Species identification in food products has grown interest in recent years since these foodstuffs are liable targets for fraudulent

labelling. Consumers of Halal products typically buying those with a Halal logo stamped on the packaging without doubt for

its authenticity. DNA-based methods on PCR amplification were used to identify the presence of porcine DNA in the processed

food samples. Genomic DNA of porcine was extracted using DNA-Sorb-C and subjected to PCR amplification targeting the

mitochondrial 12S rDNA gene and porcine leptin gene (LEP). Out of 66 samples, 37 samples showed amplified product of

387 bp with mitochondrial 12S rDNA gene and 59 samples showed amplified products of 152 bp with LEP. The verification

for Halal authentication of food products is significant for economical, religious and public health concerns

Farida Zuraina Mohd Yusof,

Khairunnisa Hassan,

UKM Journal Article Repository

ANALYSIS OF PORCINE DNA IN SEVERAL FOOD PRODUCTS 5Malays. Appl. Biol. (2015) 44(3): 5–9* To whom correspondence should be addressed.ANALYSIS OF PORCINE DNA IN SEVERAL FOOD PRODUCTSKHAIRUNNISA HASSAN* and FARIDA ZURAINA MOHD YUSOFSchool of Biological Sciences, Faculty of Applied Sciences,Universiti Teknologi MARA (UiTM), Shah Alam, 40450 Selangor Darul Ehsan, Malaysia*E-mail: kyun_alisa87@yahoo.comABSTRACTSpecies identification in food products has grown interest in recent years since these foodstuffs are liable targets for fraudulentlabelling. Consumers of Halal products typically buying those with a Halal logo stamped on the packaging without doubt forits authenticity. DNA-based methods on PCR amplification were used to identify the presence of porcine DNA in the processedfood samples. Genomic DNA of porcine was extracted using DNA-Sorb-C and subjected to PCR amplification targeting themitochondrial 12S rDNA gene and porcine leptin gene (LEP). Out of 66 samples, 37 samples showed amplified product of387 bp with mitochondrial 12S rDNA gene and 59 samples showed amplified products of 152 bp with LEP. The verificationfor Halal authentication of food products is significant for economical, religious and public health concerns.Key words: food products, Halal, mitochondrial 12S rDNA gene, leptin gene, porcine, PCRINTRODUCTIONThe increase in Muslim population ofapproximately 1.6 billion Muslims worldwide hasindicated the fast expansion of Islamic religion andthese speculation has been agreed by Malaysia’sHalal Industry Development Corporation (NorMarini et al., 2014). Concurrent to that issue, Halalwill become worldwide symbol as quality assuranceand people lifestyles (Hanzaee and Ramezani, 2011).Thus, the market opportunities and worldwide Halalmarket is profitable due to the increasing numberof Muslim population in the world (Syed andNazura, 2011). Furthermore, it generates biggerdemand for Halal foods and products due toawareness among Muslims worldwide (Abdul Raufuand Ahmad Naqiyuddin, 2014). The demand forimported food products such as chocolates, biscuitsand sweets are projected to escalate steadily over thenext decade as a result of increasing consumption.Unfortunately, most of the imported food productsdoes not have Halal Logo or doubted Halal Logo.As for Muslim and Jewish communities, theconsumption of pork or pork related ingredients isstrictly prohibited. Hence, Muslim community isvery much concerned with food products and itscontents. Currently, Malaysia is facing issuesregarding the adulteration of chocolate productswith porcine DNA. Adulteration usually includessubstituting or diluting high value of raw materialswith cheaper ingredients such as porcine or porkbased ingredients (Kalivas et al., 2014). The bestmethods to identify the presence of pork or porcinebased byproducts in food products is by usingmolecular methods such as species specific PCR(Karabasanavar et al., 2011), random amplifiedpolymorphic DNA finger printing (Calvo et al.,2001) and restriction fragment length polymorphism(RFLP) (Girish et al., 2005). Through thedevelopment of DNA amplification by PCR, it isprobable to detect the species in low amounts ofDNA in the samples (Chi et al., 2014). Nevertheless,species-specific PCR has superiority compared toother DNA-based methods in the matter of rapid andspecific which is PCR-RFLP in particular requirelonger time, costly and requires specific analysis ofresults and Polymerase chain reaction-randomamplified polymorphic DNA technique is very hardto repeat and requires strict amplificationconditions (Karabasanavar et al., 2014). Most of theforensic studies used the mitochondrial DNAbecause it contains a great copy number variation,maternal inheritance and great level of sequencevariance (Rastogi et al., 2007). Mitochondrial DNAis frequently used as genetic markers for speciesdifferentiation and the immanent numerous copiespresence of mitochondrial genes creates animproved sensitivity of PCR analysis (Wang et al.,2010). Mitochondrial DNA is the most extensivelyused to target genes for detection of animal (Fajardo6 ANALYSIS OF PORCINE DNA IN SEVERAL FOOD PRODUCTSet al., 2009). The species identification based onmitochondrial DNA is favored due to its varyingspecificity expressed in the species (Sahilah et al.,2011). In addition, the leptin gene displays greathomology of sequences in various species.(Stêpieñ- Poleszak et al., 2009). In previous study,there was a successful identification of porkadulteration in food samples by the amplificationof the 152 bp porcine leptin gene fragment (Ibrahim,2008). The aim of this study was to determine ofsuspected Non Halal processed food products byusing porcine mitochondrial 12S rDNA and porcineleptin gene.MATERIALS AND METHODSRaw materialsRaw materials used in this study were 66suspected processed food products purchased fromseveral hypermarkets around Shah Alam. There wereeight types of chocolates, hard candies, soft candies,jellies, cheese, chocolate candy, biscuit andchewing gum. Pork sausage was used as positivecontrol. The samples taken in segregated area whichseparated from Halal and Non Halal products. Inaddition, basket and counter for payment were alsoin segregated area which separated from Halal andNon Halal department.DNA extraction from food samplesDNA was extracted by using DNA-sorb-Cnucleic acid extraction kit (Amplisens, Russia)according to manufacturer’s instruction. The samplewas crushed with liquid nitrogen. An amount of 40mg of sample was transferred into a 1.5 ml centrifugetube. An amount of 400 µl of lysis reagent bufferand 17 µl of lysis reagent were added into the tubeand vigorously mixed by pulsed vortexing for fiveseconds. Later, the sample was incubated at 64.0°Cfor one hour with occasionally stirring on vortex forfive times for every ten to twelve minutes until thecells is completely lysed. After one hour, the tubewas centrifuged at 12000 to 14000 rpm for fiveminutes. Then the supernatant was transferred usingtips with aerosol filter into clean 1.5 ml centrifugetube. The suspended particles and oil drops were nottransferred. The tube was centrifuged at 5000 rpmfor five seconds. After that, 25 µl of universalsorbent was added into the tube. Supernatant anduniversal sorbent were mixed well by vortexing thetube every two minutes. Then, the tube wascentrifuged at 5000 rpm for one minute. Thesupernatant was removed using vacuum aspiratorwithout aerosol barrier and also without disturbingthe pellet. It was then followed by washing with 300µl of washing Solution I and continued with stirringon vortex until sorbent was fully suspended. Thenthe tube was centrifuged at 5000 rpm for one minute.The supernatant was removed using vacuumaspirator without aerosol barrier and also withoutdisturbing the pellet. After that, 500 µl of washingSolution II was added and continued mixing usingvortex until sorbent was fully suspended. Then thetube was centrifuged at 10000 to 12000 rpm for oneminute. The supernatant was removed using vacuumaspirator without aerosol barrier and withoutdisturbing the pellet. The washing step usingwashing Solution II was repeated. Then, thesupernatant was completely removed. Next, forsorbent drying, the tube with open cap wasincubated at 64.0°C for five to ten minutes. In thelast part of the protocol which is the elution step,50 µl of TE-buffer was added. The tube was stirredon vortex. Later, the tube was incubated at 64.0°Cfor five to eight minutes and occasionally vortexwhile incubating for every minute. Then the samplewas centrifuged at 12000 to 14000 rpm for oneminute. The supernatant contains purified DNA andwas ready for PCR amplification. Finally, allsamples underwent each procedure accordinglysimilar to steps described above and all samplescontaining 50 µl of genomic DNA were stored at -20.0°C.First PCR amplificationFirst PCR amplification was accomplished in20 µl mixture containing 10 ng genomic DNA, 4 µlof 5x HOT FIREPol® Blend Master Mix, 0.2 µM ofeach forward and reverse primers and 4 µl ofmolecular grade water. In PCR amplification, thefirst set of primers used for specific PCRamplification were forward primer (5'-CCA CCTAGA GGA GCC TGT TCT ATA AT-3') and reverseprimer (5'-GTT ACG ACT TGT CTC TTC GTG CA-3'). This application of primers was reported byRodriguez and colleagues in 2003. This primer pairswere used to identify porcine mitochondrialDNA in food samples. As for the second batch ofsamples, similar PCR amplification procedures werecarried out for second primers as reported byNeuenschwander and colleagues in 1996. Thesecond set of primers were forward primer (5’-TGCAGT CTG TCT CCT CCA AA-3’) and reverse primer(5’-CGA TAA TTG GAT CAC ATT TCT G-3’). Thisprimer pairs were used to identify the pork leptingene fragment in food samples.Second PCR amplificationSecond PCR amplification was accomplished byrepeating the same procedure as in the first PCRamplification. Second PCR amplification results in20 µl mixture containing 10 µl of DNA template ofPCR product from the first PCR amplification, 4 µlANALYSIS OF PORCINE DNA IN SEVERAL FOOD PRODUCTS 7of 5x HOT FIREPol® Blend Master Mix, 0.2 µM ofeach forward and reverse primers and 4 µl ofmolecular grade water.Gel electrophoresis of PCR productsElectrophoresis of the PCR product wasperformed using 2% (w/v) agarose gel prepared in1× TBE buffer. Twenty µl of PCR product wasloaded directly into separate wells on the gel. Then,electrophoresis was carried out at room temperatureat a constant voltage of 100 volts until the bluedye migrates to two over third of the gel. Whenelectrophoresis was completed, the comb wasremoved from the casting tray. The gel wasvisualized under Gel Documentation AlphaImager®(AlphaInnotech, California) for the detection andobservation of the PCR products. The 100 bp DNAladder (SolisBiodyne, Estonia) was used as marker.DNA sequencingAn amount of 40 µl of PCR component was runfor PCR amplification of DNA in thermal cycler(Bio-Rad, USA). The product of the PCRamplification was separated by electrophoresis on2% (w/v) agarose gel to detect the presence of PCRband. An amount of 30 µl of each samples ofprocessed food product, forward and reverse primerworking solution at the 1:10 proportion was sent toGenomic Bioscience & Technology Company forDNA sequencing. Sequencing identity wasconfirmed using online program Clustal Omega andBLAST (Basic Alignment Search Tool) search forgene homology. Finally, all the sequences obtainedwere aligned for development of potential specificprobes.RESULTS AND DISCUSSIONIn this study, DNA extractions from samples ofprocessed food products including pork sausage aspositive control were carried out. All procedures ofDNA extraction were strictly performed accordingto the manufacturer’s instructions in order to obtainhigh quality of DNA. The quality of the extractedDNA was examined by UV-VIS spectrophotometeranalysis. A band of high intensity appeared frompork sausage sample (positive control). Thisindicates that the extracted DNA from pork sausagecan be used as template for PCR amplification ofthe mitochondrial 12S rDNA gene and leptin gene.Initially, there was no genomic DNA banddetected for all processed food products samplestested. It is probably because of low yield ofgenomic DNA was extracted from all samples. In thesecond PCR amplification, it resulted with a clearband of target size for some of the samples. Theamplification yielded product of 387 bp fragmentwhich is in an agreement with the results obtainedby Rodríguez and colleagues in 2003. This resultindicates that the sausage and 37 samples ofprocessed food products contained pork derivatives.In addition, PCR amplification of leptin geneyielded a band of 152 bp for the pork sausage andsamples of processed food products which agreedwith the results reported by Neuenschwander andcolleagues in 1996.In reference to Table 5.1, results indicated thatsausage and 59 samples of processed food productscontained pork derivatives and out of all, 31 sampleswere chocolate products. About 13 samples weredetected with porcine mitochondrial DNA and 29samples detected leptin gene. This gave anindication that there were porcine cells present inthe chocolate products tested, where 10 sampleswere from hard candies product. Out of all, 6samples were detected to contain porcinemitochondrial DNA and 6 samples detected onleptin gene. All soft candy product samples withpresence of porcine derivatives were made up offruit, chocolate and mint flavours. There were 5samples which were jelly products containingporcine mitochondrial DNA and 6 samples weredetected to contain porcine leptin gene. Gelatin wasused in making the jelly products and it is believedthat gelatin used in this jelly product consists ofanimal-based gelatin from pork derivatives. Only 1sample used in this study was from cheese basedproducts. This product also contained porcinemitochondrial DNA and porcine leptin gene. A totalof 6 samples were chocolate candy. Only 2 chocolatecandy samples contained porcine mitochondrialDNA but all six samples were detected to containporcine leptin gene. A total of 4 biscuits samples ofwhich 2 samples contained porcine mitochondrialDNA and only 3 samples were detected to containporcine leptin gene. A total of 3 samples of chewinggum products contained porcine mitochondrial DNAand porcine leptin gene.PCR products of tested food samples withpositive presence of mitochondrial 12S rDNA geneand leptin gene were sent to Genomic Bioscience& Technology Company for DNA sequencing.Samples with mitochondrial 12S rDNA gene wasfurther compared with BLAST to confirm that thesequences belongs to Sus scrofa mitochondrialDNA. BLAST search results showed a maximumidentity of 99% for sample 60 and 91% for sample40 and over query coverage of 100% with theavailable Sus scrofa mitochondrial DNA completesequence in Genbank. Then, the sequences of theDNA were aligned in order to get a probe specificto Halal food. The probes were ACATAAAAACGTTAGGTCAAGGTG and CCCTAAAAAGGAA.8 ANALYSIS OF PORCINE DNA IN SEVERAL FOOD PRODUCTSTable 5.1. Summary of Detection on Mitochondrial DNA and Leptin Gene for Eight Types ofProcessed Food ProductsTypes of Processed Food Products Total Detection on Detection onMitochondrial DNA Leptin GeneChocolates 31 13 29Hard Candies 10 6 6Soft Candies 6 5 6Jellies 5 5 5Cheese 1 1 1Chocolate Candy 6 2 6Biscuits 4 2 3Chewing Gum 3 3 3Fig. 1. Samples 40 to 51 of PCR Products for Mitochondrial 12S rDNA Gene Primer Pairs on 2% (w/v) Agarose GelLane from extremely left:Lane 1 : 100 bp DNA ladder Lane 9 : Sample 45Lane 2 : Positive control Lane 10 : Sample 46 ALane 3 : Negative control Lane 11 : Sample 46 BLane 4 : Sample 40 Lane 12 : Sample 47Lane 5 : Sample 41 Lane 13 : Sample 48Lane 6 : Sample 42 Lane 14 : Sample 49Lane 7 : Sample 43 Lane 15 : Sample 50Lane 8 : Sample 44 Lane 16 : Sample 51CONCLUSIONSIn summary, PCR amplification of mitochondrial12S rDNA gene yielded a band of 387 bp for thepork sausage and 37 samples of processed foodproducts. These results indicate that sausage and37 samples of processed food products containedporcine derivatives.  In addition, PCR amplificationof leptin gene yielded a band of 152 bp from thepork sausage and 44 samples from processed foodproducts.  Results obtained showed that sausage and44 samples of processed food products alsocontained porcine derivatives. The food sampleswere concluded as Non Halal, even though the foodsamples were detected with only mitochondrial12S rDNA gene or leptin gene. This was becauseANALYSIS OF PORCINE DNA IN SEVERAL FOOD PRODUCTS 9mitochondrial 12S rDNA gene and leptin gene wasporcine specific. The alignment of the sequences wasused to make up a probe specific to mitochondrial12S rDNA gene. Two probes were obtained, onewith 24 mers and 13 mers, respectively. The probeswere ACATAAAAACGTTAGGTCAAGGTG andCCCTAAAAAGGAA.REFERENCESAbdul Raufu, A. and Ahmad Naqiyuddin, B. 2014.People’s awareness on Halal foods and products:Potential issues for policy-makers. Procedia-Social and Behavioral Sciences. 121: 3-25.Calvo, J.H., Zaragoza, P. and Osta, R. 2001.Technical note: A quick and more sensitivemethod to identify pork in processed andunprocessed food by PCR amplification of anew specific DNA fragment. Journal of AnimalScience. 79: 2108-2112.Chi, L.C., Ling, F.L., Kwok, C.P., Man, L.C., Fai, C.K.and Han, C.S. 2014. A rapid low-cost highdensity DNA-based multi-detection test forroutine inspection of meat species. MeatScience. 96: 922-929.Fajardo, V., Gonzalez, I., Dooley, J., Garret, S.,Brown, H.M., Garcia, T. and Martín, R. 2009.Application of polymerase chain reaction-restriction fragment length polymorphismanalysis and lab-on-a-chip capillary electro-phoresis for the species identification of gameand domestic meats. Journal of the Science ofFood and Agriculture. 89: 843-847.Girish, P.S., Anjaneyulu, A.S.R., Viswas, K.N.,Shivakumar, B.M., Anand, M., Patel, M. andSharma, B. 2005. Meat species identification bypolymerase chain reaction-restriction fragmentlength polymorphism (PCR-RFLP) of mito-chondrial 12S rDNA gene. Meat Science. 70(1):107-112.Hanzaee, K.H. and Ramezani, M.R. 2011. Intentionto Halal products in the world markets.Interdisciplinary Journal of Research inBusiness. 1(5): 1-7.Ibrahim, A.A. 2008. Improved DNA extractionmethod for porcine contaminants, detection inimported meat to the Saudi market. SaudiJournal of Biological Sciences. 15(2): 225-229.Kalivas, J.H., Georgiou, C.A., Moira, M., Tsafaras,I., Petrakis, E.A. and Mousdis, G.A. 2014. Foodadulteration analysis without laboratoryprepared or determined reference food adulterantvalues. Food Chemistry. 148: 289-293.Karabasanavar, N.S., Singh, S.P., Kumar, D. andShebannavar, S.N. 2014. Detection of porkadulteration by highly-specific PCR assay ofmitochondrial D-loop. Food Chemistry. 145:530-534.Karabasanavar, N.S., Singh, S.P., Umapathi, V.,Girish, P.S., Shebannavar, S.N. and Kumar, D.2011. Authentication of Carabeef (waterbuffalo, Bubalus bubalis) using highly specificpolymerase chain reaction. European FoodResearch and Technology. 233: 985-989.Nor Marini, M., Nur Alia, A. and Hazliza, H. 2014.Ayamas Food Corporation Sdn. Bhd.: A studyon factors of consumer behavior towards Halalproduct selection. Procedia-Social andBehavioral Sciences. 121: 166-185.Rastogi, G., Dharne, M.S., Walujkar, S., Kumar, A.,Patole, M.S. and Shouche, Y.S. 2007. Speciesidentification and authentication of tissue ofanimal origin using mitochondrial and nuclearmarkers. Meat Science. 76: 666-674.Sahilah, A.M., Norhayati, Y., Norrakiah, A.S.,Aminah, A. and Wan Aida, W.M. 2011. Halalauthentication of raw meats using PCRamplification of mitochondrial DNA. Inter-national Food Research Journal. 18(4): 1489-1491.Stêpieñ-Poleszak, D., Pietruszka, A. and Kawêcka,M. 2009. Effect of leptin gene polymorphism onfattening and slaughter value of line 990 gilts.Acta Veterinaria Brno. 78: 267-272.Syed, S.A. and Nazura, M.S. 2011. Applying thetheory of planned behavior (TPB) in Halal foodpurchasing. International Journal of Commerceand Management. 21(1): 8-20.Wang, Q., Zhang, X., Zhang, H.Y., Zhang, J., Chen,G.Q., Zhao, D.H., Ma, H.P. and Liao, W.J. 2010.Identification of 12 animal species meat by T-RFLP on the 12S rDNA gene. Meat Science,85(2): 265-269.

Analysis of porcine DNA in several food products

Abstract

Similar works

Full text

Available Versions

UKM Journal Article Repository