Free PMC Article: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5466580/Histoplasmosis is a systemic mycosis caused by Histoplasma capsulatum. Rare in Europe but endemic in some regions of Brazil, United States, Africa and Asia. Most of the cases are asymptomatic. Disseminated form is defined by the presence of an extra-pulmonary focus, particularly associated with immunosuppression. We report a case of an unilateral persisted tonsillar ulceration, in an immunocompetent Portuguese host, as manifestation of disseminated African histoplasmosis 45 years later after living 3 years in Africa.info:eu-repo/semantics/publishedVersio

Cardoso, L.

Silva, C.

Marques, N.

Veríssimo, Cristina

Medical Mycology Case Reports

CITATION: Froeschke, G. & Matthee, S. 2014. Landscape characteristics influence helminth
infestations in a peri-domestic rodent - implications
for possible zoonotic disease. Parasites & Vectors, 7:393  doi:10.1186/1756-3305-7-393.The original publication is available at http://www.parasitesandvectors.com/content/7/1/393Publication of this article was funded by the Stellenbosch University Open Access Fund.Background
Anthropogenic habitat change often results in altered landscapes that can provide new environments where hosts, parasites and pathogens can interact. The latter can have implications for human and animal health when in close proximity to developed areas. We recorded the helminth species richness and level of infestation in the peri-domestic rodent, Rhabdomys pumilio, in three different human linked landscapes. The aim was, to investigate the potential of R. pumilio to act as a reservoir host for zoonotic helminths and to compare the effect of anthropogenic habitat change on its parasite infestation patterns.
				
				
					
						Methods
					
					Rodents (n&#8201;=&#8201;518) were trapped in natural areas (nature reserves) and in three human linked landscapes (crop, livestock and urban fragments). Gastrointestinal parasite burdens were recovered and helminths identified from each animal. Generalized linear models were applied to investigate the effect of different landscape types on helminth infestation.
				
				
					
						Results
					
					
						Rhabdomys pumilio was the most abundant rodent species within each landscape type. Eight helminths species were recovered and overall helminth prevalence was 86.68%. Mean helminth species richness, prevalence and abundance were significantly higher in crop fragments compared to natural landscapes and overall lower for nematodes in livestock and urban areas. Cestode prevalence showed a tendency to be elevated at anthropogenic linked landscape types.
				
				
					
						Conclusions
					
					Host parameters and parasite infestations were strongly influenced by landscape characteristics. Resource-rich landscapes (crop fragments) provide favorable conditions for helminth infestations, while landscapes that are more closely associated with humans (livestock and urban landscapes) pose a larger risk by zoonotic species.Publishers' versio

Froeschke, Gotz

Matthee, Sonja

Stellenbosch University SUNScholar Repository

Landscape characteristics influence helminth infestations in a peri-domestic rodent - implications for possible zoonotic disease

Scientific Repository of the National Health Institute Doutor Ricardo Jorge

Tonsillar ulceration as manifestation of disseminated African histoplasmosis in an immunocompetent Portuguese host

Repositório Científico do Instituto Nacional de Saúde

Contents lists available at ScienceDirectMedical Mycology Case Reportsjournal homepage: www.elsevier.com/locate/mmcrTonsillar ulceration as manifestation of disseminated African histoplasmosisin an immunocompetent Portuguese hostL. Cardosoa,⁎, C. Silvaa, N. Marquesb, C. Veríssimoca Department of Otolaryngology, Centro Hospitalar e Universitário de Coimbra, 3000-075 Coimbra, Portugalb Department of Infectious Diseases, Centro Hospitalar e Universitário de Coimbra, 3000-075 Coimbra, Portugalc Department of Parasitology and Mycology, Instituto Nacional de Saúde Doutor. Ricardo Jorge, 1600 Lisboa, PortugalA R T I C L E I N F OKeywords:HistoplasmosisTonsillarUlcerationDisseminatedDuboisiiPortugueseA B S T R A C THistoplasmosis is a systemic mycosis caused by Histoplasma capsulatum. Rare in Europe but endemic in someregions of Brazil, United States, Africa and Asia. Most of the cases are asymptomatic. Disseminated form isdeﬁned by the presence of an extra-pulmonary focus, particularly associated with immunosuppression. We re-port a case of an unilateral persisted tonsillar ulceration, in an immunocompetent Portuguese host, as mani-festation of disseminated African histoplasmosis 45 years later after living 3 years in Africa.1. IntroductionHistoplasmosis is a systemic mycosis caused by Histoplasma capsu-latum, a dimorphic fungus, ﬁrst described in 1906 by Samuel Darling inPanama [1,2]. It has been isolated from soil contaminated with bird orbat droppings in endemic areas such as Brazil, North/Central of UnitedStates, central/western Africa and parts of Asia; it´s rare in Europe andfrequently associated with patients from endemic areas who seek carein Europe or visited those countries in the past [3–8]. There are twovarieties of H. capsulatum that are pathogenic to humans: H. capsulatumvar. capsulatum and H. var. capsulatum duboisii. Less common, H. cap-sulatum var. duboisii is the etiologic cause for African histoplasmosis[3,5]. In var. capsulatum, most of the cases are asymptomatic, and thosewith symptoms usually present with self-limited respiratory infection.Variety duboisii has tropism for lymph nodes, skin, and bones and isclassically associated with cutaneous lesions (nodules, ulcers) and os-teolytic bone lesions, especially aﬀecting the skull, ribs, and vertebrae[6]. The disseminated form is deﬁned by the presence of an extra-pulmonary focus, particularly on those with risk factors: im-munosuppression, transplantation, chronic renal disease, prolonged useof corticosteroids and acquired immune deﬁciency syndrome [7,9]. Onethird of disseminated disease presented oropharyngeal involvement.The most common sites are tongue, palate and buccal mucosa [2]. Wereport a rare case of a disseminated African histoplasmosis in an im-munocompetent Portuguese host presented with unilateral tonsillarulceration and large inguinal lymphadenopathy 45 years after living inAfrica.2. CaseA 68 years-old Caucasian Portuguese male, presented at day 0 in theotorhinolaryngology emergency department with 2 months’ sore throat,loss of weight (5 kg) and persisted tonsillitis after several treatmentswith antibiotics. He denied other complaints such as cough, dyspnea,nocturnal sweating, nausea, vomiting, diarrhea or headaches. Medicalhistory included alcohol and tobacco abuse stopped 15 years ago; re-sidency on a rural area with daily contact with birds, cats and dogs;malaria and typhoid fever during his ﬁrst year of military service inPortuguese Colonial War in Africa (Angola) from 1969 to 1971; rightinguinal hernia since 2005.At admission, on day 0, a complete exam revealed a left tonsillarulceration (Fig. 1A) with bilateral cervical infracentimetric lymphade-nopathy and a 5 cm right inguinal lymphadenopathy, mobile andnontender (Fig. 1B).At day 0, routine hematological parameters were normal; blood andurine cultures were sterile; c-reactive protein, erythrocyte sedimenta-tion rate, serum levels of liver enzymes, bilirubin and lactate dehy-drogenase were within reference ranges; serologic tests for human im-munodeﬁciency virus (HIV), hepatitis B virus, hepatitis C virus, herpessimplex virus, Borrelia burgdorferi, Brucella, Bartonella, Histoplasma andinterferon-gamma release assays were negative; previous contact/in-fection and immunity – immunoglobulin (Ig) M negative and IgG po-sitive – were documented to Chlamydia trachomatis, epstein-barr virus,Chlamydophila pneumoniae, Cytomegalovirus, Toxoplasma and Varicellazoster; routine serologic antibodies for autoimmune diseases were alsohttp://dx.doi.org/10.1016/j.mmcr.2017.04.003Received 4 January 2017; Received in revised form 9 April 2017; Accepted 24 April 2017⁎ Corresponding author.Medical Mycology Case Reports 17 (2017) 14–16Available online 29 April 20172211-7539/ © 2017 The Authors. Published by Elsevier B.V. on behalf of International Society for Human and Animal Mycology. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).MARKnegative. Screening test for syphilis was positive.Chest X-ray, cervical/thoracic computed tomography (CT) andupper gastrointestinal endoscopy were normal.To exclude malignancy, on day 5, a biopsy of the ulcerated tissuewas performed and direct examination revealed large narrow basedbudding yeast cells compatible with Histoplasma (Fig. 2). Culture ofulcerated tissue on Sabouraud dextrose agar at 30 °C revealed a whiteﬁlamentous fungus one month after incubation (Fig. 3), the microscopicexamination with lacto-phenol cotton blue preparation, showed septatehyphae and thick-walled tuberculated conidia. Genomic DNA was ex-tracted and the internal transcribed spacer (ITS) region of ribosomalDNA (rDNA) was ampliﬁed using primer set ITS1 (5′TCCGTAGGTGA-ACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′). The alignedsequence was compared with sequences deposited at GenBank databaseand showed> 98% similarity with H. capsulatum var. duboisii se-quences, which is the value considered as an acceptable identiﬁcationto species level. The isolate is deposited at GenBank database with theaccession number KY420902.Left inguinal lymphadenopathy was removed on day 33 and histo-pathologic study was positive for Periodic Acid Schiﬀ (PAS) andGrocott's methenamine silver (GMS) stains and revealed ovoid yeastcells in direct histopathologic exam also compatible with histo-plasmosis.Patient was treated with Benzathine penicillin G 7.2 million unitstotal, administered as 3 doses of 2.4 million units intramuscular each at1-week intervals. After treatment, on day 30, Rapid Plasm Reagin forTreponema pallidum were negative but the tonsillar ulceration persists.On day 35, he started oral itraconazol 200 mg three-times-daily for theﬁrst 3 days and then 200 mg twice-daily for 12 months.After 1 month of treatment, tonsillar ulceration healed completelywith some retraction of the soft palate (Fig. 4) and there was no cervicallymphadenopathy palpable. Inguinal region also healed well. There wasno sign of disease or side eﬀects during the 12-month period of anti-fungal treatment. Six months after treatment, no recurrence was alsodetected.3. DiscussionOral ulcerations have many diﬀerent etiologies and it can be achallenge to diagnose and manage. Their cause can range from minorirritation to systemic diseases (viral, bacterial, fungal or autoimmune)and malignancies. Malignancy must be excluded, particularly in solitarypersisted ulceration, in patients with history of alcohol and smokingFig. 1. A. Left tonsilar ulceracion; B. Right inguinallymphadenopathy.Fig. 2. Histoplasma capsulatum var. duboisii yeast in fresh exam from tonsillar tissue(400x).Fig. 3. Septate, hyaline hyphae with large thick-walled spherical macroconidia.Lactophenol cotton blue from the culture plate −400x.Fig. 4. Oral cavity: 1 month after treatment.L. Cardoso et al. Medical Mycology Case Reports 17 (2017) 14–1615behavior. A biopsy is mandatory. Oral histoplasmosis is unusual and istypically associated with immunosuppression status, especially in pa-tients with AIDS and/or active pulmonary tuberculosis. Oral lesions canbe the presentation of disseminated disease.There are several cases worldwide reported with oral histoplasmosisin immunocompetent patients [7,9–19]. In Portugal, only one case waspublished about an oral histoplasmosis in a hemodialysis patient withpersisted fever [9].Our case illustrates a two-month persistent tonsillar ulceration as amanifestation of disseminated African histoplasmosis in an im-munocompetent Portuguese patient who lived three years in Africa1969–1971) and had an inguinal lymphadenopathy misdiagnosed asinguinal hernia for years. H. capsulatum var. duboisii is not endemic inEurope and the patient might acquire the infection in Africa. This pa-tient also had a positive screening for syphilis that mislead/delay thediagnosis and treatment for histoplasmosis.The deﬁnitive diagnosis of histoplasmosis requires isolation of theH. capsulatum on speciﬁc culture media or visualization in direct ex-amination using speciﬁc fungal staining techniques: PAS or GMS. Non-culture methods have also been developed and include antibody orantigen detection, although there is an increase in false-negative resultsin the disseminated form of histoplasmosis [5]. In our patient, the im-munodiﬀusion antibody detection was negative; in our experience thismethod is less sensitive for detection of the Histoplama capsulatum du-boisii.Until the azole era began in the 1990s, amphotericin B deoxycholatewas the only therapeutic option. Nowadays, patients who are not se-verely ill, can be treated with oral itraconazole, 200 mg twice daily for6–12 months and some authors advocate 200 mg 3 times a day for theﬁrst 3 days. Fluconazole is less eﬀective than itraconazole and it'sconsidered to be a second-line agent [1,10].Despite the rarity of the disease in Europe, clinicians should beaware of the possibility of histoplasmosis in cases of tonsillar ulcerationspecially in travelers or immigrants from sub-Saharan West and centralAfrica.Conﬂict of interestThere are none.AcknowledgementsWe acknowledge Dr. Eduardo Serra, Infectious Disease Specialist atCentro Hospitalar e Universitário de Coimbra, Portugal, that also par-ticipated in the diagnosis and follow up of the patient.References[1] C.A. Kauﬀman, Histoplasmosis: a clinical and laboratory update, Clin. MicrobiolRev. 20 (2007) 115–132.[2] S. Tom, A. Dharmadhikari, Disseminated histoplasmosis, Am. J. Hematol. 71 (2002)223.[3] H.C. Gugnani, F. Muotoe-Okafor, African histoplasmosis: a review, Rev. Iberoam.Micol. 14 (1997) 155–159.[4] A.A. George, M. Bindra, P. Mohanraj, Rare presentation of disseminated histo-plasmosis in an immunocompetent host, Am. J. Trop. Med. Hyg. 93 (2015)1125–1127.[5] A.J. Guimarães, J.D. Nosanchuk, M.Z. Oliveira, Diagnosis of Histoplasmosis, Braz. J.Microbiol. 37 (2006) 1–13.[6] P. Loulergue, F. Bastides, V. Baudouin, J. Chandenier, P. Mariani-Kurkdjian,B. Dupont, J.P. Viard, et al., Literature review and case histories of Histoplasmacapsulatum var. dubloisii infections in HIV-infected patients, EmergInfectDis 13(2007) 1647–1652.[7] V.S. Antonello, V.F. Zaltron, M. Vial, F.M. Oliveira, L.C. Severo, Oropharyngealhistoplasmosis: report of eleven cases and review of the literature, Rev. Soc. Bras.Med. Trop. 44 (2011) 26–29.[8] L.J. Wheat, M.M. Azar, N.C. Bahr, A. Spec, R.F. Relich, C. Hage, Histoplasmosis,Infect. Dis. Clin. N. Am. 30 (2016) 207–227.[9] N. Marques, A. Lebre, F. Marques, M. Julião, L. Freitas, L. Malcata, et al., Isolatedoral histoplasmosis presenting as fever of unknown origin in a portuguese hemo-dialysis patient, Mycopathologia 176 (2013) 89–93.[10] M.S. Ferreira, A.S. Borges, Histoplasmosis, Rev. Soc. Bras. Med. Trop. 42 (2009)192–198.[11] F.J. Mota de Almeida, K. Kivijärvi, G. Roos, K. Nylander, A case of disseminatedhistoplasmosis diagnosed after oral presentation in an old HIV-negative patient inSweden, Gerodontology 32 (2015) 234–236.[12] L. Ge, C. Zhou, Z. Song, Y. Zhang, L. Wang, B. Zhong, et al., Primary localizedhistoplasmosis with lesions restricted to the mouth in a Chinese HIV-negative pa-tient, Int. J. Infect. Dis. 14 (2010) 325–328.[13] M.V. O’Sullivan, M. Whitby, C. Chahoud, S.M. Miller, Histoplasmosis in Australia: areport of a case with a review of the literature, Aust. Dent. J. 49 (2004) 94–97.[14] A. Wierna, A. Ansonnaud, A. Soria, M. Gonzalez, Localized oral histoplasmosis:report of one case, Rev. Med. Chil. 138 (2010) 586–589.[15] T. Thiago Pde, J.I. dos Santos, M. Steindel, Histoplasmosis in the region of the hardpalate simulating a lesion caused by Leishmania, Rev. Soc. Bras. Med. Trop. 31(1998) 22529.[16] E. Clyti, C. Aznar, P. Couppie, D. Sainte-Marie, C. Lemoine, M. Huerre, et al.,Disseminated histoplasmosis detected by lingual and tonsillar erosions in an im-munocompetent patient, Ann. Dermatol. Venereol. 126 (1999) 709–711.[17] M.T. Brazao-Silva, G.W. Mancusi, F.V. Bazzoun, G.Y. Ishisaki, M. Marcucci, A gin-gival manifestation of histoplasmosis leading diagnosis, Contemp. Clin. Dent. 4(2013) 97–101.[18] S. Vidyanath, P. Shameena, S. Sudha, R.G. Nair, Disseminated histoplasmosis withoral and cutaneous manifestations, J. Oral Maxillofac. Pathol. 17 (2013) 139–142.[19] F. Iqbal, M. Schifter, H.G. Coleman, Oral presentation of histoplasmosis in an im-munocompetent patient: a diagnostic challenge, Aust. Dent. J. 59 (2014) 386–388.L. Cardoso et al. Medical Mycology Case Reports 17 (2017) 14–1616

Götz Froeschke

Sonja Matthee

Crossref

Parasites & Vectors

Anthropogenic habitat change often results in altered landscapes that can provide new
environments where hosts, parasites and pathogens can interact. The latter can have implications for human and animal health when in close proximity to developed areas. We recorded the helminth species richness and level of infestation in the peri-domestic rodent, Rhabdomys pumilio, in three different human linked landscapes. The aim was, to investigate the potential of R. pumilio to act as a reservoir host for zoonotic helminths and to compare the effect of anthropogenic habitat change on its parasite infestation patterns.National Research Foundatio

Froeschke, Götz

National Research Foundation

https://parasitesandvectors.biomedcentral.com/track/pdf/10.1186/1756-3305-7-393?site=parasitesandvectors.biomedcentral.com

Tonsillar ulceration as manifestation of disseminated African histoplasmosis in an immunocompetent Portuguese host

Abstract

Similar works

Full text

Available Versions

Stellenbosch University SUNScholar Repository

Scientific Repository of the National Health Institute Doutor Ricardo Jorge

Repositório Científico do Instituto Nacional de Saúde

Crossref

National Research Foundation