Incorporation of non-natural amino acids into proteins in vivo expands the scope of protein synthesis and design. p-Acetylphenylalanine was incorporated into recombinant dihydrofolate reductase (DHFR) in Escherichia coli via a computationally designed mutant form of the phenylalanyl-tRNA synthetase of the host. DHFR outfitted with ketone functionality can be chemoselectively ligated with hydrazide reagents under mild conditions

Carrico, Isaac S.

Datta, Deepshikha

Mayo, Stephen L.

Tirrell, David A.

Wang, Pin

English

Caltech Authors - Main

 S1
Supporting Information: JA0177096 
 
Plasmid Construction 
 
E. coli pheS* was amplified by the polymerase chain reaction (PCR) from vector 
pQE-FS.  Amplified pheS* was subjected to PCR mutagenesis to create the coding 
sequence for the desired Thr251Gly mutant, which we designate pheS**.  To allow 
constitutive expression of the synthetase, a linker encoding a tac promoter with an 
abolished lac repressor binding site was prepared with terminal NheI restriction sites and 
internal NcoI and HindIII sites.  The linker sequence is  
5’CTAGCAGTTGACAATTAATCATCGGCTCGTATAATGGATCGAATTGT
GAGCGGAATCGATTTTCACACAGGAAACAGACCATGGATCTTCGTCGCCATC
CTCGGGTCGACGTCTGTTTGCAAGCTTG-3’  
(the –35 and –10 sequences are underlined and start codon is in bold).  This linker was 
cloned into the NheI site of vector pET5a (Novagen) to form pET5a-tac.  PCR amplified 
fragments containing pheS* and pheS** were cloned into pET5a-tac at the NcoI and 
HindIII sites. pheS* and pheS** outfitted with the tac promoter were cut out as NheI 
fragments and inserted into expression plasmid pQE15 (Qiagen) to yield pQE-FS* and 
pQE-FS** respectively. Expression plasmids pQE15, pQE-FS* and pQE-FS** encode 
murine dihydrofolate reductase (mDHFR) under control of a bacteriophage T5 promoter.     
 
Determination of Translational Activity 
 
Buffer and media were prepared according to standard protocols.  A 
phenylalanine auxotrophic derivative of E. coli strain BL21(DE3), designated AF (HsdS 
gal (λcIts857 ind 1 Sam7 nin5 lacUV5-T7 gene 1) pheA) and constructed in our 
laboratory, was used as the expression host.  The AF strain was transformed with 
repressor plasmid pLysS-IQ and with pQE15, pQE-FS* or pQE-FS** to afford 
expression strains AF-IQ[pQE15], AF-IQ[pQE-FS*] or AF-IQ[pQE-FS**] respectively.        
Small scale (10 ml) cultures were used to investigate the in vivo translational 
activity of 2.  M9 minimal medium (50 ml) supplemented with 0.2 % glucose, 1mg/L 
thiamine, 1 mM MgSO4, 0.1 mM CaCl2, 19 amino acids (at 20 mg/L), antibiotics 
(ampicillin 200 mg/L, chloramphenicol 35 mg/L) and phenylalanine (at 20 mg/L) was 
inoculated with 1 ml of an overnight culture of the expression strain.  When the optical 
density at 600 nm reached 0.8-1.0, a medium shift was performed.  Cells were 
sedimented by centrifugation for 15 min at 3100g at 4 oC, the supernatant was removed 
and the cell pellets were washed twice with 0.9% NaCl.  Cells were resuspended in 
supplemented M9 medium containing either: (a) 250 mg/L 2, (b) 20 mg/L phe (1) 
(positive control), (c) no phe or analog (negative control).  Protein expression was 
induced 10 min after the medium shift by addition of isopropyl-β-D-thiogalactoside 
(IPTG) to a final concentration of 1 mM.  Cells were cultured for 4 hours post-induction 
and protein expression was monitored by SDS polyacrylamide gel electrophoresis (PAGE, 
12 %), using a normalized OD600 of 0.2 per sample.   
 
  
Protein Purification   
 S2
 
mDHFR as expressed in this work contains an N-terminal hexahistidine sequence, 
which was utilized to purify the protein by nickel affinity chromatography with stepwise 
pH gradient elution under denaturing conditions according to the recommendations of the 
supplier (Qiagen).  The eluted protein was buffer-exchanged (Millipore, MWCO=5 kDa) 
against distilled water three times and the purified protein was subjected to matrix-
assisted laser desorption ionization mass spectrometry (MALDI-MS) analysis. 
 
Tryptic Peptide Analysis   
 
10 µl of purified protein in elution buffer (8 M urea, 100 mM NaH2PO4, 10 mM 
Tris, pH=4.5) was mixed with 90 µl 75 mM NH4OAc, to which 2 µL of modified trypsin 
(Promega, 0.2 µg/µL) was added.  The solution was allowed to digest overnight at room 
temperature.  The reaction was quenched by addition of trifluoroacetic acid to pH < 4.0.  
The digest was subjected to sample clean-up by using a ZipTipC18, which provided 2 µl 
of purified sample solution.  10 µl of the MALDI matrix (α-cyano-β-hydroxycinnamic 
acid, 10 mg/ml in 50% CH3CN) was added, and 0.5 µl of the resulting solution was 
spotted directly onto the sample plate. Samples were analyzed in the linear mode on an 
Applied Biosystems Voyager DE Pro MALDI-TOF mass spectrometer.    
 
Chemical Modification of Protein 
 
 Purified proteins (mDHFR-wt and mDHFR-2) were dissolved in 200 µl of PBS 
buffer (pH=6.0) and added to 20 µl of 5mM biotin hydrazide (BH, dissolved in PBS).  
Protein/BH mixtures were incubated at room temperature for 1 to 1.5 h. Reaction 
solutions were then washed twice with distilled water using a buffer-exchange column 
(Millipore, MWCO=5 kDa).  Standard western blotting procedures were used to identify 
proteins modified with BH as well as those bearing an N-terminal hexahistidine tag.  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 21717.2                            26499.6 21717.2                            26499.6 
mDHFR-wt 
24045.29 
24349.05 
mDHFR-2 
Figure 1:  Matrix-assisted laser desorption ionization mass spectrometry (MALDI-
MS) of purified proteins. 
 S3
 
 
 
 
 
 
 
(a) 
(b) 
(c)  
Figure 2: Active sites in 
tPheRS/Phe. Protein 
residues are shown as stick 
models and the substrate 
Phe is shown as a ball-and-
stick model. Yellow protein
residues are involved in 
hydrophobic interactions
with the substrate. (a) wild 
type; (b) A314G mutant; (c) 
T261G/A314G mutant. 
Ala314 
Val261 
Gly314 
Val261 
Gly314 
Gly261 


A designed phenylalanyl-tRNA synthetase variant allows efficient in vivo incorporation of aryl ketone functionality into proteins

A Designed Phenylalanyl-tRNA Synthetase Variant Allows Efficient in Vivo
Incorporation of Aryl Ketone Functionality into Proteins
Deepshikha Datta, Pin Wang, Isaac S. Carrico, Stephen L. Mayo, and David A. Tirrell*
DiVision of Chemistry and Chemical Engineering, Howard Hughes Medical Institute, DiVision of Biology,
Biochemistry Option, California Institute of Technology, Pasadena, California 91125
Received December 7, 2001
Protein engineering is a powerful tool for modification of the
structural, catalytic, and binding properties of natural proteins and
for the de novo design of artificial proteins. Although amino acid
replacement is normally limited to the 20 proteinogenic amino acids,
it is becoming increasingly clear that incorporation of non-natural
amino acids can extend the scope and impact of protein engineering
methods.1
We have previously exploited the ability of auxotrophic Es-
cherichia coli strains to effect efficient incorporation of amino acid
analogues into proteins in a multisite fashion. The method is simple
and produces high protein yields, and incorporation of the analogue
at multiple sites offers significant advantages with respect to control
of protein properties such as thermal and chemical stability.2
In this study, we report a computationally designed variant of
the E. coli phenylalanyl-tRNA synthetase (ePheRS), which allows
efficient in vivo incorporation of aryl ketone functionality into
proteins. In 1991, Kast and co-workers3 introduced a variant of
ePheRS (termed ePheRS*), which bears an Ala294Gly mutation
in the R-subunit and which thereby acquires relaxed substrate
specificity. We have recently shown that overexpression of ePheRS*
can be exploited to effect efficient incorporation of p-bromo-,
p-iodo-, p-ethynyl-, p-cyano-, and p-azidophenylalanines into
recombinant proteins in E. coli hosts.4,5 But similar experiments
with p-acetylphenylalanine (2) failed; even in a host in which
ePheRS* was overexpressed, phe-depleted cultures supplemented
with 2 did not produce substantial yields of protein (Figure 1).
Our interest in 2 arises from the chemical versatility of the side-
chain ketone function, which can be chemoselectively ligated with
hydrazide, hydroxylamino, and thiosemicarbazide reagents under
physiological conditions.6,7 Cornish and co-workers have ac-
complished site-specific incorporation of ketone functionality into
recombinant proteins via in vitro translation;8 however, we are
unaware of previous reports of in vivo methods of introducing
ketone functionality into recombinant proteins.
We sought ePheRS mutants that would allow efficient incorpora-
tion of 2 into recombinant proteins in vivo. The crystal structure
of Thermus thermophilus PheRS (tPheRS) complexed with 1 is
available9 and there is 43% overall sequence identity between
ePheRS and tPheRS; sequence identity in the identified active site
region is 80%. We therefore employed a previously described
protein design algorithm10 to identify potentially useful mutants of
tPheRS, with the intention to prepare and evaluate the corresponding
mutant forms of ePheRS. We generated a backbone-independent
rotamer library for 2, in which both the ł1 and ł2 torsional angles
were varied by (20° (in increments of 5°) from the values of 1 in
the tPheRS structure. Design calculations were performed by fixing
the identity of the substrate (2) and by allowing each of 11 non-
anchor sites in the amino acid binding pocket of tPheRS (determined
from the crystal structure) to be occupied by any of the 20 natural
amino acids except for proline, methionine, and cysteine. The
anchor residues (Glu128, Glu130, Trp149, His178, Ser180, Gln183,
and Arg204) were held fixed in identity and conformation in all
calculations. These residues contribute important electrostatic
interactions with the substrate and it is reasonable to assume that
such interactions are equally critical for the binding of 2.
The calculations identified two important cavity-forming muta-
tions: Val261 (Thr251 in E. coli) to Gly, and Ala314 (Ala294 in
E. coli) to Gly. These predictions are consistent with the results of
Reshetnikova and co-workers,9 who pointed out that Ala314 and
Val261 hinder the binding of amino acids larger than phe (e.g.,
tyrosine) into the active site of tPheRS. Further confidence in the
prediction was engendered by the fact that the Ala294Gly mutant
allows incorporation of an interesting set of para-substituted
phenylalanines, as described earlier.4,5 We were thus encouraged
to test whether the additional Thr251Gly mutation would relax the
specificity of ePheRS* sufficiently to allow incorporation of 2 into
proteins in vivo.
E. coli pheS* (which encodes ePheRS*) was amplified by the
polymerase chain reaction (PCR) from vector pQE-FS.4 Amplified
pheS* was subjected to PCR mutagenesis to create the coding
sequence for the desired Thr251Gly mutant, which we designate
pheS**. To allow constitutive expression of the synthetase, a tac
promoter with an abolished lac repressor binding site was inserted
upstream of the start codon of pheS**.11 The expression cassette
was then cloned into pQE15 (Qiagen), which encodes the marker
protein mouse dihydrofolate reductase (mDHFR). The resulting
plasmid was designated pQE-FS**. As a control, plasmid pQE-
FS* (which contained pheS* under control of a constitutive tac
promoter) was constructed similarly. AF-IQ, a phenylalanine* Corresponding author. E-mail: tirrell@caltech.edu.
Figure 1. SDS-PAGE of cell lysates of 4 h post-induction with 1 mM
IPTG. Expression plasmids and amino acid supplements are indicated. The
concentration of 1 is 20 mg/L and that of 2 is 250 mg/L. Lane M: molecular
weight marker (36.5, 31, 21.5, 14.4 kDa).
BATCH: ja5e62 USER: kan69 DIV: @xyv04/data1/CLS_pj/GRP_ja/JOB_i20/DIV_ja0177096 DATE: May 1, 2002
Published on Web 04/26/2002
5652 9 J. AM. CHEM. SOC. 2002, 124, 5652-5653 10.1021/ja0177096 CCC: $22.00 © 2002 American Chemical Society
auxotrophic E. coli strain carrying the repressor plasmid pLysS-
IQ,4 was transformed with pQE15, pQE-FS*, or pQE-FS** to
generate expression systems AF-IQ[pQE15], AF-IQ[pQE-FS*], and
AF-IQ[pQE-FS**], respectively. The capacity of 2 to support pro-
tein synthesis in each expression system was determined by induc-
tion of mDHFR expression in phenylalanine-free minimal media
supplemented with 2. As shown in SDS-PAGE analysis of whole
cell lysates (Figure 1), neither AF-IQ[pQE15] nor AF-IQ[pQE-
FS*] exhibits protein expression above background (-phe) in media
supplemented with 2.12 In contrast, similarly supplemented cultures
of AF-IQ[pQE-FS**] yield high levels of mDHFR expression. The
histidine-tagged protein from the latter culture (mDHFR-2) was
purified in a yield of about 20 mg/L, approximately 60% of that
obtained from cultures supplemented with 1. MALDI-TOF mass
spectrometry showed that the mass of mDHFR-2 was increased
by 304 Da, which corresponds to approximately 80% replacement
of 1 by 2 (mDHFR contains 9 phe residues). Incorporation of 2
was confirmed by tryptic digestion of mDHFR-2 (Figure 2). For
mDHFR, two peptides in the mass range 1550-1750 Da were
assigned to residues 34-47 and 93-106, respectively (Figure 2a).
Each fragment contains a single phe residue. The corresponding
fragments of mDHFR-2 (Figure 2b) were shifted up in mass by 42
Da, consistent with the increased mass of 2 relative to 1.13
We have completed preliminary studies of the reactivity of
mDHFR-2 toward hydrazide reagents. Purified mDHFR and
mDHFR-2 were dissolved in PBS buffer (pH 6.0) and treated either
with 5 mM biotin hydrazide (BH) or with PBS buffer as a negative
control. The reaction products were analyzed by western blotting
and visualized by treatment with a biotin-specific streptavidin-HRP
conjugate (Figure 3). The products were also examined for the
presence of the 6His tag of mDHFR to ensure the identity of the
protein band and to probe the possibility of chain cleavage under
the ligation conditions. The results are consistent with chemo-
selective ligation without chain cleavage (Figure 3b).
In conclusion, we describe here a new mutant form of the E.
coli phenylalanyl-tRNA synthetase, which allows efficient in vivo
incorporation of reactive aryl ketone functionality into recombinant
proteins. This study also demonstrates the power of computational
protein design in the development of aminoacyl-tRNA synthetases
for activation and charging of non-natural amino acids.
Acknowledgment. The authors thank William A. Goddard III,
Nagarajan Vaidehi, Kent Kirshenbaum, and Yi Tang for helpful
discussions. This work was supported by NIH Grants R01-
GM62523 and T32-GM08501, the NSF Center for the Science and
Engineering of Materials at Caltech, the Howard Hughes Medical
Institute, the Ralph M. Parsons Foundation, and an IBM shared
University Research Grant.
Supporting Information Available: MALDI-MS for proteins and
details of experimental procedures (PDF). This material is available
free of charge via the Internet at http://pubs.acs.org.
References
(1) (a) Dougherty, D. A. Curr. Opin. Chem. Biol. 2000, 4, 645-652. (b)
Minks, C.; Alefelder, S.; Moroder, L.; Huber, R.; Budisa, N. Tetrahedron
2000, 56, 9431-9442. (c) Behrens, C.; Nielsen, J. N.; Fan, X. J.; Doisy,
X.; Kim, K. H.; Praetorius-Ibba, M.; Nielsen, P. E.; Ibba, M. Tetrahedron
2000, 56, 9443-9449.
(2) (a) Tang, Y.; Giovanna, G.; Petka, W. A.; Nakajima, T.; DeGrado, W.
F.; Tirrell, D. A. Angew. Chem., Int. Ed. Engl. 2001, 40, 1494-1496. (b)
We recognize that multisite incorporation of amino acid analogues may
in some cases result in protein misfolding and loss of function.
(3) (a) Ibba, M.; Hennecke, H. FEBS Lett. 1995, 364, 272-275. (b) Ibba,
M.; Kast, P.; Hennecke, H. Biochemistry 1994, 33, 7107-7112. (c) Kast,
P.; Hennecke, H. J. Mol. Biol. 1991, 222, 99-124.
(4) Sharma, N.; Furter, R.; Tirrell, D. A. FEBS Lett. 2000, 467, 37-40.
(5) Kirshenbaum, K.; Carrico, I. S.; Tirrell, D. A. Chem. BioChem. 2001, in
press.
(6) (a) Rose, K. J. Am. Chem. Soc. 1994, 116, 30-33. (b) Canne, L. E.; Ferre-
DAmare, S. K.; Burley, S. B. H. J. Am. Chem. Soc. 1995, 117, 2998-
3007. (c) Rideout, D.; Calogeropoulou, T. Biopolymers 1990, 29, 247-
262. (d) Rideout, D. Cancer InVest. 1994, 12, 189-202. (e) Shao, J.; Tam,
J. P. J. Am. Chem. Soc. 1995, 117, 3893-3899.
(7) (a) Mahal, L. K.; Yarema, K. J.; Bertozzi, C. R. Science 1997, 276, 1125-
1128. (b) Yarema, K. J.; Mahal, L. K.; Bruehl, R. E.; Rodriguez, E. C.;
Bertozzi, C. R. J. Biol. Chem. 1998, 273, 31168-31179.
(8) Cornish, V. W.; Hahn, K. M.; Schultz, P. G. J. Am. Chem. Soc. 1996,
118, 8150-8151.
(9) (a) Reshetnikova, L.; Moor, N.; Lavrik, O.; Vassylyev, D. G. J. Mol. Biol.
1999, 287, 555-568. (b) Fishman, R.; Ankilova, V.; Moor, N.; Safro, M.
Acta Crystallogr. 2001, D57, 1534-1544.
(10) Dahiyat, B. I.; Mayo, S. L. Science 1997, 278, 82-87.
(11) Furter, R. Protein Sci. 1998, 7, 419-426.
(12) Phe starvation does not completely eliminate background expression,
presumably because of incomplete depletion of the cellular pool of phe.
(13) The enhanced promiscuity of ePheRS** allows misincorporation of
tryptophan under phe starvation conditions in the absence of 2. In media
supplemented with 2 there is no detectable misincorporation of any of
the canonical amino acids. We have not observed misincorporation of
tyrosine under any conditions.
JA0177096
Figure 2. MALDI TOF mass spectra of tryptic peptides digested from
mDHFR expressed in media supplemented with 1 (a) or 2 (b).
Figure 3. Western blot showing chemoselective modification of ketone
functionality in mDHFR. (a) Modified protein was treated with biotin
hydrazide (BH), stained with HRP conjugated streptavidin, and analyzed
by western blot. (b) Western blot analysis of the products. Lane 1: mDHFR-
wt + buffer. Lane 2: mDHFR-2 + buffer. Lane 3: mDHFR-wt + BH.
Lane 4: mDHFR-2 + BH.
BATCH: ja5e62 USER: kan69 DIV: @xyv04/data1/CLS_pj/GRP_ja/JOB_i20/DIV_ja0177096 DATE: May 1, 2002
C O M M U N I C A T I O N S
J. AM. CHEM. SOC. 9 VOL. 124, NO. 20, 2002 5653


(b) We recognize that multisite incorporation of amino acid analogues may in some cases result in protein misfolding and loss of function.

Phe starvation does not completely eliminate background expression, presumably because of incomplete depletion of the cellular pool of phe.

http://authors.library.caltech.edu/24112/1/Datta_2002_J_Am_Chem_Soc_A_designed_phenylalanyl-tRNA_synthetase_variant.pdf

A designed phenylalanyl-tRNA synthetase variant allows efficient in vivo incorporation of aryl ketone functionality into proteins

Abstract

Similar works

Full text

Available Versions

Caltech Authors - Main

Caltech Authors - Main