Cotton, D.

Gutierrez, Jean

Kreiter, S.

Navajas, M.

Horizon / Pleins textes

Experiniental & Applied Acarology, 15 ( 1992) 2 1 1-2 18 
Elsevier Science Publishers B.V., Amsterdam 
21 1 
y. ACARI623 
Molecular approach in spider mites (Acari: 
Tetranychidae ) : preliminary data on ribosomal 
DNAsequences 
M. Navajas, D. Cotton, S .  Kreiter and J. Gutierrez 
Laboratoire d ’Acarologie, INRA-ENSA. M-ORSTOM, Montpellier, France 
(Accepted 21 July 1992) 
ABSTRACT 
Navajas, M., Cotton, D., Kreiter, S. and Gutierrez, J., 1992. Molecular approach in spider mites (Acari: 
Tetranychidae): preliminary data on ribosomal DNA sequences. Exp. Appl. Acarol., 15: 21 1-218. 
DNA sequence data were used to examine phylogenetic relationships between six species of eco- 
nomically important Tetranychidae mites: Eotetranychus carpini (Oudemans), E. pruni (Reck), Tet- 
ranychuspaci’cus McGregor, T. incdanieli McGregor, T. turkestaiii Ugarov & Nikolski and T. urticae 
Koch. With primers directed toward conserved elements flanking the target region, the Polymerase 
Chain Reaction was used to amplify the ITS2 spacer of the ribosomal DNA molecule. The nucleotide 
sequence of a 300-bp fragment of the ITS2 was determined by direct sequencing and nucleotide di- 
vergence used for intra-generic comparison in mites. The resulting phylogenetic tree expressing inter- 
specific relationships in genus Tetranychus agrees with morphological data. The study demonstrates 
the usefulness of the approach in the assessment of the systematics and evolution of the group. 
INTRODUCTION 
The family Tetranychidae (66 genera and over 1000 species) includes many 
agricultural pests. The systematics of the group was previously based on mor- 
phological characters which are not always easy to observe and which may be 
variable. Biological and cytogenetic work has led to phylogenetic hypotheses 
(Gutierrez et al., 1970; Gutierrez and Helle, 1985), but the scope seemed 
limited. Other techniques were used to improve species discrimination. A few 
mite species have been submitted to electrophoretic protein analysis. These 
studies were performed in particular on three of the agronomically most im- 
portant mite species ( Tetrunyelzus mcdunieli McGregor, T. pacificus Mc- 
Gregor and T. urticae Koch). Enzymatic polymorphism was useful in the de- 
Correspondence to: M. Navajas, Laboratoire d‘Acarologie, INRA, 2 Place P. Viala, 34060 Mont- 
pellier, France. 
0168-8162/92/$05.00 O 1992 Elsevier Science Publishers B.V. All rights reserved. 
212 M. NAVAJAS ET AL. 
tection of inter- and intraspecific differences (Ward et al., 1982; Sula and 
Weyda, 1983; Grafton-Cardwell et al., 1988; Kim and Lee, 1990). 
Molecular analysis in taxonomic classification provides a solid basis for 
phylogenetic hypotheses. Advantages of both morphological and molecular 
approaches of systematics were discussed by Hillis (1987). Geneticists and 
taxonomists have used molecular techniques over the past decade to examine 
intra- and interspecific variation in DNA segments. Work on restriction en- 
donucleases was followed by sequencing leading to phylogenetic hypotheses 
(Miyamoto and Cracraft, 1992). The Polymerase Chain Reaction (PCR) 
(Mullis and Faloona, 1987; Saiki et al., 1988), amplifying specific regions in 
the genome using minute quantities of DNA, enables use of the DNA ap- 
proach on organisms as small as mites. 
Sequence comparisons of small subunits of ribosomal RNAs or their genes 
can be applied to compare closely and distantly related taxa (Sogin and Gun- 
derson, 1987). Several rDNA regions have been sequenced in a broad range 
of eukaryotes (Hillis and Dixon, 199 1 ) . Some regions of the ribosomal genes 
are well conserved (coding regions) while others undergo more rapid evolu- 
tion (noncoding regions referred to as “spacers”). A variable rDNA region - 
spacer ITS2 - was amplified using primers defined in the highly conserved 
flanking regions 5.8s and 28s rDNA (Fig. 1 ). Sequences of this 28s region 
are known in several eukaryotes (Qu et al., 1988 1. 
This is a completely new approach in mites and we possess no sequence 
data, with the exception of a few molecular analyses of a mite neurotoxin gene 
in Pyemotidae (Tomaiski and Miller, 199 1 ) and mite allergens such as Ixo- 
didae and Pyroglyphidae (Rand et al., 1989; Tovey et al., 1989; Dilworth et 
al., 199 1 ; Yuuki et al., 199 11 ). We used PCR and chain termination sequenc- 
ing of the ITS2 rDNA spacer as a first step in the molecular study of mite 
phylogenetic relationships to assess the level of variability in six Tetranychi- 
dae species. 
MATERIALS AND METHODS 
Sample preparation and DNA isolation 
Mite sources are shown in Table 1. They were either collected in the field 
(Eotetranychus carpini (Oudemans) , E. pruni (Reck) ) or reared in the lab- 
oratory ( T. pacijcus, T. mcdanieli, T. urticae, T. turkestani Ugarov & Nikol- 
ski). Whole genomic DNA was extracted from fresh adults ( 1 O to 30 individ- 
uals). Tissues were digested in 500 pl of extraction buffer ( 1 O mM NaCl, 1 
mM EDTA, 1 O mM Tris, 1 Yo SDS ) and 1 O0 pg/ml of proteinase K at 37 OC 
for 2 h. The resulting soluti,on was extracted twice with phenol and once with 
phenol/chloroform. DNA samples were concentrated and desalted on a Cen- 
tricon 1 O0 microconcentrator (Amicon). 
f 
RIBOSOMAL DNA SEQUENCES OF SPIDER MITES 
TABLE 1 
List of species examined and origin of the material 
213 
Species Host plant Locality 
Eotetranychus carpini (Oudemans) Vitis vinifera L. Montpellier (F) 
Eotetranychus pruni (Oudemans ) Acer platanoides L. Montpellier (F) 
Tetraiiychus pacificus McGregor Vitis vinifera L. Davis (Ca, USA) 
Tetranychus incdanieli McGregor Vitis vinifera L. Verzenay (F) 
Tetranychus turkestani Ugarov & Nikolski Pliaseolus vulgaris L. Montpellier (F) 
Tetranychus urticae Koch Sambucus nigra L. Amsterdam (NL) 
ITS-1 ITS-2 
ETS 18s \ 5.8s / 28s 
Fig. 1. Organisation of an animal rDNA replication unit (after Hillis and Dixon, 199 1 ). Spacer 
ITS2 was amplified in mites by PCR. Arrows indicate the position of PCR primers. These primers 
are the HC2 (in the 28s region) and the LC1 (in the 5.8s region) in Depres et al. (1992). 
M l  2 3 4 5 6  
Fig. 2. Agarose gel electrophoresis of amplified ITS2 ribosomal DNA region in several species 
of Tetranychidae mites. Size differences were observed between the amplification products of 
the studied genera. Lanes 1 to 4: Tetranychus spp.; lanes 5 and 6: Eotetranyclzus spp. Size marker 
(M) noted in base pairs. 
Enzymatic amplification and sequencing 
The polymerase chain reaction was performed in 5O-pl reactions. Amplifi- 
cation was carried out by denaturation at 92 O C  for 1 min, annealing at 54 OC 
for 1 min and extension at 72°C for 1 min. The cycle was repeated 30 times. 
Amplification products were resolved by electrophoresis in agarose gel and 
stained with ethidium bromide to visualize the DNA. Sequences and precise 
position of PCR primers are described in Despres et al. ( 1992) (Fig. 1 ). 
The amplified products were directly sequenced after centrifugal dialysis 
214 M. NAVAJAS ET AL. 
on Centricon 100 microconcentrators; 7 pl of the retentate was used for se- 
quencing by the dideoxynucleotide chain termination method and Sequenase 
enzyme (United States Biochemical Co. ). The products of the sequencing 
reactions were resolved in 6% polyacrylamide/7-Murea gels. Electrophoresis 
was carried out for 2.5 h at 40 mA. Gels were fixed in 10% glacial acetic acid/ 
10% ethanol, dried and autoradiographed. 
Sequence analysis 
Sequences were aligned with the aid of the MULTALIN program (Corpet, 
1488 ) . The percent nucleotide divergences were calculated by the method of 
Ju.kes and Cantor (1969) using the program DNADIST of J. Felsenstein's 
package PHYLIP 3.4. A tree was constructed using the program KITSCH in 
PHYLIP 3.4. This program builds the tree that minimises the sum of squares 
of the differences between the patristic and the measured distances. This 
method furthermore assures a molecular clock, i.e. assumes that the rate of 
evolution is the same in all branches of the tree. 
RESULTS 
The ITS2 spacer of ribosomal DNA was amplified in the six Tetranychidae 
species listed in Table 1. Size differences were observed between the amplifi- 
cation products of the two studied genera (Fig. 2).  A fragment of 200 to 300 
nucleotides of the 3' end of the ITS2 region was sequenced. Pairwise compar- 
isons cmf nucleotide positions (Fig. 3 )  showed a low substitution rate within 
eqch genus and good alignment is thus possible. In contrast, there were con- 
siaerable divergences between the two genera and sequences were aligned in- 
dependently at generic level (Fig. 3A and B) .  Percent of nucleotide diver- 
gences between the Tetranychus species varied from 1.4% between T. urticae 
and T. turkestani to 1.7% between T. mcdanieli and T. pacificus (with 3 and 
2 insertions/deletions respectively between the two pairs of species). These 
divergences reach 10% between T. urticae and T. pacificus (4  insertions/dele- 
tions ) . In the genus Eotetrunychus, the nucleotide substitution rate between 
the studied species is 7.6% (8  insertions/deletions) . 
Sequences of the genus Tetranyehus were processed in a phylogenetic tree 
to express the relationship between species (Fig. 4). Two clusters clearly ap- 
pear from this analysis: T. urticae and T. turkestani on one side and T. medan- 
ieli and T. pacificus on the other side. 
Fig: 3. Comparison of the mite sequences of the 3' end of the ITS2 ribosomal DNA region. 
Sequences of the two studied genera are aligned independently: (A) Tetranychus spp. (B) 
Eotetrunychus spp. Tetranychidae species were aligned by reference to the consensus sequence 
(with identities denoted by hyphens and deletions represented by dots). 
I '  
RIBOSOMAL DNA SEQUENCES OF SPIDER MITES 
B 
1 10  20  30  40 5 0  60  
consensus AGA C A AGTAAAAAGGTT GGAAAAGT CACA CACACGC CAATTAAG TT 
70 80 90 1 O0 110 120 
consensus GT TGTG TGAC TCAAACATTTGCTTGAACGAT AAAACCATATGCACATAAAGA A 
190 200 21 o 
consensus AG GAGA GCCTTTTCTTTG CGTCATATTA 
215 
216 
T. pac i f icus  
T. mcdanie l i  
T. turkes tani  
T. urt icae 
M. NAVAJAS ET AL. 
5 4 3 2 1 0  
Fig. 4. Phylogenetic tree obtained from four species of Tetranychus mites. The sequences con- 
sidered are those of Fig. 3. The scale below the tree gives the percent of nucleotide divergences. 
DISCUSSION 
The variability of sequences enabled good separation of the various species 
and appeared to be suitable for examining phylogenetic relationships within 
each genus. In contrast, the differences between genera were too great to en- 
able proper alignment of sequences. This important sequence divergence be- 
tween genera was accompanied by a difference in size of about 100 bp be- 
tween the products of amplification (Fig. 2). Clearly, more conserved regions 
of the genome must be analysed to resolve the phylogenetic relationships at 
this higher taxonomic level. 
The phylogenetic tree (Fig. 4)  of the genus Tetranychus is in agreement 
with the morphology. Apart from a slight difference in the shape of the aedea- 
gus, T. mcdanieli and T. pacificus appear to be very similar and display little 
sequence divergence. Although a clear distinction can be made between T. 
urticue and T. turkestani in the shape of the aedeagus, they are morphologi- 
cally and molecularly close. This is in agreement with the geographical origin 
of the species studied: T. urticae and T. turkestani probably originated in Eur- 
asia, while T. mcdanieli and T. pacificus are from North America. In contrast 
however, E. pruni and E. carpini display relatively substantial nucleotide di- 
vergence and are from the same area and appear to be morphologically very 
close, according to conventional criteria, except for a slight difference in the 
shape of the peritreme end. One might therefore wonder whether the system- 
atics of all the Eotetranychus species close to this group should perhaps be 
revised. 
It is interesting to note that while the studied Tetranychus species are poly- 
phagous, the studied Eotetrunychus live on one or only a few plant genera. 
This feature and the sequence analysis above raises the more general question 
of whether specialisation on a host plant can lead to speciation in phytopha- 
gous mites. Our data also raise the question of the reliability of morphological 
characters for the understanding of the evolution of the group. 
RIBOSOMAL DNA SEQUENCES OF SPIDER MITES 217 
Y 
A 
In this study, the DNA from several individuals of each species was pooled 
and the resulting sequence represents the consensus sequence of the species. 
It will subsequently be interesting to analyse the intraspecific variability of 
the DNA fragment studied. 
The sequences of various rDNA domains are becoming available for a wide 
range of organisms. However, the data presented here for several Tetranychi- 
dae species are the first ITS2 sequences studied in mites. We took advantage 
of the conservative fragments of the ribosomal gene to' initiate the examina- 
tion of DNA sequences from taxa about which we have no previous sequence 
information. Our approach provides new features for use in conjunction with 
traditional morphological criteria and with biological features for the assess- 
ment of the systematics and evolution of the group. 
ACKNOWLEDGEMENTS 
The authors thank Dr. Nicole Pasteur (Laboratoire GCnétique et Envi- 
ronnement, Institut des Sciences de l'Evolution, Université Montpellier II) 
for her kind support; Dr. P. Boursot for his useful help in sequences analysis; 
Dr. L. Despres for providing PCR primers and helpful technical comments 
and Dr. M. Raymond for his critical reading of the manuscript. 
REFERENCES 
~ Corpet, F., 1988. Multiple sequence alignment with hierarchical clustering. Nucl. Acids Res., 
Depres, L., Imbert-Establet, D., Combes, C. and Bonhomme, F., 1992. Molecular evidence link- 
ing hominid evolution to recent radiation of Schistosomes (Platyhelminths, Trematodes). 
Mol. Phyl. Evol., in press. 
Dilworth, R.J., Chua, K.Y. and Thomas, W.R., 1991. Sequence analysis of cDNA coding for a 
major house dust mite allergen Der f II. Clin. Exp. Allergy, 21: 25-32. 
Grafton-Cardwell, E.E., Eash, J.A. and Granett, J., 1988. Isozyme differentiation of Tetrany- 
clzus pacificus from T. urticae and T. turkestani (Acari: Tetranychidae) in laboratory and 
field populations. J. Econ. Entomol., 8 1: 770-775. 
Gutierrez, J., Helle, W. and Bolland, H.R., 1970. Etude cytogénétique et réflexions phylogéné- 
tiques sur la famille des Tetranychidae Donnadieu. Acarologia, XII( 4): 732-75 1. 
Gutierrez, J. and Helle, W., 1985. Evolutionary changes in the Tetranychidae. In: W. Helle and 
M.W. Sabelis (Editors), Spider Mites. Their Biology, Natural Enemies and Control, Vol 1A. 
Elsevier, Amsterdam, pp. 91-107. 
Hillis, D.M., 1987. Molecular versus morphological approaches to systematics. Ann. Rev. Ecol. 
Hillis, D.M. and Dixon, M.T., 1991. Ribosomal DNA molecular evolution and phylogenetic 
16: 10881-10889. 
Syst., 18: 23-42. 
inference. Q. Rev. Biol., 66: 41 1-453. 
v Jukes, Y.H. and Cantor, C.R., 1969. Evolution of protein molecules. In: H.N. Munro (Editor), 
'r Mammalian Protein Metabolism. Academic Press, New York, pp. 2 1-32. 
Kim, S.S. and Lee, S.C., 1990. Development of acaricidal resistance esterase isozyme of Tetra- 
?zychus urticae (Acarina: Tetranychidae). Korean J. Appl. Entomol., 29: 170-1 75. 
r 
218 M. NAVAJAS ET AL. 
Miyamoto, M.M. and Cracraft, J., 1992. Phylogenetic analysis of DNA sequences. Oxford Uni- 
versity Press, 400 pp. 
Mullis, K.B. and Faloona, F.A., 1987. Specific synthesis of DNA in vitro via a polymerase- 
catalyzed chain reaction. Methods Enzymol., 155: 335-350. 
Qu, L.H., Nicoloso, M. and Bachellerie, J.P., 1988. Phylogenetic calibration of the 5’ terminal 
domain of large rRNA achieved by determining twenty eucaryotic sequences. J. Mol. Evol., 
Rand, K.N., Moore, T., Sriskantha, A., Spring, K., Tellam, R., Willadsen, P. and Clobon, G.S., 
1989. Cloning and expression of a protective antigen from the cattle tick Boophilus micro- 
plus. Proc. Natl. Acad. Sci. USA, 86: 9657-9661. 
Saiki, R., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and 
Erlich, H.A., 1988. Primer-directed enzymatic amplification of DNA with a thermostable 
DNA polymerase. Science, 239: 487-49 1. 
Sogin, M.L. and Gunclerson, J.H., 1987. Structural diversity of eukaryotic small subunit ribo- 
somal RNAs: evolutionary implications. Endocytobiology III. Ann. N. Y. Acad. Sci., 503: 
Sula, J. and Weyda, F., 1983. Esterase polymorphism in several populations of the two-spotted 
spider mite, Tetrunychus urticue Koch. Experientia, 39: 78-79. 
Tomaiski, M.D. and Miller, L.K., 199 1. Insect paralysis by baculovirus-mediated expression of 
a mite neurotoxin gene. Nature, 352: 82-85. 
Tovey, E.R., Johnson, M.C., Roche, A.L., Cobon, G.S. and Baldo, B.A., 1989. Cloning and 
sequencing of a cDNA expressing a recombinant house dust mite protein that binds human 
IgE and corresponds to an important low molecular weight allergen. J. Exp. Med., 170: 1457- 
1462. 
Ward, P.S., BOUSSY, I.A. and Swincer, D.E., 1982. Electrophoretic detection of enzyme poly- 
morphism and differentiation in three species of spider mites (Tetrunychus) (Acari: Tetra- 
nychidae). Ann. Entomol. Soc. Am., 75: 595-598. 
Yuuki, T., Okumura, Y., Ando, T., Yamakawa, H., Suko, M., Haida, M. and Okudaira, H., 
1991. Cloning and expression of cDNA coding for the major house dust mite allergen Der f 
II in Escherichia coli. Agric. Biol. Chem., 55: 1233-1238. 
28: 113-124. 
125-139. 


Molecular approach in spider mites (Acari : Tetranychidae) : preliminary data on ribosomal DNA sequences

Abstract

Similar works

Full text

Available Versions

Horizon / Pleins textes