Knoch, T.A. (Tobias)

Erasmus University Digital Repository

German Cancer Research Center (DKFZ)Heidelberg - GermanyGFP-'Walking': Articial Construct AberrationsCaused by Cotransfectional Homologous RecombinationDo You still believeYour GFP results ???Tobias A. KnochJörg LangowskiBiophysics of MacromoleculesFelix BestvaterEberhard SpiessBiomedical Structure AnalysisHumanGenomeStudy GroupSimultanious cotransfection of GFP-chimeras lead to a GFP conversion:All conversion possibilities were observed by cotransfectingH2A-CFP (SV40, strong expression, localized in the nucleus) andCB-YFP (CMV, weak expression, localized in the ER/Golgi).The convertants can be enriched and stable cell lines can be created.HumanGenome3DTobias A. KnochDoubleTransfectionPure ConversionMixed Conversion20 mHumanGenomeStudy GroupHomology analysis of vectors and genomic PCR for proof of conversion:A homology analysis of H2A-CFP and CB-YFP suggestshomologous recombination as cause of conversion.The final proof of conversion was obtained with a genomic PCRof the full H2A-XFP fusion gene and sequencing of the PCR.HumanGenome3DTobias A. Knoch0 1000 2000 3000 4000 5000 6000 7000 bpλ λM100M100M100M100Cl.-1 Cl.-2 Cl.-3CFPYFPHomology Comparison of H2A-CFP and CB-YFP 2% Agarose Gel, 40V, 4C, 20cmH2A-XFPHumanGenomeStudy Group3DTobias A. KnochFinal proof of the conversion events byanalysis of the sequenced PCRof an conversion enriched cell clone:The conversion takes place in all 16 bpmutations separating CFP and YFP .H2A-ECFP        GGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCH2A-YFP (Cl.1)  GGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCeYFP            --------------------ATGGTGAGCAAGGGCGAGGAGCTGTTCACC H2A-ECFP        GGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAH2A-YFP (Cl.1)  GGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAeYFP            GGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA H2A-ECFP        GTTCAGCGTGTCCGGCGAGGGCGAGGGCGA GCCACCTACGGCAAGCTGAH2A-YFP (Cl.1)  GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGAeYFP            GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGA H2A-ECFP        CCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCH2A-YFP (Cl.1)  CCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCeYFP            CCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACC H2A-ECFP        CTCGTGACCACCCTGACCTGGGGCGTGCAGTGCTTCAGCCGCTACCCCGAH2A-YFP (Cl.1)  CTCGTGACCACCtTcggCTacGGCcTGCAGTGCTTCgcCCGCTACCCCGAeYFP            CTCGTGACCACCtTcggCTacGGCcTGCAGTGCTTCgcCCGCTACCCCGA H2A-ECFP        CCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGH2A-YFP (Cl.1)  CCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGeYFP           CCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACG H2A-ECFP        TCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCH2A-YFP (Cl.1)  TCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCeYFP            TCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGC H2A-ECFP        GCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAH2A-YFP (Cl.1)  GCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAeYFP            GCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAA H2A-ECFP        GGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTH2A-YFP (Cl.1)  GGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTeYFP           GGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGT H2A-ECFP        ACAACTACATCAGCCACAACGTCTATATCACCGCCGACAAGCAGAAGAACH2A-YFP (Cl.1)  ACAACTACAaCAGCCACAACGTCTATATCAtgGCCGACAAGCAGAAGAACeYFP            ACAACTACAaCAGCCACAACGTCTATATCAtgGCCGACAAGCAGAAGAAC H2A-ECFP        GGCATCAAGGCCAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTH2A-YFP (Cl.1)  GGCATCAAGGtgAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTeYFP            GGCATCAAGGtgAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGT H2A-ECFP        GCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGH2A-YFP (Cl.1)  GCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGeYFP            GCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCG H2A-ECFP        TGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAH2A-YFP (Cl.1)  TGCTGCTGCCCGACAACCACTACCTGAGCtaCCAGTCCGCCCTGAGCAAAeYFP           TGCTGCTGCCCGACAACCACTACCTGAGCtaCCAGTCCGCCCTGAGCAAA H2A-ECFP        GACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCH2A-YFP (Cl.1)  GACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCeYFP            GACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGC H2A-ECFP        CGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAH2A-YFP (Cl.1)  CGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAeYFP            CGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAHumanGenomeStudy GroupQuantifiing the conversion rate:For quantifiing the conversion rate images were taken in the phasecontrast-, CFP- and YFP- channel with a Zeiss Axiovert S100 TV.The image aquisition can partly be automized with macros.Reliable conversion rates critically depend on many a  parameter!HumanGenome3DTobias A. KnochCFP-ChannelYFP-ChannelPhase ContrasBackground CellsCFP-Channel YFP-Channela*b*AB[Intensity or Area Range][Intensity or Area Range]FfAAFBfBI  F>I  F>I  F>I  F>  Conversion = BAI  F>I  F>I > i  &  F > fwithand=a*AI  F> b*BI  F>I  F> I  F>HumanGenomeStudy Group3DTobias A. KnochQuantifiing the conversion - Image Aquisition:   For quantifiing the conversion rate imageswere taken in the phase contrast-, CFP- andYFP- channel with a Zeiss Axiovert S100 TV. CFP-ChannelYFP-ChannelPhase ContrasBackground CellsHumanGenomeStudy Group3DTobias A. KnochQuantifiing the conversion - Image Aquisition:Although the image taking can partly beautomized by macros, a reliable conversionrate depends critically on the aquisitionparameters as well as on the vector system !CFP-Channel YFP-Channela*b*AB[Intensity or Area Range] [Intensity or Area Range]FfAAFBfBI  F>I  F>I  F>I  F>  Conversion = BAI  F>I  F> I > i  &  F > fwith and =a*AI  F> b*BI  F>I  F> I  F>HumanGenomeStudy GroupQuantifiing the conversion - Numeration and Background Subtraction: For later digital image processing the images have to be numberedand the background having no isotrope distribution accross the fieldof illumination is subtracted using again a macro.HumanGenome3DTobias A. Knoch= =- -CFP-Channel YFP-ChannelHumanGenomeStudy GroupQuantifiing the conversion - Signal Analysis:With intensity thresholds, binary masks of each channel are createdseparating most H2A from CB signals. With the merged binary masks thesignals in each channel are reevaluated, followed by an area separationof the H2A from the CB signal. The data can be checked in a result image.  HumanGenome3DTobias A. KnochCFP-Channel YFP-ChannelCFP-Channel YFP-ChannelHumanGenomeStudy GroupVarious conversion experiments proof the high rate of conversion:For sufficient statistics in each experiment 1000 to 3000 signalswere obtained, including tests totaling to more than 50.000.In general conversion appears with different vectors, cell lines, andmethods of transfection, but not in overtransfection of a stable cell line !HumanGenome3DTobias A. KnochConstruct Cells Method Conversion[+/-] and [%]H2A-CFPCB-YFPH2A-CFP + CB-YFPH2A-CFP + DsRedH2A-CFP + pure GFPH2A-CFP + CB-YFPH2A-CFP + CB-YFPH2A-CFP* + CB-YFPH2A-CFP + CB-YFPH2A-CFP + CB-YFPH2A-CFP + CB-YFPH2A-CFP + CB-YFPH2A-CFP + CB-YFPH2A-CFP + CB-YFPH2A-CFP + CB-YFPH2A-CFP + CB-YFPH2A-CFP + CB-YFPH2A-CFP + CB-YFPH2A-CFPH2A-CFP + CB-YFPH2A-CFPH2A-CFP + CB-YFPLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HLCLC103HHeLaHeLaCos-7Cos-7--+-++- (+)-++++++++++++-+-+0.00.04.0  0.20.0>1.0>1.00.0 (7.3)0.0??3.410.33.8>1.02.4>1.0~1.0~1.00.0?0.0?FuGene6FuGene6FuGene6FuGene6FuGene6FuGene6FuGene6FuGene6FuGene6FuGene6FuGene6FuGene6Dmrie-CCellfectinLipofectinGibcoPlusElectroporationCa-PhosphatFuGene6FuGene6FuGene6FuGene6simultanioussimultanioussimultanioussep. Mix + simultanioussep. Mix + 4 h delayovertransfec. *stable line5x DNA conc10x DNA conclinearizedlinearized + 96CsimultanioussimultanioussimultanioussimultanioussimultanioussimultanioussimultanioussimultaniousHumanGenomeStudy Group3DTobias A. KnochWarningApplicationsimultanious cotransfections can lead to GFP-walkingthe artificial and misleading results due to conversionare usually between 2% and 8%and can reach up to ~20% in the extreemthe conversion can be reduced dramaticallyby succesive transfectionand overtransfection of a stably transfected cell linea fast method for expressing a fusion protein withanother GFP without creating a new DNA plasmidand receiving immediately a clone of a cell linethis system is a suitable tool for the investigationof homologous recombination(e.g. cancer cells with elevated recombination activity)or similar processes(an optimized system for FACS analysis is possible)Summary and OutlookCFP-Channel YFP-Channel“GFP-Walking”: Artificial Construct Aberrations caused by                                          Co-Transfectional Homologous Recombination  Knoch, T. A. Biophysics of Macromolecules Seminar, German Cancer Research Centre (DKFZ), Heidelberg, Germany, July, 2000.   Corresponding author email contact: TA.Knoch@taknoch.org  Keywords: Genome, genomics, genome organization, genome architecture, structural sequencing, architectural sequencing, systems genomics, coevolution, holistic genetics, genome mechanics, genome function, genetics, gene regulation, replication, transcription, repair, homologous recombination, simultaneous co-transfection, cell division, mitosis, metaphase, interphase, cell nucleus, nuclear structure, nuclear organization, chromatin density distribution, nuclear morphology, chromosome territories, subchromosomal domains, chromatin loop aggregates, chromatin rosettes, chromatin loops, chromatin fibre, chromatin density, persistence length, spatial distance measurement, histones, H1.0, H2A, H2B, H3, H4, mH2A1.2, DNA sequence, complete sequenced genomes, molecular transport, obstructed diffusion, anomalous diffusion, percolation, long-range correlations, fractal analysis, scaling analysis, exact yard-stick dimension, box-counting dimension, lacunarity dimension, local nuclear dimension, nuclear diffuseness, parallel super computing, grid computing, volunteer computing, Brownian Dynamics, Monte Carlo, fluorescence in situ hybridization, confocal laser scanning microscopy, fluorescence correlation spectroscopy, super resolution microscopy, spatial precision distance microscopy, autofluorescent proteins, CFP, GFP, YFP, DsRed, fusionprotein, in vivo labelling.   Literature References  Knoch, T. A. Dreidimensionale Organisation von Chromosomen-Domänen in Simulation und Experiment. (Three-dimensional organization of chromosome domains in simulation and experiment.) Diploma Thesis, Faculty for Physics and Astronomy, Ruperto-Carola University, Heidelberg, Germany, 1998, and TAK Press, Tobias A. Knoch, Mannheim, Germany, ISBN 3-00-010685-5 and ISBN 978-3-00-010685-9 (soft cover, 2rd ed.), ISBN 3-00-035857-9 and ISBN 978-3-00-0358857-0 (hard cover, 2rd ed.), ISBN 3-00-035858-7, and ISBN 978-3-00-035858-6 (DVD, 2rd ed.), 1998. Knoch, T. A., Münkel, C. & Langowski, J. Three-dimensional organization of chromosome territories and the human cell nucleus - about the structure of a self replicating nano fabrication site. Foresight Institute - Article Archive, Foresight Institute, Palo Alto, CA, USA, http://www. foresight.org, 1- 6, 1998. Knoch, T. A., Münkel, C. & Langowski, J. Three-Dimensional Organization of Chromosome Territories and the Human Interphase Nucleus. High Performance Scientific Supercomputing, editor Wilfried Juling, Scientific Supercomputing Center (SSC) Karlsruhe, University of Karlsruhe (TH), 27- 29, 1999. Knoch, T. A., Münkel, C. & Langowski, J. Three-dimensional organization of chromosome territories in the human interphase nucleus. High Performance Computing in Science and Engineering 1999, editors Krause, E. & Jäger, W., High-Performance Computing Center (HLRS) Stuttgart, University of Stuttgart, Springer Berlin-Heidelberg-New York, ISBN 3-540-66504-8, 229-238, 2000. Bestvater, F., Knoch, T. A., Langowski, J. & Spiess, E. GFP-Walking: Artificial construct conversions caused by simultaneous cotransfection. BioTechniques 32(4), 844-854, 2002.  

"GFP-Walking": Artificial Construct Aberrations caused by Co-Transfectional Homologous Recombination

Abstract

Similar works

Full text

Available Versions

Erasmus University Digital Repository