Aifat N.R.,

Md-Zain B. M,

Yaakop S.,

UKM Journal Article Repository

* To whom correspondence should be addressed.Malays. Appl. Biol. (2016) 45(1): 93–96OPTIMIZATION OF PARTIAL Cyt b GENE SEQUENCE FROMSELECTED ANCIENT Presbytis MUSEUM SKIN SPECIMENSAIFAT, N.R., YAAKOP, S. and MD-ZAIN, B.M.*School of Environmental and Natural Resource Sciences, Faculty of Science and Technology,Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor*Email: abgbadd@ukm.edu.myAncient DNA analyses hold great potential toimprove our understandings on phylogeny,phylogeography, and the population history ofextinct and extant species (Barnett et al., 2007).According to Rohland et al. (2004), museumspecimens are important sources of biologicalmaterials for a large number of ancient DNA studies.Most importantly, museum specimens are theonly sample source available from the extinctpopulations, enables the investigation of past andpresent diversity and detection of genetic diversitylosses that may have incurred over a period of time.Unlike modern genetic analyses, ancient DNAstudies are characterized by low quality DNA andthus render limited potential for satisfactory resultsobtained from amplification and sequence analyses.Therefore, a suitable extraction procedure is neededto obtain DNA from the museum specimens. In thisstudy, we selected dry skin specimens from themuseum collection because not all collections inmuseums are preserved (frozen or ethanolimmersion), and dry skins may be the only sourceof genetic material with poor molecularcharacterizations (Nadia & Morgante, 2007).Seven dry skin specimens of primate Presbytiswere procured from Sarawak Museum and SabahMuseum. All specimens were dated from 43 to 124years old (Table 1). The DNA extraction wereperformed using the QIAamp DNA InvestigatorKit (Qiagen). Although there are several well-established protocols, have been used to obtain andamplify DNA segments from museum specimens(Shedlock et al., 1997; Yang et al., 1997; Pichler etal., 2001; Junqueira et al., 2002), nevertheless, theseprotocols require special reagents, which are costlyand time consuming.Two primer pairs were designed for the Cyt bregion of the mitochondrial DNA (mtDNA). Bothprimer pairs were designed for P. hosei and P.frontata (Table 2). Two sequences of P. hosei andP. frontata retrieved from GenBank were used astemplates for the primer design. The Primer-BLAST(Ye et al., 2012) program was used to generatecandidate primer pairs for the template sequencesand minimum Tm differences between primerpairs. The Needleman-Wunsch global alignmentalgorithm was employed to check the specificity ofthe primer pairs corresponding to the templatesequences (Needleman & Wunsch, 1970). Physicalcharacteristics taken into account in designingspecies-specific primers included the sequencelength, percentage of guanine-cytosine (GC)content, molecular weight (g/mole), andcomplementary sequences.The polymerase chain reaction (PCR) wascarried out in a 25 µl final volume by usingMyTaq™ Red Mix from Bioline, (Country). Assuggested by the manufacturer, the PCR reactionset up included 12.5 µl of MyTaq™ Red Mix,(Country) 1.0 µl of each 20 µM primer (forward andreverse), 3.0 µl of DNA template, and water addedup to the final volume of 25 µl. The PCR cyclingconditions were set as followings; 95°C for 3 min,30 cycles of 95°C for 15 sec, gradient rangedannealing temperature (P. hosei: 48.8°C–51.0°C;P. frontata: 49.2°C–52.4°C) for 30 sec, and 72°Cfor 10 sec, followed by incubation at 72°C for 10min. Negative controls were included in each PCRrun. In order to optimize the annealing temperaturefor each primer pair, the amount of DNA templateused was kept constant. The PCR products weresubjected to electrophoresis using 1.5% agarose gelin a 1X TAE buffer. In the event of successful bandsof amplifications, PCR products were sent to FirstBase Sdn. Bhd., Malaysia for sequencing. Bothforward and reverse primers were conducted in thesequencing process. The quality of amplified DNAwas quantified by chromatogram using BioEditsoftware. The chromatogram was ascertained withthe following properties; distinctive, single-colorpeaks that were evenly separated, well formed andabsence of noisy background.94 CYT b GENE SEQUENCE FROM SELECTED ANCIENT Presbytis MUSEUM SKIN SPECIMENSTable 2. Two designed primer pairs for Cyt b locusPrimate Species Sequence (5’-3’) Annealing Temperature PCR Product Size   Primer name (ºC) (bp)PresbytishoseiAIFAT6901_F 5'- GATAATTATACCCCAGCCAA -3' 48.8 150AIFAT6903_R 5'- GATATGCTTTGTTGTTTGGA -3'PresbytisfrontataAIFAT6909_F 5'- ACTCTTCACTTTACACTACC -3' 49.2 210AIFAT6911_R 5'- AGTATTTAGTGGGTTAGCTG -3'Table 1. List of museum skin samplesNo Code No.   Species        Date of Locality Types of    Name      specimen sample1 BMPF 55 P. frontata 8 Oct 1962 Nanga Takalit, Sg Mengiong, Balleh Sarawak Skin2 BMPF 57 P. frontata 23 Sept 1962 Nanga Takalit, Sg Mengiong, Balleh Sarawak Skin3 BMPF 59 P. frontata 4 Sept 1929 Ulu Majong, Sarawak Skin4 BMPH 71 P. hosei 29 March 1972 Kg. Pandasan, Kota Belud, Sabah Skin5 BMPH 72 P. hosei 10 Jan 1969 Kg. Pinawantas, Kudat Sabah Skin6 BMPH 77 P. hosei 25 Nov 1964 Kuching, Sarawak Skin7 BMPH 79 P. hosei Sept 1891 Gunung Dulit, Sarawak  SkinA temperature of 48°C–53°C was applied usinga gradient PCR machine (PTC-100 Thermal Cyclerby MJ Research, Inc., Waltham, MA, USA) for bothprimer pairs (Cyt b P. hosei and P. frontata). Onlyone sample (DNA) from each species (P. hosei[BMPH72] and P. frontata [BMPF59]) was chosento optimize the annealing temperature of theprimers.In this study, both of the primer pairs had thesame average estimated Tm (49°C). The resultsshowed that both primer pairs were able to amplifythe targeted loci, approximately 200bp (Figure 1and Figure 2). However, each Tm tested for this geneproduced poor amplification products (fainterbands) than were obtained for a Tm between 51°Cand 53°C. The highest Tm that can produce the bestvisible product on agarose gel was chosen for eachof the primer pairs in order to obtain the highestspecificity of the annealing of the primer to itsperfect matched template (McPherson & Moller,2006). The sequencing results were aligned to thecontrol sequence retrived from GenBank to ensurethat the designed primers annealed to the specifictarget. Both primer pairs were able to amplify theCyt b gene, sized 100bp to 200bp (four samplesfrom P. hosei and three samples from P. frontata).Previous ancient DNA studies using degradedDNA did not report positive results for DNAsequences longer than 250bp (Paabo et al., 2004).In this study, both primers designed specificallyto the selected species were able to amplify all themuseum skin specimens utilized in this study. Byusing specific-locus-species primers, amplifyingunwanted by-products which could occur with theusage of universal primers can be avoided (Syed-Shabthar et al., 2013). In addition, the analysisof DNA from degraded samples is technicallydemanding since the availability of DNA is limited.Several factors should be taken into account whendesigning PCR primers because these factors affectthe efficacy of the approach tremendously. Forexample, when using a primer with minimal length,a denaturation temperature of 55–56°C shouldgenerally be used; this will greatly increase thespecificity and efficacy of PCR (Singh & Kumar,2001).PCR optimization has proved to be animportant approach to obtain positive results inresearch involving ancient DNA samples (Elliza etal., 2015). The successful use of suitable parametersand chemical reactions to examine museum skinspecimens showed that ancient specimens may bevaluable biological samples to compare the past andpresent genetic diversity values. of P. hosei and P.frontata which are nearing to extinct. Museumsamples can fulfill this task through ancient DNAanalyses, and most Malaysian museums have agood representation of all primate taxa.CYT b GENE SEQUENCE FROM SELECTED ANCIENT Presbytis MUSEUM SKIN SPECIMENS 95Fig. 2. DNA bands of gradient PCR on 1.5% agarose gel for Cyt b gene. The best Tm was48.8°C for P. hosei and 49.2°C for P. frontata. Each well on agarose gel indicates Tm forP. hosei and P. frontata, respectively: Well 1 = 48.8°, 49.2°C; Well 2 = 49.2°, 49.7°C;Well 3 = 49.7°, 50.6°C; Well 4 = 50.2°, 51.5°C, Well 5 = 51.0°, 52.4°C.Fig. 1. Results of DNA extraction for samples P. hosei (A) and P. frontata (B).96 CYT b GENE SEQUENCE FROM SELECTED ANCIENT Presbytis MUSEUM SKIN SPECIMENSACKNOWLEDGEMENTSThe authors are deeply indebted to both theSarawak Museum and Sabah Museum for theirassistance in the sample collection. The authorswould like to thank Universiti Kebangsaan Malaysia(UKM) for funding this study and providingnecessary facilities and assistance. This research wassupported by ERGS/1/2013/STWN10/UKM/02/1,DLP-2013-006 FRGS/1/2012/STWN10/UKM/02/3,and AP-2015-004 grants.REFERENCESBarnett, R., Yamaguchi, N., Shapiro, B. & Nijman,V. 2007. Using ancient DNA techniques toidentify the origin of unprovenanced museumspecimens, as illustrated by the identificationof a 19th century lion from Amsterdam.Contribution to Zoology, 76: 87-94.Elliza, M.N., Shukor, M.N., Othman, N. & Md-Zain,B.M. 2015. Haplotype distribution amongendangered Asian elephants (Elephas maximus)in Peninsular Malaysia. Malaysian AppliedBiology, 44: 129-135.Junqueira, A.C.M., Lessinger, A.C. & Azeredo-Espin, A.M.L. 2002. Methods for the recoveryof mitochondrial DNA sequences from museumspecimens of myiasis-causing flies. Med VetEntomol., 16: 39-45.McPherson, M.J. & Moller, S.G. 2006. PCR. 2nd edn.Taylor & Francis Group, New York.Nadia, M.B. & Morgante, J.S. 2007. A simpleprotocol for the extraction and sequenceanalysis of DNA from study skin of museumcollections. Genetics and Molecular Biology,30(4): 1181-1185.Needleman, S.B. & Wunsch, C.D. 1970. A generalmethod applicable to the search for similaritiesin the amino acid sequence of two proteins.Journal of Molecular Biology, 48(3): 443-453.Paabo, S., Poinar, H., Serre, D., Despres, V., Juliane,H., Rohland, N., Kuch, M., Krause, J., Vigilant,L. & Hofreiter, M. 2004. Genetic analyses fromancient DNA. Annu. Rev. Genet., 38: 645-679.Pichler, F.B., Dalebout, M.L. & Baker, C.S. 2001.Nondestructive DNA extraction from spermwhale teeth and scrimshaw. Mol. Ecol. Notes, 1:106-109.Rohland, N., Siedel, H. & Hofreiter, M. 2004.Nondestructive DNA extraction method formitochondrial DNA analyses of museumspecimens. Biotechniques, 36: 814-821.Rosli, M.K., Zamzuriada, A.S., Syed-Shabthar,S.M.F., Mahani, M.C., Abas-Mazni, O. &Md-Zain, B.M. 2011. Optimization of PCRconditions to amplify Cyt b, COI and 12S rRNAgene fragments of Malayan gaur (Bos gaurushubbacki) mtDNA. Genetics and MolecularResearch, 10(4): 2554-2568.Shedlock, A.M., Haygood, M.G., Pietsch, T.W. &Bentzin, P. 1997. Enhanced DNA extractionand PCR amplification of mitochondrial genesfrom formalin-fixed museum specimens.Biotechniques, 22: 394-396.Singh, V.K. & Kumar, A. 2001. PCR Primer Design.Molecular Biology Today, 2(2): 27-32.Syed-Shabthar, S.M.F., Rosli, M.K.A., Mohd-Zin,N.A.A., Romaino, S.M.N., Fazly-Ann, Z.A.,Mahani, M.C., Abas-Mazni, O., Zainuddin, R.,Yaakop, S. & Md-Zain, B.M. 2013. Themolecular phylogenetic signature of Bali cattlerevealed by maternal and paternal markers.Molecular Biology Reports, 40: 5165-5176.Yang, H., Golenberg, E.M. & Shoshani, J. 1997.Proboscidean DNA from museum and fossilspecimens: An assessment of ancient DNAextraction and amplification techniques.Biochem.Genet., 35: 165-179.Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I.,Rozen, S. & Madden, T.L. 2012. Primer-BLAST: a tool to design target-specificprimers for polymerase chain reaction. BMCBioinformatics, 13: 134.

Optimization of partial CYT b gene sequence from selected ancient Presbytis museum skin specimens

http://journalarticle.ukm.my/11804/1/45_1_11.pdf

Optimization of partial CYT b gene sequence from selected ancient Presbytis museum skin specimens

Abstract

Similar works

Full text

Available Versions

UKM Journal Article Repository