This Request for Comments (RFC) describes a strategy for using homology-based assembly methods to assemble parts from a library in any order

Abbas, Yassen

Crossman, Allan

Fletcher, Eugene

French, Chris

Gibson, Clare

Isapanie, Sylvia

Kopec, Lukasz

Lee, Mun Ching

Li, Di

Tynan-O'Mahony, Fionn

DSpace@MIT

BBF RFC 81: "BioSandwich", a homology-based assembly method using a library of standard partsBBF RFC 81: "BioSandwich", a homology-based assembly method using a library of standard partsYassen Abbas, Allan Crossman, Eugene Fletcher, Chris French, Clare Gibson,Sylvia Ispasanie, Lukasz Kopec, Mun Ching Lee, Di Li, Fionn Tynan-O'MahonySeptember 17, 20111. PurposeThis  Request  for  Comments  (RFC)  describes  a  strategy  for  using  homology-based  assembly methods to assemble parts from a library in any order.2. Relation to other BBF RFCs BBF RFC 81 does not update or replace any earlier BBF RFC. It is compatible with most RFC10 parts, with the added requirement that they not contain BglII sites ("agatct"). RFC10 parts can be converted to BioSandwich parts by PCR with a forward primer that adds a BglII site.3. Copyright NoticeCopyright (C) The BioBricks Foundation (2011). All Rights Reserved. 4. BackgroundOne of the main aspects of synthetic biology is the assembly of standard modular parts from a library to produce larger constructs. There are two main types of assembly strategy:  hierarchical and homology-based (Ellis et al, 2010).The  RFC10  format,  which  is  standard  for  iGEM  projects,  is  based  on  hierarchical  assembly methods such as Standard Assembly and Three Antibiotic Assembly. The main advantage of RFC10 is flexibility: any combination of parts can be assembled in any order. The main disadvantage is speed.Many iGEM teams now use homology-based assembly strategies, such as Gibson Assembly. These methods use PCR to create parts that have homologous ends. They are then assembled using the method of Gibson et al (2009). This method is relatively fast. However, the order of the parts in the final  construct  is  entirely determined by the  primers  chosen for  the initial  PCR reactions.  If  a different order is desired, parts have to be remade with new PCR primers.BioSandwich  is  a  hybrid  that  combines  many  of  the  benefits  of  hierarchical  assembly  and homology-based assembly. In particular, it is useful for creating different combinations of the same parts in different orders. BBF RFC 81: "BioSandwich", a homology-based assembly method using a library of standard parts5. OutlineBioSandwich  parts  are  reusable  because  they  come  in  a  standard  format  (much  like  ordinary BioBricks) with restriction sites flanking the part. The restriction sites are BglII ("agatct") in the prefix, and SpeI ("actagt") in the suffix. However, these restriction sites are not used directly for assembly;  instead they are used to  attach short  (~35 bp) oligonucleotides (hereafter  "spacers"). These spacers serve two purposes:• They create homology between the end of one part and the start  of another;  this allows homology-based assembly.• They can incorporate short meaningful sequences such as ribosome binding sites, linkers for fusion proteins, etc.We note that many assemblies are, or could be, made using an alternating pattern of short and long sequences;  for  example,  ribosome  binding  sites  are  placed  between  complete  genes;  or  linker sequences are placed between domains to make a fusion protein. BioSandwich is suitable for such assemblies,  whereas  many  other  homology-based assembly  methods  have  difficulty  with  small parts.Any lab using BioSandwich will  want to keep a small  library of different spacers for different purposes.  Once  (carefully  chosen)  spacers  have  been  attached  to  each  part,  homology-based assembly can be carried out in a single reaction. Precisely which spacers have been attached to which parts will determine the order of the parts in the final assembly.6. Formats6.1. Normal partsParts MUST be free of internal BglII restriction sites ("agatct") and SpeI sites ("actagt"). Each part MUST be made with a BglII site at the start, and a SpeI site at the end. Parts SHOULD be made and stored as PCR products rather than minipreps. For compliance with RFC10, parts  SHOULD also be free of EcoRI sites ("gaattc"),  XbaI sites ("tctaga") and PstI sites ("ctgcag"). For RFC10 compliance, the full part format becomes: gaattcgcggccgcttctagagatct NNN [...] NNt actagtagcggccgctgcagAfter cutting with BglII and SpeI, we have the following (shown in frame, which is relevant for fusion proteins):5'    ga tct NNN [...] NNt a         3'3'         a nnn [...] nna tga tc    5'When a part is used for fusion proteins, the "t" base at the start of the RFC10 suffix becomes the  final base of the final codon in the part. Design of the part SHOULD take this into account. This  BBF RFC 81: "BioSandwich", a homology-based assembly method using a library of standard partsMAY be done by making this final codon "ggt", coding for an innocuous glycine residue. (If a fusion protein is not being made, no such consideration is needed. If RFC10-compliance is not required, this "t" base MAY be replaced with anything.) 6.2. Normal SpacersSpacers are designed as a set of oligonucleotides that can be attached to any part via the part's restriction sites.  Each type of spacer will  be attached upstream of one part  and downstream of another.  Users  MUST create  three  different  single-stranded  oligonucleotides  (spacer  oligos  or "spoligos")  for  each  spacer  so  as  to  allow annealing  and ligation  at  the  restriction  sites.  They SHOULD be designed so that the spacer's non-ligating ends are blunt.The format for the upstream spacers is as follows (both strands shown):5'    ct agc NNN [...] NNN g         3'          (forward spoligo)3'    ga tcg nnn [...] nnn cct ag    5'      (reverse spoligo ONE)The format for the downstream spacers is:5'    ct agc NNN [...] NNN g         3'          (forward spoligo)3'         g nnn [...] nnn c         5'      (reverse spoligo TWO)Note that the forward spoligo is used for both upstream and downstream attachment.The content of different spacers MUST be varied to avoid homology. It is RECOMMENDED that non-coding spacers have an in-frame stop codon, in case they are to be used after a coding part which  lacks  one.  Non-coding  spacers  MAY be  designed  to  contain  useful  sequences  such  as ribosome binding sites.6.3. Vector PartA vector MUST be made as a PCR product with a BglII site ("agatct") at the 5' end and an XbaI site ("tctaga")  at  the  3'  end.  Since  XbaI  produces  sticky-ends  compatible  with  SpeI,  the  vector  is compatible with standard spacers.If one wishes the final products (after insertion into the vector) to be RFC10-compliant, the format for a vector SHOULD be as follows:agatct [...] tactagtagcggccgctgcag [ori, cmlR, etc] gaattcgcggccgcttctagaNote that a few additional bases MUST also be present at the 5' and 3' ends to give the restriction enzymes space to work. When spacers are to be annealed, the vector MUST be cut with BglII and XbaI (not SpeI).6.4. Start SpacerFor compliance with RFC10, the spacer that connects the vector to the first part SHOULD be in the  following format:BBF RFC 81: "BioSandwich", a homology-based assembly method using a library of standard partsSpoligos attaching upstream of first part:5'    ctagag NNN [...] NNN g         3'          (forward spoligo)3'    gatctc nnn [...] nnn cctag     5'      (reverse spoligo ONE)Spoligos attaching downstream of vector:5'    ctagag NNN [...] NNN g         3'          (forward spoligo)3'        tc nnn [...] nnn c         5'      (reverse spoligo TWO)This format ensures that the final product contains a standard RFC10 prefix and suffix. 7. Assembly7.1. Digestion of Parts and VectorEach part MUST be digested separately.• Parts: digest with BglII and SpeI in NEB Buffer 2 • Vector: digest with BglII and XbaI in NEB Buffer 2 or 3As an example protocol, each digestion reaction might contain:    36 uL     Water     5 uL     DNA     5 uL     Buffer     2 uL     Enzyme 1     2 uL     Enzyme 2In this example, the digestions could be left for 2 hours at 37 °C. Afterwards they would be purified (e.g. with 5 uL glass beads, and eluted to 10 uL elution buffer).7.2. Ligation of Parts and Vector to SpacersThe parts and vector MUST now be ligated to the correct spacers.As an example protocol, each ligation reaction might contain:    10 uL     Water     5 uL     DNA     1 uL     Spacer pair #1                    (upstream spacer forward spoligo +                     upstream spacer reverse spoligo ONE)     1 uL     Spacer pair #2                    (downstream spacer forward spoligo +                     downstream spacer reverse spoligo TWO)     2 uL     Ligase buffer     1 uL     T4 DNA ligaseIn this example, reactions could be left for 9 hours at 16 °C. Afterwards they would be purified.BBF RFC 81: "BioSandwich", a homology-based assembly method using a library of standard parts7.3. Homology-Based AssemblyThe parts MUST now be assembled using a homology-based assembly method.Users can choose from a number of different methods, including Gibson Assembly (Gibson et al, 2009); Overlap Extension PCR (Horton et al, 1989); Circular Polymerase Extension Cloning (Quan et al, 2009); and others.8. Authors' Contact InformationYassen Abbas: s0817711@sms.ed.ac.ukAllan Crossman: igem@nothinginbiology.comEugene Fletcher: E.K.A.Fletcher@sms.ed.ac.ukChris French: C.French@ed.ac.ukClare Gibson: claregibson58@gmail.comSylvia Ispasanie: s0834270@sms.ed.ac.ukLukasz Kopec: L.Kopec@sms.ed.ac.ukMun Ching Lee: leemunching@gmail.comDi Li: D.li-7@sms.ed.ac.ukFionn Tynan-O'Mahony: fionntom@yahoo.ieReferencesEllis T, Adie T, Baldwin GS (2010) DNA assembly for synthetic biology: from parts to pathways and beyond. Integrative Biology 3: 109-118 (doi: 10.1039/c0ib00070a).Gibson  DG,  Young  L,  Chuang  RY,  Venter  JC,  Hutchison  CA,  Smith  HO  (2009)  Enzymatic assembly of DNA molecules up to several hundred kilobases.  Nature Methods 6:  343-345 (doi: 10.1038/nmeth.1318).Horton R, Hunt H, Ho S, Pullen J, Pease L (1989) Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension.  Gene 77(1): 61-68. (doi: 10.1016/0378-1119(89)90359-4).Quan  J,  Tian  J  (2009)  Circular  Polymerase  Extension  Cloning  of  complex  gene  libraries  and pathways. PLoS ONE 4(7): e6441 (doi: 10.1371/journal.pone.0006441). 

"BioSandwich", a homology-based assembly method using a library of standard parts

"BioSandwich", a homology-based assembly method using a library of standard parts

Abstract

Similar works

Full text

Available Versions

DSpace@MIT