This item is under embargo for a period of 12 months from the date of publication, in accordance with the publisher's policy

Burdon, Kathryn Penelope

Craig, Jamie E

Kuot, Abraham

Mills, Richard Arthur

Sharma, Shiwani

Clinical and Experimental Ophthalmology

Flinders Academic Commons

Archived at the Flinders Academic Commons: http://dspace.flinders.edu.au/dspace/ This is the authors’ version of an article published in Clinical and Experimental Ophthalmology. The original publication is available by subscription at: http://onlinelibrary.wiley.com/  doi: 10.1111/ceo.12122Please cite this article as: Kuot, A., Mills, R., Craig, J. E., Sharma, S. and Burdon, K. P. (2014), Screening of the COL8A2 gene in an Australian family with early-onset Fuchs’ endothelial corneal dystrophy. Clinical & Experimental Ophthalmology, 42: 198–200.Copyright (2013) Royal Australian and New Zealand College of Ophthalmologists. All rights reserved. Please note that any alterations made during the publishing process may not appear in this version. 1 Letter to the Editor – Clinical Case Note Screening of the COL8A2 gene in an Australian family with early-onset Fuchs’ endothelial corneal dystrophy  Abraham Kuot BSc (Hons), Richard Mills PhD, FRANZCO, Jamie E Craig PhD, FRANZCO,Shiwani Sharma PhD* and Kathryn P Burdon PhD*#Department of Ophthalmology, Flinders University, Bedford Park, SA 5042, Australia *contributed equally#corresponding author: Address: Department of Ophthalmology, Flinders University, GPO 2100, Adelaide 5001 SA, Australia Email: kathryn.burdon@flinders.edu.au Phone: + 61 8 8204 4094 Fax: + 61 8 8277 0899 Conflict of Interest Statement None of the authors has any conflict of interest related to this work.    2 Early-onset Fuchs’ endothelial corneal dystrophy (FECD) is a rare, and almost always familial disease with autosomal dominant inheritance (1). To date, mutations in only the COL8A2 (alpha 2 type VIII collagen) gene (MIM 120252; 1p34.2) have been reported to cause this disease (1, 2). So far, only one Australian family has been reported to develop the disease due to the p.Q455K mutation in COL8A2 (1). To determine whether mutations in this gene cause the disease in other similar cases in Australia, we screened the entire coding region of the COL8A2 gene for causative mutations in an affected Caucasian family. The study was conducted in accordance with the tenets of the Declaration of Helsinki and was approved by the Southern Adelaide Clinical Human Research Ethics Committee (Adelaide).   Multiple members of the three-generation family (Fig. 1) were independently examined by six ophthalmologists at different times and institutions. Available clinical information is given in Table 1. Two (II.2 and III.2) of the family members were clinically diagnosed with advanced stage disease following their referral to ophthalmologists. Patients II.2 and III.2 underwent unilateral corneal grafting at the ages of 49 and 48, respectively, to prevent vision loss. The histopathological findings confirmed a diagnosis of early-onset FECD (Table 1) (2). Patient II.2 also had keratoconus (since 15 years of age), blue dot congenital cataract and Map dot fingerprint corneal degeneration. Patient IV.2, the youngest member of the family, was clinically diagnosed with early-onset FECD at 21 years of age, but has not undergone any corneal transplantation as yet. She had visual acuities of 6/9 (right eye) and 6/12 (left eye). Clinical details were not available for individual III.4 but other family members reported that he was diagnosed with endothelial corneal dystrophy, keratoconus and Herpes Simplex Virus (HSV) keratitis. His son (IV.3) is also reported to have endothelial corneal dystrophy but has not been examined. It was also reported that patient I.1 had bilateral corneal transplants at the age of 62; therefore, he was inferred to have FECD. Neither individual I.1 nor IV.3 was available for this study. Overall, the family displayed an autosomal dominant mode of inheritance of the disease (Fig. 1). Four affected family members were recruited (through the Eye Clinic, Flinders Medical Centre, Adelaide) to participate in this study following written informed consent. Blood samples were collected and genomic DNA was extracted as previously described (3).  The two coding exons and their flanking sequence incorporating the 5’UTR (untranslated region), splice sites and stop codon of the COL8A2 gene were amplified by polymerase chain    3 reaction (PCR) using gene-specific primers (Supplementary Table1) in each DNA sample. The PCR products were sequenced as previously described (3).  We identified only one intronic SNP (rs274754; G/A) in individuals II.2 and IV.2, as reported in the dbSNP 135 database (http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp). The minor allele frequency of the G allele of this SNP in the 1000Genomes Project (www.1000genomes.org) is 0.491. This SNP is highly unlikely to be causative as it is a common polymorphism and is present in individuals without early-onset FECD. Neither of the previously reported disease-causing mutations in COL8A2 (p.L450W and p.Q455K) (1, 2), were observed in this family and no novel mutations were identified. This is only the second study to investigate this gene in Australian cases with early-onset FECD. Our finding suggests that mutation in this gene does not contribute to the disease and as yet undetermined gene/s are likely to account for the disease in this Caucasian Australian family.  Our results are supported by other studies that also reported absence of mutation in the COL8A2 gene in familial or sporadic early-onset FECD in French and Indian cases (4, 5). Given the heterogeneity of FECD, it is likely that mutations in genes other than COL8A2 lead to the early-onset disease (2). Two members (II.2 and III.4) of the studied family also have other corneal conditions (Table 1), suggesting that there may be genetic overlap between FECD and other diseases including keratoconus. Keratoconus has never been reportedly associated with familial or sporadic early-onset FECD in patients with COL8A2 mutations, which indicates a further distinction between the present family and those reported in previous studies.  In summary, mutations in the COL8A2 gene do not contribute to all cases of early-onset FECD. We hypothesize that mutations in as yet undetermined gene/s are likely to account for the disease in some cases with early-onset disease.   Acknowledgements We sincerely thank the participants for taking part in this study. We also thank Ms. Emmanuelle Souzeau, Prof. Lawrence Hirst and Dr. John Males for providing technical, clinical and pathology information about the patients. This work was supported by grants from the Ophthalmic Research Institute of Australia and the Flinders Medical Centre    4 Foundation, Adelaide, Australia. K.P.B. and J.E.C. are respectively supported by the National Health and Medical Research Council of Australia Career Development Award and Practitioner Fellowship.  References 1. Biswas S, Munier FL, Yardley J et al. Missense mutations in COL8A2, the gene encoding the α2 chain of type VIII collagen, cause two forms of corneal endothelial dystrophy. Hum Mol Genet. 2001 October 2, 2001;10(21):2415-23. 2. Gottsch JD, Zhang C, Sundin OH, Bell WR, Stark WJ, Green WR. Fuchs Corneal Dystrophy: Aberrant Collagen Distribution in an L450W Mutant of the COL8A2 Gene. Invest Ophthalmol Vis Sci. 2005 December 1, 2005;46(12):4504-11. 3. Burdon KP, Durkin SR, Burke M et al. A novel genetic syndrome characterized by pediatric cataract, dysmorphism, ectodermal features, and developmental delay in an indigenous Australian family. American Journal of Medical Genetics Part A. 2009;149A(4):633-9. 4. Hemadevi B, Srinivasan M, Arunkumar J, Prajna N, Sundaresan P. Genetic analysis of patients with Fuchs endothelial corneal dystrophy in India. BMC Ophthalmol. 2010;10(1):3. 5. Boutboul S, Vetu C, Abitbol M, Menasche M, Borderie V, Laroche L. No Pathogenic Mutations Identified in the COL8A2 Gene in French Families of Fuchs Corneal Dystrophy and CHED. Invest Ophthalmol Vis Sci. 2009 April 11, 2009;50(5):2304-.  Figure legends Figure 1. The pedigree of the Caucasian Australian family with familial early-onset FECD. Squares = males; circles = females; white shapes = unaffected; black shapes = clinically confirmed as affected by FECD; * = DNA available for genetic screening of COL8A2; Grey shape = Affected by Keratoconus only.        5 Table 1: Clinical and histopathological findings in individuals from the Caucasian Australian family with early-onset Fuchs’ endothelial corneal dystrophy (FECD). KC = Keratoconus; HSV = Herpes Simplex Virus; LE = left eye; RE = right eye; DM = Descemet’s membrane; EM = Electron microscopy. Individual Diagnosis History & Clinical Findings Corneal Histopathology I.1 FECD Penetrating keratoplasty in both eyes, presumed for FECD Not available II.2 KC FECD Both eyes: Central corneal thinning  Fleischer rings Abnormal endothelium Corneal oedema Blue-dot congenital cataracts Map-dot fingerprint corneal degeneration Penetrating keratoplasty LE 1991, RE 2001 LE: Attenuated endothelium, no posterior nodularity of DM, thickened 3 layered DM and stromal deposits of unknown significance on EM. RE: Reduced endothelial density, stromal oedema, subepithelial bullae. III.2 FECD Corneal oedema RE Abnormal endothelium both eyes Penetrating keratoplasty RE 2002 RE: Attenuated endothelium, thickened 4 layered DM on EM III.4 FECD KC HSV keratitis Not examined Not available IV.2 FECD Both eyes: Corneal guttata Corneal oedema Reduced endothelial density  Not available IV.3 FECD Not examined Not available    6 Supplementary Table 1. Primers and PCR conditions used for mutation screening of the COL8A2 gene. Primer sequences, primer annealing temperature in degrees centigrade, and the use of Q solution are indicated. Primers were designed using the Primer3 software (http://frodo.wi.mit.edu/primer3/). Amplimers Forward Primer 5’>3’ Reverse Primer 5’>3’ Annealing Temp (C) Q Solution Added? 1 ATTCGGAATTGCTTCTCAGC GCCCTCTGGGGTATTAGGAA 57 No 2.1 TCCTCTCCCGTGTACCTCAT CCTGGTTTTCCAGGGATAGTA 57 No 2.2 CAGGAATACGAGGGGACCA AGTCCTGGCATCCCATAGC 56 Yes 2.3 GGAGACAAGGGTGAGTCTGG AGGAAGTCCCCTCTCACCTG 57 Yes 2.4 TGACCAGGGGCCTAGTGG CGATGCCAGTCTCATCGAA 57 Yes 2.5 CTGGCTCCCCTGGAATCA CCGGCACGTTGTTCTTGTA 57 Yes 2.6 CGTGAAATTTGACCGGACTC CATGCAGGGAGAAAGCAAGT 57 No    7  

Screening of the COL8A2 gene in an Australian family with early-onset Fuchs’ endothelial corneal dystrophy

http://dspace.flinders.edu.au/xmlui/bitstream/handle/2328/27545/Craig_Screening_MS2013.pdf?sequence=1

Screening of the COL8A2 gene in an Australian family with early-onset Fuchs’ endothelial corneal dystrophy

Abstract

Similar works

Full text

Available Versions

Flinders Academic Commons