Xuorescent tag DNA labelingmethods used for expression analysis by DNA microarrays, Bio-Techniques 33 (2002) 620–630.[6] J. Haralambidis, M. Chai, G.W. Tregear, Preparation of base-modiWed nucleosides suitable for non-radioactive label attach-ment and their incorporation into synthetic oligodeoxyribonu-cleotides, Nucleic Acids Res. 15 (1987) 4857–4876.[7] D. Singh, V. Kumar, K.N. Ganesh, Oligonucleotides: V. Synthesisand Xuorescence studies of DNA oligomers d(AT)5 containingadenines covalently linked at C-8 with dansyl Xuorophore,Nucleic Acids Res. 18 (1990) 3339–3345.[8] J.B. Randolph, A.S. Waggoner, Stability, speciWcity, and Xuores-cence brightness of multiply-labeled Xuorescent DNA probes,Nucleic Acids Res. 25 (1997) 2923–2929.[9] R.L. Stears, R.C. Getts, S.R. Gullans, A novel, sensitive detectionsystem for high-density microarrays using dendrimer technology,Physiol. Genom. 3 (2000) 93–99.[10] Z. Zhu, J. Chao, H. Yu, A.S. Waggoner, Directly labeled DNAprobes using Xuorescent nucleotides with diVerent length linkers,Nucleic Acids Res. 22 (1994) 3418–3422.[11] Z. Zhu, A.S. Waggoner, Molecular mechanism controlling theincorporation of Xuorescent nucleotides into DNA by PCR,Cytometry 28 (1997) 206–211.[12] M.A. Augustin, W. Ankenbauer, B. Angerer, Progress towards sin-gle-molecule sequencing: Enzymatic synthesis of nucleotide-spe-ciWcally labeled DNA, J. Biotechnol. 86 (2001) 289–301.[13] J.P. Anderson, B. Angerer, L.A. Loeb, Incorporation of reporter-labeled nucleotides by DNA polymerases, BioTechniques 38(2005) 257–264.[14] V.V. Demidov, Rolling-circle ampliWcation in DNA diagnostics:The power of simplicity, Expert Rev. Mol. Diagn. 2 (2002) 542–548.[15] D.Y. Zhang, B. Liu, Detection of target nucleic acids and proteinsby ampliWcation of circularizable probes, Expert Rev. Mol. Diagn.3 (2003) 237–248.[16] S. Bakht, X. Qi, Ligation-mediated rolling-circle ampliWcation-based approaches to single nucleotide polymorphism detection,Expert Rev. Mol. Diagn. 5 (2005) 111–116.[17] M. Frieden, E. Pedroso, E.T. Kool, Tightening the belt on poly-merases: Evaluating the physical constraints on enzyme substratesize, Angew. Chem. Intl. Ed. 38 (1999) 3654–3657.[18] D. Shore, J. Langowski, R.L. Baldwin, DNA Xexibility studied bycovalent closure of short fragments into circles, Proc. Natl. Acad.Sci. USA 78 (1981) 4833–4837.[19] L. Ulanovsky, M. Bodner, E.N. Trifonov, M. Choder, CurvedDNA: Design, synthesis, and circularization, Proc. Natl. Acad. Sci.USA 83 (1986) 862–866.[20] P.J. Hagerman, Flexibility of DNA, Annu. Rev. Biophys. Biophys.Chem. 17 (1988) 265–286.[21] H. Kuhn, D.I. Cherny, V.V. Demidov, M.D. Frank-Kamenetskii,Inducing and modulating anisotropic DNA bends by pseudocom-plementary peptide nucleic acids, Proc. Natl. Acad. Sci. USA 101(2004) 7548–7553.[22] S. Brakmann, S. Löbermann, High-density labeling of DNA:Preparation and characterization of the target material for single-molecule sequencing, Angew. Chem. Intl. Ed. 40 (2001) 1427–1429.[23] P.M. Lizardi, X. Huang, Z. Zhu, P. Bray-Ward, D.C. Thomas, D.C.Ward, Mutation detection and single-molecule counting using iso-thermal rolling-circle ampliWcation, Nat. Genet. 19 (1998) 225–232.[24] J. Baner, M. Nilsson, M. Mendel-Hartvig, U. Landegren, SignalampliWcation of padlock probes by rolling circle replication,Nucleic Acids Res. 26 (1998) 5073–5078.[25] M. Salas, M. de Vega, J.M. Lázaro, L. Blanco, Phi29 DNA polymer-ase, a potent ampliWcation enzyme, in: V.V. Demidov, N.E. Broude(Eds.), DNA AmpliWcation: Current Technologies and Applica-tions, Horizon Bioscience, Wymondham, UK, 2004, pp. 21–34.[26] H. Yu, J. Chao, D. Patek, R. Mujumdar, S. Mujumdar, A.S. Wagg-oner, Cyanine dye dUTP analogs for enzymatic labeling of DNAprobes, Nucleic Acids Res. 22 (1994) 3226–3232.[27] R.M. Nietupski, S.G. Wilson, J. Shah, S.W. Chan, D.N. Halbert,D.J. Lane, Probes and methods for the detection of Salmonella,U.S. patent 5,147,778 (1992).[28] D.I. Cherny, T.M. Jovin, Electron and scanning force microscopystudies of alterations in supercoiled DNA tertiary structure, J.Mol. Biol. 313 (2001) 295–307.[29] C.R. Sabanayagam, C. Berkey, U. Lavi, C.R. Cantor, C.L. Smith,Molecular DNA switches and DNA chips, in: M. Ferrari (Ed.),Micro- and Nanofabricated Structures and Devices for Biomedi-cal and Environmental Applications, vol. 3606, International Soci-ety for Optical Engineering, San Jose, CA, 1999, pp. 90–97.[30] A. Hatch, T. Sano, J. Misasi, C.L. Smith, Rolling circle ampliW-cation of DNA immobilized on solid surfaces and its applica-tion to multiplex mutation detection, Genet. Anal. 15 (1999)35–40.[31] X.B. Zhong, P.M. Lizardi, X.H. Huang, P.L. Bray-Ward, D.C. Ward,Visualization of oligonucleotide probes and point mutations in inter-phase nuclei and DNA Wbers using rolling circle DNA ampliWcation,Proc. Natl. Acad. Sci. USA 98 (2001) 3940–3945.

High-density fluorescently labeled rolling-circle amplicons for DNA diagnostics

https://pure.mpg.de/pubman/item/item_598241_3/component/file_598240/249250.pdf

High-density fluorescently labeled rolling-circle amplicons for DNA diagnostics

Abstract

Similar works

Full text

Available Versions

MPG.PuRe