Bacterial hazards are the major concern in the production of food of animal origin. Clostridium perfringens is a common cause of food-borne illness. The illness is characterized by profuse diarrhea and acute abdominal pain. At this study 30 carcass swabs from dorsal area and 30 fecal samples from a swine abattoir were analyzed over C. perfringens presence

Almeida, Renata R.

Fereirra, Antônio J. P.

Ferreira, Thais S. P.

Gobbi, Débora D. S.

Gomes, Cleise R.

Moreno, Andrea M.

Paixão, Renata

Zucon, Luciane T. S.

English

Bacterial hazards are the major concern in the production of food of animal origin. Clostridium perfringens is a common cause of food-borne illness. The illness is characterized by profuse diarrhea and acute abdominal pain. At this study 30 carcass swabs from dorsal area and 30 fecal samples from a swine abattoir were analyzed over C. perfringens presence.</p

Moreno, Andrea

Ferreira, Thais

Almeida, Renata

Zucon, Luciane

Gobbi, Débora

Gomes, Cleise

Fereirra, Antônio

Digital Repository @ Iowa State University (ISU)

POSTERPRESENTATIONS251SafePork 2005ISOLATION OF CLOSTRIDIUM PERFRINGENS FROMSWINE CARCASSES AND FECESAndrea M. Moreno*, Thais S. P. Ferreira, Renata R. Almeida, Luciane T. S. Zucon, RenataPaixão, Débora D. S. Gobbi, Cleise R. Gomes, Antônio J. P. FerreiraFaculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo,  Av. Prof. Dr. Orlando Marques de Paiva, n.87, CEP05508000. São Paulo, SP, Brasil. *E-mail: morenoam@uol.com.br.Abstract Bacterial hazards are the major concern in the production of food of animal origin.Clostridium perfringens is a common cause of food-borne illness. The illness is characterized byprofuse diarrhea and acute abdominal pain. At this study 30 carcass swabs from dorsal area and30 fecal samples from a swine abattoir were analyzed over C. perfringens presence. The frequen-cy of agent in carcasses was 40% and in fecal samples 73.2%. The forty-seven isolated strainswere characterized by PCR for the presence of genes codifying the enterotoxin, alpha, beta,epsilon, iota and beta-2 toxins. All strains were positive for presence of alpha and beta 2 toxingene, and were classified as type A. None were positive to enterotoxin gene through PCR. Singleenzyme amplified fragment length polymorphism (SE-AFLP) analyses were used to characterize47 C. perfringens strains and revealed two common profiles among fecal and carcass strains.Introduction Clostridium perfringens is the etiologic agent of multiple syndromes in domesticanimals, some of the most important conditions that producers and veterinary practitioners haveto face (Songer, 1998; Klaasen, 1999). The various toxins produced by the bacteria play key rolesin the pathogenesis of the disease and are divided into five biotypes, designated A through E,based on the production of alpha- (a-), beta- (b-), epsilon- (S-), and iota- (i-) toxins. The a-toxin isproduced by all types, b-toxin is produced by type B and C strains, S-toxin is produced by type Band D strains, and i-toxin is produced by type E strains (Garmory et al., 2000). Different biotypesof C. perfringens are associated with different diseases. Type A enterotoxigenic strains are a com-mon cause of food poisoning outbreaks worldwide. Type C, is generally considered to be the pri-mary cause of necrotic enteritis in piglets. In addition to the major toxins, other toxins may play arole in disease (Garmony et al., 2000). A novel toxin produced by C. perfringens, named beta 2-(b2) toxin, has recently been identified and its encoding gene characterized. The occurrence of C. perfringens in swine carcass at slaughter is not reported in Brazil. Thegenotyping of these isolates may lead to a better understanding of the potential of this agent tocontaminate pork meat and cause outbreaks in humans.Single enzyme AFLP (SE-AFLP) has previously been used for the differentiation of Clostridiumperfringens and others agents as Pasteurella multocida to strain level (McLauchlin et al, 2000;Moreno et al, 2003).The objectives of this trial are to isolate C. perfringens from carcass swabs and swine feces atabattoir, characterize the strains in relation to the presence of enterotoxin, alpha, beta, epsilon,iota and beta-2 toxins genes using polymerase chain reaction (PCR) and analyze the strainsthrough the SE-AFLP technique.Materials and Methods A total of 30 carcass swabs from dorsal area and 30 fecal samples fromone swine abattoir were analyzed. A sample of 5 g of feces and the carcass swabs were submit-ted to enrichment in 25 ml of liquid thioglycolate medium and cultured overnight under anaerobiccondition. After that, the culture was streaked in TSC agar under anaerobic condition. The suspectcolonies were identified by the use of Gram stains, lecithinase and lipase reaction in egg-yolk agarand presence of storm clout in Litmus milk. The colonies of C. perfringens were cultured in 10 ml of thioglycolate broth for 24 hr at 37°C.The DNA extraction was conducted with 200 µl of bacterial culture treated with Lysozyme (140µl of100mg/ml) and Proteinase K (40µl of 20 mg/ml) for 1 hour at 37°C. The bacterial lysates were sub-mitted to DNA purification with the guanidium thiocyanate method described by Pitcher et al. (1989).PCR assays were performed using specific primers the toxin genes (alpha, beta, beta2,epsilon, iota and enterotoxin) as described elsewhere (Moreno, 2003). Reference strains C. per-fringens type A (ATCC 3624), type C (ATCC 3628), type B (ATCC 3626) and type D (ATCC 3629)were kindly supplied by Instituto Biológico de São Paulo, and were used as positive controls.To SE-AFLP technique an aliquot containing 10µg of DNA was digested overnight (16 h) at POSTERPRESENTATIONS252 SafePork 200537°C with 24 U of HindIII (Life Technologies) in the buffer provided with the enzyme and ultra purewater in a final volume of 20 µl. A 5 Ìl aliquot containing the digested DNA was used in a ligationreaction containing 0.2 µg of each adapter oligonucleotide (ADH1- 5´ ACGGTATGCGACAG 3´andADH2- 3´ GAGTGCCATACGCTGTCTCGA 5´), 1U of T4 DNA ligase, ligase buffer, and water, in afinal volume of 20 µl incubated at room temperature for 3 h. Ligated DNA was heated to 80°C for10 min, diluted 1/5 in sterile distilled water, and 5 µl were used for each PCR reaction.PCR reactions were performed in 50 µl final volumes and contained: 5 µl of ligated DNA, 2.5mM MgCl2, 300 ng of primer HIG- 5´GGTATGCGACAGAGCTTG 3´ and 1.25 U of Taq DNA poly-merase in 1 X PCR buffer. The mixture was subjected to an initial denaturing step of 94°C for 4min, followed by 35 cycles of 94°C for 1 min, 60°C for 1 min, and 72°C for 2.5 min. The amplified products were analyzed on a 2.0% agarose gel, stained with ethidium bromide(0.5 mg/ml), observed by UV transilumination, and registered by an image capturing system. A100 bp DNA ladder was included twice on each electrophoresis gel. Banding patterns wereassessed visually, considering only strong and moderately stained fragments. Results The bacteriological examination of 30 carcasses swabs revealed 12 positive to C. perfin-gens isolation (40%) and twenty-two fecal samples showed positive results (73.2%). From positive carcasses swabs and fecal samples were selected 47 strains of C. perfringensto toxin characterization. All strains were positive for presence of alpha and beta 2 toxin gene, andwere classified as type A. None were positive to enterotoxin gene through PCR. Using SE-AFLP, each culture generated one to five DNA fragments ranging between approxi-mately 400 -1750 bp. Among the 47 cultures tested, 18 SE-AFLP profiles were observed, whichvaried by one or more bands from all other patterns (Figure 1 and 2). Two identical profiles werepresent in samples from carcass and fecal strains. Fecal strains presented a high genetic hetero-geneity when compared with carcass strains. Discussion Swine slaughter is an open process with many opportunities for the contamination ofthe pork carcass with potentially pathogenic bacteria; however it does not contain any point werethe hazards are completely eliminated. The major contamination points during swine slaughter arepig-related, such as fecal and pharyngeal, and environmental (Borch 1996). The high occurrence of C. perfringens on feces (73.2%) are expected, since the agent is acomponent of intestinal micro biota, but the frequency of this agent in carcass was higher thanexpected in this first trial (40%). In Japan, a study with 50 pork meat samples showed that 12%were positive to C. perfringens, but none of isolates were positive to enterotoxin presence(Miwa, 1998). At present study enterotoxin positive isolates of C. perfringens were not found too.The AFLP technique showed results comparable with all other molecular typing methodsdescribed to analyze C. perfringens strains, and appears to have several advantages in terms ofbeing easy to perform, rapid, discriminatory, cheap and highly reproducible. The strains observedin carcass swabs presented less genetic heterogeneity than that isolated from feces. The pres-ence C. perfringens with identical profiles in carcass and feces confirm the potential of fecal con-tamination of carcass during slaughter process. The absence of enterotoxin positive strains among the isolates studied suggest a low risk ofhuman infections from carcass contamination, but a constant monitoring of this agent must bedone, considering the high percentage of it detection at the samples analyzed. Acknowledgements This study was supported by FAPESP -Fundação de Amparo a Pesquisa doEstado de São Paulo (grant # 03/01654-3).ReferencesBellaver, C., 2001. Ingredientes de origem animal destinados à fabricação de rações. In: Simpósio sobre ingredientes na ali-mentação animal, Campinas, SP. Anais...Campinas: CBNA 167-190Borch, E., Nesbakken, T., Christensen, H., 1996. Hazard identification in swine slaugther with respect to foodborne bacteria.Int J Food Microbiol 30:9-25Garmory, H.S.; Chanter, N.; French, N.P. Bueschel, D.; Songer, J.G.; Titball, R.W. 2000. Occurrence of Clostridium perfringensbeta-2 toxin amongst animals, determined using genotyping and subtyping PCR assays. Epidemiol. Infect. 124:61- 67.POSTERPRESENTATIONS253SafePork 2005Klaasen, L.B.M.H., Molkenboer, M.J.C.H., Bakker, J., Misrez, R., Hani, H., Frey, J., Popoff, M.R., Van Den Bosch, J., 1999.Detection of the beta-2 toxin gene of Clostridium perfringens in diarrhoeic piglets in the Netherlands and Switzerland. FEMSImmunol Med  Microbiol 24: 325-332Mclauchlin, J., Ripabelli, G., Brett, M.M., Threlfall, E.J., 2000. Amplified fragment length polymorphism (AFLP) analysis ofClostridium perfringens for epidemiological typing. Int J Food Microbiol, 56: 21-28Miwa N., Nishina T., Kubo S., Atsumi M., Honda H. 1998 Amount of enterotoxigenic Clostridium perfringens in meat detectedby nested PCR Int J Food Microbiol 42: 195–200Moreno, A.M., Baccaro, M.R., Ferreira, A. J. P.;Pestana de Castro, A. F. 2003.Use of single-enzyme amplified length polymor-phism for typing Pasteurella multocida subsp. multocida isolates from pigs. J. Clin. Microbiol., 41:1743-1746.Moreno, A.M., Baccaro, M.R., Ferreira, A.J.P., Hirose, F.H., Campos, D.S., 2003. Detection of the beta-2 toxin gene fromClostridium perfringens isolated in diarrheic piglets. Arq Inst Biol, São Paulo 70: 155-158Pitcher, D. G.; Saunders, N. A.; Owen, R. J. 1989. Rapid extraction of bacterial genomic DNA with guanidium thiocyanate.Letters Applied Microbiology., 8:151-156.Songer, J.G., Glock, R.D., 1998. Enteric infection of swine with Clostridium perfringens types A and C. Swine Health and pro-duction  6:223-225Figure 1 - Electrophoresis in agarose gel. SE-AFLP pro-files of Clostridium perfringens produced by primer HIG.Lanes 1 and 24, 100bp molecular weight standard. Theremaining lanes show AFLP profiles of 20 C. perfringensstrains isolated from swine carcass swabs.

Isolation of Clostridium perfringens from swine carcasses and feces

Crossref

https://lib.dr.iastate.edu/cgi/viewcontent.cgi?article=1590&amp;context=safepork

Isolation of Clostridium perfringens from swine carcasses and feces

Abstract

Similar works

Full text

Available Versions

Digital Repository @ Iowa State University (ISU)

Crossref