Bayele, Henry K.

Blanco Rojo, R.

Srai, S. K. S.

Vaquero, M. Pilar

Blanco-Rojo, Ruth

Digital.CSIC

2144Nutr Hosp. 2012;27(6):2144-2147ISSN 0212-1611 • CODEN NUHOEQS.V.R. 318Comunicación breveIntronic SNP rs3811647 of the human transferrin gene modulatesits expression in hepatoma cellsR. Blanco-Rojo1,2, H. K. Bayele2, S. K. S. Srai2 and M. Pilar Vaquero1, ¹Department of Metabolism and Nutrition. Institute of Food Science, Technology and Nutrition (ICTAN). Spanish NationalResearch Council (CSIC). Madrid. Spain. 2Department of Biochemistry and Molecular Biology. University College London.London. UK.EL SNP INTRÓNICO rs3811647 DEL GEN DE LATRANSFERRINA HUMANO, MODULA SU EXPRESIÓN EN CÉLULAS HEPÁTICASResumenIntroducción: La transferrina (Tf) ejerce una funcióncrucial en el mantenimiento de la homeostasis sistémicadel hierro. La expresión del gen de la transferrina es con-trolada a nivel transcripcional, aunque la posible influen-cia de factores genéticos todavía es desconocida.Objetivo: Estudiar el papel del rs3811647 en la expre-sión de la transferrina mediante un ensayo in-vitro encélulas de hepatoma.Diseño y métodos: Células Hep3B fueron co-transfecta-das con vectores que contenían las variantes A (VarA-Tf-luc) y G (VarG-Tf-luc) del rs3811647, utilizandose la luci-ferasa como marcador de la expresión del gen Tf. Resultados: Los ensayos con la luciferasa mostraron unmayor aumento de la expresión del gen Tf en presencia dela variante A comparada con la G (p < 0,05). El análisis insilico del SNP rs3811647 mostró que la presencia del aleloA puede constituir un sitio de unión del receptor de gluco-corticoides (GR).Conclusión: El alelo A del SNP rs3811647 incrementala expresión del gen Tf de modo que podría modular lavariación interindividual en los niveles de transferrinasérica observados en diferentes poblaciones.(Nutr Hosp. 2012;27:2144-2147)DOI:10.3305/nh.2012.27.6.????Palabras clave: Gen de la transferrina. SNP rs3811647.Transferina sérica. Metabolismo del hierro. Expresión génica.AbstractIntroduction: Transferrin (Tf) exerts a crucial functionin the maintenance of systemic iron homeostasis. Theexpression of the Tf gene is controlled by transcriptionalmechanism, although little is known about genetic factorsinfluence.Objective: To study the role of rs3811647 in Tf expres-sion using an in-vitro assay on hepatoma cells.Design and Methods: Hep3B cells were co-transfectedwith constructs containing A (VarA-Tf-luc) and G(VarG-Tf-luc) variants of rs3811647, using luciferase as asurrogate reporter of Tf expression. Results: Luciferase assays showed a higher intrinsicenhancer activity (p < 0.05) in the A compared with the Gvariant. In silico analysis of SNP rs3811647 showed thatthe A allele might constitute a binding site for the tran-scription factor glucocorticoid receptor (GR).Conclusion: The A allele of SNP rs3811647 increasesTf expression in a manner that might underlie inter-indi-vidual variation in serum transferrin levels observed indifferent population groups.(Nutr Hosp. 2012;27:2144-2147)DOI:10.3305/nh.2012.27.6.????Key words: Transferrin gene. SNP rs3811647. Serumtransferrin. Iron metabolism. Gene expression.AbbreviationsTf: Transferrin.GR: Glucocorticoid receptor.IntroductionTransferrin (Tf) is an iron-binding plasma protein thatdelivers iron to cells via the transferrin receptor pathway.1A molecule of Tf can bind two atoms of ferric iron withhigh affinity. Iron chelation by transferrin serves threemain purposes: to maintain ferric iron in a soluble formunder physiologic conditions; to facilitate regulated irontransport and cellular uptake, and to maintain ferric ironin a redox-inert state, avoiding the generation of free radi-cals.2 Moreover, diferric Tf stimulates hepcidin expres-sion, the central regulatory molecule of systemic ironhomeostasis, through a TfR2/HFE mediated pathway.3Correspondence: M. Pilar Vaquero.Grupo de Minerales en Metabolismo y Nutrición Humana.Departamento de Metabolismo y Nutrición.Instituto de Ciencia y Tecnología de los Alimentos y Nutrición(ICTAN).C/ José Antonio Novais, 10.28040 Madrid. Spain.E-mail: mpvaquero@ictan.csic.esRecibido: 5-IX-2012.Aceptado: 11-IX-2012.48. INTRONIC:01. Interacción  13/11/12  13:36  Página 2144The expression of the Tf gene is controlled by tran-scriptional mechanisms and is tissue-specific.4 Manyenvironmental factors are known to affect plasma Tflevels: in iron deficiency, the rate of Tf synthesis in theliver increases significantly,5 whereas inflammatory orimmunologic stimuli may decrease the levels of circu-lating Tf.6 Recent studies observed increased Tf levelsunder hypoxia, a response that may facilitate ironsupply for erythropoiesis.7 Nevertheless, little is knownabout the genetic factors that influence Tf levels inhumans, although its expression pattern appears toshow sexual dimorphism.8 Our research group recentlypublished that only a few SNPs could explain a largepercentage of the heritable variation of serum trans-ferrin levels; one of these loci is SNP rs3811647,located in intron 11 of the human transferrin gene (Tf),9which as in agreement with other data from the bibliog-raphy.10 Based on these studies, we hypothesised thatSNP rs3811647 increases transferrin expression. Herewe show that this SNP constitutes an intronic enhancerthat modulates Tf expression in hepatoma cells.Design and methodsPlasmid constructsA fragment of approximately 500 bp of intron 11 ofthe human transferrin gene (Tf), encompassing the SNPrs3811647, was amplified from placental genomic DNAwith the following primers: sense, CATGCTAGCG-GCTTGCACACAGGATTTTT; antisense, CATCTC-GAGAATCAGTGGAAGTGGCAAGG; NheI andXhoI restriction sites are underlined. The cycling para-meters were: 95° C for 5 minutes, then 95° C for 5minutes (denaturation), 62° C for 1 minute (annealing),and 72° C for 1 minute (extension); 35 cycles of PCRwere performed with a final extension for 10 minutes at72° C. The PCR product was subcloned into pGEM-TEasy vector (Promega, Southampton, United Kingdom)and sequenced for verification of the nucleotidesequence (MWG Biotech, Ebersberg, Germany) and toconfirm the presence of the A allele. The construct wasdigested with NheI and XhoI (New England Biolabs,Hitchin, United Kingdom), and the insert was purifiedwith Geneclean (BIO101; Anachem, Luton, UnitedKingdom) and ligated into the NheI and XhoI sites ofpGL3Promoter (Promega) to generate VarA-Tf-luc.Site-directed mutagenesisVarA-Tf-luc was subjected to site-directed mutagen-esis using the QuikChange Multi Site-Directed Mutage-nesis system (Stratagene, Amsterdam, The Netherlands)as instructed by the manufacturer. To change the A to Galleles we synthesized a mutagenic primer (mutationsin lowercase) as follows: GGGAGTTTACAGACA-GATCgTCTAGGATTATACATCTAGGAAGGG.After initial denaturation for 5 minutes at 95° C, PCRcycling parameters were 95° C (5 minutes), 55° C (1minute), and 65° C (11 minutes and 12 seconds), for atotal of 30 cycles. Plasmids were sequenced to verifythat the intended mutation had occurred. The resultingconstruct was designated VarG-Tf-luc.Cell culture, transfection and luciferase assayThe human hepatoma cell line Hep3B was obtainedfrom Antonello Pietrangelo and cultured in Dulbecco’sModified Eagle Medium (DMEM), supplemented with10% foetal calf serum (FCS) and antibiotics/antimy-cotics (Invitrogen). Cells were grown under standardcell culture conditions of 37° C and 5% CO2; for trans-fection, cells were seeded in 24-well plates at densitiesof approximately 104 cells/well. Cells were transfectedwith 100 ng/well of VarA-Tf-luc or VarG-Tf-luc withLipofectamine 2000 (Invitrogen), as instructed by themanufacturer. As internal control, 50 ng of pSV galvector (Promega) was included in all transfections tonormalize transfection efficiencies. Cells wereharvested after 48 hours for reporter assays; luciferaseactivities were determined with the luciferase assayreagent and β-galactosidase (βgal) activity wasmeasured using the Beta-Glo reagent (both fromPromega). Luminescence was measured in a TropixTR717 microplate luminometer (Applied Biosystems);luciferase levels were normalized with respect to galactivity in the samples.In silico analysisFor the prediction of putative transcription factorbinding sites, a sequence of 25 bases to either side ofthe SNP rs3811647 was submitted to a net-basedsearch tool Patch 1.0 (http://www.gene-regulation.com/cgi-bin/pub/programs/patch/bin/patch.cgi).Settings for core and pair similarities, matrix conser-vation, and factor class levels were adjusted accordingto factors predicted.Statistical analysisPairwise comparisons of control and SNP constructswere made using ANOVA test. A P value of 0.05 wasconsidered significant. Graphs were plotted with theGraphPad Prism software and data were analysedusing the SPSS statistical package for Windows(version 19.0; SPSS Inc., Chicago, IL, USA).ResultsUsing reporter assays in which fragments of theintron encompassing SNP rs3811647 were ligated toSNP rs3811647 modulates transferrinexpression2145Nutr Hosp. 2012;27(6):2144-214748. INTRONIC:01. Interacción  13/11/12  13:36  Página 2145firefly luciferase as Tf surrogate, we found that the Aallele enhanced gene expression compared with the Gallele. The fold activation of the VarA-Tf-luc constructwas significantly higher (p < 0.05) than that of theVarG-Tf-luc construct (fig. 1). In other words, the Aallele of the SNP rs3811647 supports higher Tf expres-sion than the G allele in hepatoma cells.In silico analysis of this SNP showed that the Aallele in rs3811647 could theoretically constitute abinding site for the glucocorticoid receptor (GR), alsoknown as nuclear receptor subfamily 3 group Cmember 1 (NR3C1), whereas this binding site is lostwith the G allele (fig. 2).DiscussionThe obtained results can be validated by the findingsthat our research group obtained in a group of menstru-ating women. We found that serum transferrin wassignificantly higher in AA homozygous women than inAG heterozygous and GG homozygous (p < 0.01), andserum transferrin saturation was significantly higher inGG than in AG and AA women (p = 0.01).9 Also, thein-vitro results confirm previous observations indifferent population groups10-13 and add new informa-tion concerning the functionality of rs3811647. Wetherefore suggest that basal differences in circulatingTf levels between individuals may be ascribed to SNPrs3811647, which is located in intron 11 of Tf gene(Chr3q22.1). The tissue-specificity of Tf expression is accom-plished by the recruitment of different combinations oftranscription factors. In hepatocytes, binding sites oftranscription factors that are well-known to regulate Tfexpression have been described. Proximal region I(PRI) and proximal region II (PRII) within the Tfpromoter positively regulate its expression in the liverwhereas distal regions repress Tf expression.14However, our study shows that in addition to the posi-tive regulation of Tf by proximal promoter elements,there are intronic elements such as rs3811647 thatcould act as enhancers of Tf transcription. This isintriguing because no known function especially inrelation to relative risk would have been predicted forintronic sequences,15 considering that disease associa-tions have hitherto been limited to coding-region muta-tions only. We found that presence of the A allele ofrs3811647 might constitute a binding site for the GR.Glucocorticoids influence the expression of a numberof genes involved in iron metabolism including ferritin,ferroportin, DMT-1 and iron regulatory protein-1.16,17GR might therefore regulate glucocorticoid-dependentdifferences in Tf allele expression; further studies willascertain this. Although it is more frequent to findregulatory regions upstream of the start site of tran-scription, in some cases transcription factors are able todrive gene expression from within coding regions.18 Itis therefore not entirely surprising that we found regu-latory regions within the Tf intron.In our previous study, the women that presented theA allele also had lower transferrin saturation, whichmay indicate a reduction in iron transport to tissues.9Since low ferritin levels have been associated with this2146 R. Blanco-Rojo et al.Nutr Hosp. 2012;27(6):2144-2147Fig. 1.—SNP rs3811647 luciferase assay. Hep3B cells weretransfected with VarA-Tf-luc or VarG-Tf-luc constructs; pGL3(Promoter) vector backbone was used as negative control. Datawere normalized to the expression levels of β-galactosidase in-ternal control, and represent the means of two independent ex-periments (± SEM), *p < 0.05.150100500Fold activation27.8 ± 7.580.3 ± 16.9pGL3 VarG-Tf-Iuc VarA-Tf-IucFig. 2.—Genomic arrangement (upper panel) and sequences proximal to SNP rs3811647 (bold letter, lower panel). Sequence analysiswith prediction algorithms showed that the A allele in rs3811647 might create a binding site for the glucocorticoid receptor (GR).rs3811647Allele A: AAGCTGAGGGAGTTTACAGACAGATCATCTAGGATTATACATCTAGGAAGGGAllele G: AAGCTGAGGGAGTTTACAGACAGATCGTCTAGGATTATACATCTAGGAAGGG==GR==0M 10M 20M 30M 40M 50M 60M 70M 80M 90M 100M 110M 120M 130M 140M 150M 160M 170M 180M 190M48. INTRONIC:01. Interacción  13/11/12  13:36  Página 2146SNP, it could be related to low iron status.10 Anotherimportant observation was made in a placebo-controlled nutritional intervention study with iron-fortified food in iron-deficient women.19 Dietary iron-fortification markedly increased the iron status in allwomen. However, carriers of the minor A alleleshowed Tf levels higher than the rest during the 16-week intervention period.20 All of these observationssuggest that this SNP may affect iron metabolism.In conclusion, we found that the A allele of the SNPrs3811647 enhances Tf expression compared with theG allele, and that this might explain the associationbetween this SNP and the high serum Tf levelsobserved in different population groups.AcknowledgementsThis study was supported by Project AGL2009-11437. R. Blanco-Rojo was supported by a JAE-predoc grant from CSIC and European Social Found.References1. World Health Organization. Assessing the iron status of popu-lations. Geneva, 2007.2. Gkouvatsos K, Papanikolaou G, Pantopoulos K. Regulation ofiron transport and the role of transferrin. Biochim Biophys Acta2012; 1820 (3): 188-202.3. Gao J, Chen J, Kramer M, Tsukamoto H, Zhang AS, Enns CA.Interaction of the hereditary hemochromatosis protein HFEwith transferrin receptor 2 is required for transferrin-inducedhepcidin expression. Cell Metab 2009; 9 (3): 217-27.4. Zakin MM, Baron B, Guillou F. Regulation of the tissue-specific expression of transferrin gene. Dev Neurosci 2002; 24(2-3): 222-6.5. Idzerda RL, Huebers H, Finch CA, McKnight GS. Rat trans-ferrin gene expression: tissue-specific regulation by iron defi-ciency. Proc Natl Acad Sci USA 1986; 83 (11): 3723-7.6. Djeha A, Perez-Arellano JL, Hayes SL, Oria R, Simpson RJ,Raja KB, et al. Cytokine-mediated regulation of transferrinsynthesis in mouse macrophages and human T lymphocytes.Blood 1995; 85 (4): 1036-42.7. Rolfs A, Kvietikova I, Gassmann M, Wenger RH. Oxygen-regulated transferrin expression is mediated by hypoxia-inducible factor-1. J Biol Chem 1997; 272 (32): 20055-62.8. Whitfield JB, Cullen LM, Jazwinska EC, Powell LW, HeathAC, Zhu G et al. Effects of HFE C282Y and H63D polymor-phisms and polygenic background on iron stores in a largecommunity sample of twins. Am J Hum Genet 2000; 66 (4):1246-58.9. Blanco-Rojo R, Baeza-Richer C, Lopez-Parra AM, Perez-Granados AM, Brichs A, Bertoncini S et al. Four variants intransferrin and HFE genes as potential markers of iron defi-ciency anaemia risk: an association study in menstruatingwomen. Nutr Metab (Lond) 2011; 8: 69.10. Benyamin B, McRae AF, Zhu G, Gordon S, Henders AK,Palotie A et al. Variants in TF and HFE explain approximately40% of genetic variation in serum-transferrin levels. Am J HumGenet 2009; 84 (1): 60-5.11. Benyamin B, Ferreira MA, Willemsen G, Gordon S, Middel-berg RP, McEvoy BP, et al. Common variants in TMPRSS6 areassociated with iron status and erythrocyte volume. Nat Genet2009; 41 (11): 1173-5.12. McLaren CE, Garner CP, Constantine CC, McLachlan S,Vulpe CD, Snively BM, et al. Genome-wide association studyidentifies genetic Loci associated with iron deficiency. PLoSOne 2011; 6 (3): e17390.13. Constantine CC, Anderson GJ, Vulpe CD, McLaren CE, BahloM, Yeap HL et al. A novel association between a SNP inCYBRD1 and serum ferritin levels in a cohort study of HFEhereditary haemochromatosis. Br J Haematol 2009; 147 (1):140-9.14. Sawaya BE, Aunis D, Schaeffer E. Distinct positive and nega-tive regulatory elements control neuronal and hepatic transcrip-tion of the human transferrin gene. J Neurosci Res 1996; 43 (3):261-72.15. Tabor HK, Risch NJ, Myers RM. Candidate-gene approachesfor studying complex genetic traits: practical considerations.Nat Rev Genet 2002; 3 (5): 391-7.16. He F, Ma L, Wang H, Shen Z, Li M. Glucocorticoid causes ironaccumulation in liver by up-regulating expression of iron regu-latory protein 1 gene through GR and STAT5. Cell biochemis -try and biophysics 2011; 61 (1): 65-71.17. Wang L, Wang H, Li L, Li W, Dong X, Li M, Lv L. Corticos-terone induces dysregulation of iron metabolism inhippocampal neurons in vitro. Biol Trace Elem Res 2010; 137(1): 88-95.18. Schrem H, Klempnauer J, Borlak J. Liver-enriched transcrip-tion factors in liver function and development. Part I: the hepa-tocyte nuclear factor network and liver-specific gene expres-sion. Pharmacol Rev 2002; 54 (1): 129-58.19. Blanco-Rojo R, Perez-Granados AM, Toxqui L, González-Vizcayno C, Delgado MA, Vaquero MP. Efficacy of a microen-capsulated iron pyrophosphate-fortified fruit juice: arandomised, double-blind, placebo-controlled study in Spanishiron-deficient women. Br J Nutr 2011; 105 (11): 1652-9.20. Blanco-Rojo R, Pérez-Granados AM, López-Parra AM, BaezaC, Toxqui L, Arroyo-Pardo E et al. Influence of SNP rs3811647on Fe metabolism and response to an Fe supplemented food inmenstruating women. Proceedings of the Nutrition Society2011; 70 (OCE4): E212.SNP rs3811647 modulates transferrinexpression2147Nutr Hosp. 2012;27(6):2144-214748. INTRONIC:01. Interacción  13/11/12  13:36  Página 2147

Intronic SNP rs3811647 of the human transferrin gene modulates its expression in hepatoma cells

Abstract

Similar works

Full text

Available Versions

Digital.CSIC