Abdolvahabi, Zohreh

Alizadeh, Safar Ali

Ilghari, Dariush

Khabbaz, Farhad

Najafipour, Reza

piri, Hosein

Sahmani, Mehdi

Sirati-Sabet, Majid

Qazvin University of Medical Sciences Repository

Biotech Health Sci. 2014 May; 1(1): e19191. Published online 2014 April 27. Research ArticleCloning and Expression of Mycobacterium Tuberculosis Rv0285 (Pe5) GeneMajid Sirati-Sabet 1,2; Mehdi Sahmani 1,2; Reza Najafipour 1,2; Safarali Alizadeh 2; Hossein Piri 1,2; Zohreh Abdolvahabi 1; Farhad Khabbaz 1; Dariush Ilghari 1,2,*1Department of Biochemistry and Genetic, Qazvin University of Medical Sciences, Qazvin, IR Iran2Cellular and Molecular Research Center, Qazvin University of Medical Sciences, Qazvin, IR Iran*Corresponding author: Dariush Ilghari, Department of Clinical Biochemistry and Genetics, Qazvin University of Medical Sciences, Qazvin, IR Iran. Tel: +98-9382081127, E-mail: d.ilghari@gmail.com Received: February 10, 2014; Revised: February 25, 2014; Accepted: March 16, 2014Background: PE5 is a member of the PE protein family whose precise function is yet to be understood. There are about 100 members of the PE family proteins in mycobacterium tuberculosis. These glycine- and alanine-rich proteins consist of Proline-Glutamate motifs at their N-termini and may be implicated in pathogenesis of the bacilli.Objectives: We aimed to clone and over-express the Rv0285 coding region in the BL21 (DE3) Escherichia coli strain for the future functional investigations.Materials and Methods: The PE5 coding region was cloned into a specific vector containing N-terminal GST tag using ligation independent cloning (LIC) method and then the recombinant vector was transferred into the competent TOP10 E. coli strain. The positive colonies were screened by the colony PCR approach and finally integration of the constructed expression vector was assessed by DNA sequencing. The vectors were then transferred and expressed in E. coli BL21 (DE3) strain and finally the protein expression level was analyzed using SDS-PAGE.Results: In this study, the PE5 (Rv0285) coding region was amplified as a 309 bp DNA fragment from the mycobacterium tuberculosis H37Rv chromosome using specific sets of primers. The amplicon was then cloned into pLEICS-02 and then confirmed by DNA sequencing. The recombinant protein was over-expressed as a ~ 40 kDa tagged protein in E. coli, and finally confirmed by SDS-PAGE analysis.Conclusions: Our data showed that recombinant PE5 coding region was successfully cloned in pLEICS-02 and expressed in BL21 (DE3) E. coli strain as host.Keywords: Mycobacterium Tuberculosis; GenesImplication for health policy/practice/research/medical education:It helps to clone and over-express the Rv0285 coding region in the BL21 (DE3) Escherichia coli strain for the future functional investigations.Copyright © 2014, School of Paramedical Sciences, Qazvin University of Medical Sciences; Published by Qazvin University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.1. BackgroundTuberculosis (TB), once thought to be controlled, is now resurgent in many parts of the world, claiming more lives annually than any other infectious disease. Every second someone in the world is newly infected with TB Bacilli and five to ten percent of the infected individuals become in-fectious at some time during their life. An estimated two billion people, about one third of world’s population, is currently infected with TB Bacilli, resulting in about two million deaths annually (1, 2). The major burden of TB is borne by developing countries, particularly in Africa and South-East Asia, mainly because of the reduced socio-economic status, lack of proper public healthcare sys-tem, emergence of both multi-drug resistant (MDR) and extensively drug resistant (XDR) tuberculosis and spread of HIV/AIDS (3). However, in economically favored coun-tries with outstanding clinical facilities and proper public healthcare system, other risk factors such as, stressful life, alcohol consumption and particularly increased number of immigrants from high burden counties have resulted in an increase in the number of reported TB cases (2, 4).The M. tuberculosis genome was sequenced completely about 14 years ago (5). The singular GC rich circular chro-mosome consists of 4.4 Mbp and contains 4006 func-tional protein genes (6). About 52% of these proteins have been assigned a precise or predicted function (7). An unusual characteristic of the genome is the presence of 167 genes encoding the two unrelated, acidic protein families, known as the PE and PPE proteins (8). These two protein families are recognized by their N-terminal pro-line-glutamic acid and proline-proline-glutamic acid mo-tifs and it has been suggested that at least some of these proteins are surface exposed and play a role in adhesion, immune modulation and antigenic variation (9, 10). PE5, a member of the PE family proteins, is encoded by the RV0285 gene (11). This 306 bp coding region encodes a polypeptide, containing 102 amino acids (12). Given the possibility that this polypeptide acts as virulence factor, we cloned and then expressed the Rv0285 coding region in the BL21 (DE3) E. coli strain for the future functional in-vestigations.Sirati-Sabet M et al.Biotech Health Sci. 2014;1(1):e19191142. ObjectivesWe aimed to clone and over-express the Rv0285 coding region in the BL21 (DE3) E. coli strain for the future func-tional investigations.3. Materials and Methods3.1. Primer Design and Polymerase Chain ReactionsIn the present study, the m. tuberculosis H37Rv chromo-some we used as a template for PCR. The coding regions were amplified by PCR from the DNA template using Pfx DNA polymerase (Invitrogen), and the following primers (Table 1):Table 1.  The sets of Forward and Reverse Primes Used to Am-plify Rv0285 Coding Region aPrimer Names The Sequences (5'-3')F1 TGGTGAAACCCAACAGAAR1 GCGAAGCCATCCAGATGGF2 TACTTCCAATCCATGACGTTGCGAGTGGTT R2 TATCCACCTTTACTGTCAGCCGCCCACGACCCC a  Abbreviations: F, forward; R, reverse.The second set of forward and reverse primers (F2 and R2) contain a 5' extension (the underlined fragments) which is recognized by a 3'-5' exonuclease. The PCR reac-tions were performed according to the manufacturer’s protocols, using the TECHNE thermal cycling system (TECHGENE). The PCR products were finally identified by electrophoresis using 1% (w/v) agarose gels, and purified using the QIA quick PCR purification kit. PCRs were ac-complished in a 50 μL reaction volume and the protocol consisted of a five minute initial denaturation at 94°C followed by 30 cycles of one minute at 94°C, one minute at 50°C for annealing and one minutes at 68°C for exten-sion. The final extension cycle was five minutes at 68°C.3.2. DNA Gel ElectrophoresisPCR products were identified by horizontal electropho-resis using 1% (w/v) agarose gels run at a constant 100 V for 40 minutes. Ethidium bromide was used to visualize the location of the plasmid DNA under ultra violet light.3.3. Ligase Independent CloningpLEICS-02 expression vector was digested by the restric-tion enzyme BseRI to remove the inserted lethal SacB gene (the Bacillus subtilis SacB gene encodes levansucrase that induces lethality upon exposure to 5% (wt/vol) sucrose in the growth medium) (13). The freeze-dried 3'-5' exonucle-ase supplied by In-fusionTM PCR cloning Kit (Clontech) was then thoroughly dissolved in 5 μL dH2O. 2 μL of dis-solved enzyme, the linearized vector and the purified PCR product were mixed together and the mixture was finally subjected to a two-step incubation procedure at 30°C and room temperature respectively (14).3.4. Transformation the Competent E. Coli StrainsAn aliquot of 50 μL competent cells was mixed with 4 μL of plasmid mixture and then mixed gently. The mix-ture was incubated on ice for 30 minutes and then heat shocked at 42°C for 45 seconds. Following the heat shock, the sample was left on ice for five minutes. 300 μL LB broth was then added to the ice-cold sample and incu-bated for 45 minutes at 37°C and 200 rpm, with the tubes placed horizontally in the incubator. The incubated sam-ple was plated out in 50, 100, 200 μL aliquots onto LB agar containing 100 µM ampicillin and finally incubate at 37°C overnight.3.5. Colony PCR Screening and DNA SequencingTen colonies were picked and transferred separately into 10 PCR tubes containing 20 μL of sterile water. In order to trace out the positive transformants, 5 μL of each inoculated sample was used to inoculate 10 mL LB broth containing 100 μg/mL ampicillin. The 10 mL inocu-lated cultures were then incubated at 37°C/200 rpm for overnight to be subjected for miniprep (Promega). The remaining samples (15 μL) were then utilized for the an-alytical PCR using F2 and R2 primers. The PCR products were then analyzed by DNA electrophoresis. The positive constructs identified by the colony PCR screening were finally checked by sequencing which was performed at the Reference lab, Qazvin University of Medical Sciences.3.6. Protein Expression TrialsTime-course expression trials were carried out using BL21 (DE3) transformed by the respective construct. LB starter cultures (50 mL) containing 100 μg/mL Ampicillin was inoculated with one colony of each selected trans-formant and grown overnight at 37°C, and 200 rpm in a shaker. The cells centrifuged for 10 minutes at 5000 rpm. The pellets were resuspended in 1mL fresh LB (without an-tibiotic) and subcultured into 50 mL LB broth containing 100μg/ml Ampicillin to final OD 600 nm of about 0.1. The cultures were grown at 37°C until mid-log phase (OD600 nm 0.6-0.7) and 1 mL of each culture removed and stored at -20°C for SDS-PAGE analysis. The cells were induced by addition of 1 mM IPTG and 1 mL of the cells were harvested every hour post-induction for 4 hours. Normalized pre- and post-induction samples were analyzed by SDS-PAGE for protein production.4. Results and Discussion4.1. Specific Primers Were Designed to Amply the Target Rv0285 Coding RegionOur blast analysis unmasked that there were many cod-Sirati-Sabet M et al.15Biotech Health Sci. 2014;1(1):e19191ing regions in the bacilli chromosome very similar to that of RV0285. This made us design two sets of forward and reverse primers to circumvent amplification of unwant-ed genes. In fact, we used the bacterial chromosome as template and applied the first set of forward and reverse primers (F1 and R1) to amplify the Rv0285 coding region with 5' and 3' flanking regions. The resulting PCR prod-ucts were then utilized as secondary template to amplify only the Rv0285 coding region using the second set of primers, i.e. F2 and R2. The amplicon was then analyzed and confirmed using DNA electrophoresis as shown in the Figure 1.4.2. Ligase Independent Cloning Were Used to Clone Rv0285 in pLEICS-02In order to produce Rv0285 protein with removable glutathion-S-transferase-tag, the corresponding coding regions were cloned into the pLEICS-02 expression vec-tors using LIC-PCR method (14). Ligation-independent cloning (also known as enzyme-free cloning) increases both the speed and efficiency of cloning of PCR products. LIC-PCR also eliminates the need to ligate PCR products to a vector, and does not rely on restriction sites (14). In this method, overlapping sequences are designed into the vector and PCR primers used to amplify the target DNA. Controlled digestion of the PCR product and the vector with a 3'-5' exonuclease such as exonuclease III is then used to create complementary protruding 3' ends. When the insert and the vector are mixed, the PCR products are annealed to the prepared vector. The chimeric molecule is then used to transform E. coli, and the ligase of the bac-terial cells finally seals the single-stranded nicks and gen-erates a covalently closed circular molecule (14).4.3. Colony PCR Screening and DNA Sequencing Were Used to Confirmed the Constructed pLECS-02 PlasmidFollowing cloning of the Rv0285 amplicon into pLECS-02 expression vector, we used colony PCR screening to trace out the colonies carrying the chimeric plasmid. As ex-pected, the method of cloning performed was quite ef-ficient. This is evidenced by the fact that all 10 colonies selected for colony PCR screening were positive (Figure 2). To double check if we had the right colons at hands, the recombinant vector was extracted by miniprep from the selected transformants mentioned above and then sent for DNA sequencing. Finally, our sequencing data confirmed that the right coding region had been cloned in the pLECS-02 expression vector.4.4. Expression Trails Showed That the PE5 Polypeptide Can be Expressed in BL21 E. coli StrainOur expression trials clearly demonstrated that the GST-tagged protein was expressed in the standard BL21 (DE3)Figure 1. PCR Amplification of the Rv0285 Coding RegionThe gel is a 1% w/v agarose gel viewed under UV light with ethidium bro-mide used to visualize the products of the PCR reactions. Lanes 1 and 2 correspond to a 100 bp DNA ladder and the PCR products of Rv0285 cod-ing region, respectively.Figure 2. Colony PCR Screening of TransformantsThe gel shows the results of colony PCR screening for the transformants carrying of the right Rv0285-pLEICS-02 (lanes 2-10) construct. Lane one contains a 100 bp DNA marker.Sirati-Sabet M et al.Biotech Health Sci. 2014;1(1):e1919116Figure 3. SDS-PAGE Gel of Expression Trails of the Recombinant Rv0285Gel shows the expression trials of the GST-Rv0285 in BL21 (DE3) E. coli cells. Lanes 1, 2, 3, 4, 5 and 6 contain a high molecular weight protein marker, the pre-induction cell lysate, 1, 2, 3, and four hour post-induction frac-tions (whole cell lysate). The Position of the GST-Rv028s band on the gel is shown by the arrow on lanes 6. cells. Indeed, comparison of the pre-induced cell lysate with 1 hour-, 2 hour-, 3 hour- and 4 hour-post induction lysates by SDS-PAGE analysis showed that a protein band with molecular weight of about 40 kDa was appeared in all but the lane corresponding to the pre-induced sample (Figure 3), suggesting that the GST-PE5 polypeptide (Mw: 40 kDa) was expressed upon induction of the transfor-mants with IPTG.Collectively, our data reveal that the Rv0285 coding re-gion was successfully cloned in the pLECS-02 expression vector using efficient, rapid and inexpensive ligase inde-pendent cloning approach and was expressed in the stan-dard BL21 (DE3) E. coli strain. It is noteworthy that we are planning to purify the expressed GST-PE5 protein using GST affinity chromatography and further confirm it us-ing mass spectroscopy.AcknowledgementsWe would like to acknowledge University of Leicester for providing the original expression vector for cloning.Author's ContributionSirati-Sabet conducted cloning and expression of Rv0285, and helped with manuscript preparation; Sah-mani, Najafipour, Alizadeh, Piri, Abdolvahabi and Khab-baz were involved in solution preparations, miniprep, competent cell preparation, and accomplishment of ex-periments; Ilghari designed the experiment, wrote the manuscript, and rewarded the grant.Financial DisclosureThere is no conflict of interest.Funding/SupportThis project has been supported by cell and Molecular Research Center, Qazvin University of Medical Sciences.References1.       Ilghari D, Lightbody KL, Veverka V, Waters LC, Muskett FW, Ren-shaw PS, et al. Solution structure of the Mycobacterium tuber-culosis EsxG.EsxH complex: functional implications and com-parisons with other M. tuberculosis Esx family complexes. J Biol Chem. 2011;286(34):29993–30002.2.       Maher D, Dye C, Floyd K, Pantoja A, Lonnroth K, Reid A, et al. Plan-ning to improve global health: the next decade of tuberculosis control. Bull World Health Organ. 2007;85(5):341–7.3.       Bonnet MM, Pinoges LL, Varaine FF, Oberhauser BB, O'Brien DD, Kebede YY, et al. Tuberculosis after HAART initiation in HIV-pos-itive patients from five countries with a high tuberculosis bur-den. AIDS. 2006;20(9):1275–9.4.       Lightbody KL, Ilghari D, Waters LC, Carey G, Bailey MA, Wil-liamson RA, et al. Molecular features governing the stability and specificity of functional complex formation by Mycobac-terium tuberculosis CFP-10/ESAT-6 family proteins. J Biol Chem. 2008;283(25):17681–90.5.       Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, et al. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature. 1998;393(6685):537–44.6.       Cole ST. Learning from the genome sequence of Mycobacterium tuberculosis H37Rv. FEBS Letters. 1999;452(1–2):7–10.7.       Ilghari D, Waters LC, Veverka V, Muskett FW, Carr MD. (15)N, (13)C and (1)H resonance assignments and secondary structure de-termination of the Mycobacterium tuberculosis Rv0287-Rv0288 protein complex. Biomol NMR Assign. 2009;3(2):171–4.8.       Flores J, Espitia C. Differential expression of PE and PE_PGRS genes in Mycobacterium tuberculosis strains. Gene. 2003;318:75–81.9.       Smith I. Mycobacterium tuberculosis pathogenesis and molecu-lar determinants of virulence. Clin Microbiol Rev. 2003;16(3):463–96.10.       Garnier T, Eiglmeier K, Camus JC, Medina N, Mansoor H, Pryor M, et al. The complete genome sequence of Mycobacterium bovis. Proc Natl Acad Sci U S A. 2003;100(13):7877–82.11.       Brennan MJ, Delogu G. The PE multigene family: a ‘molecular mantra’ for mycobacteria. Trends in Microbiology. 2002;10(5):246–9.12.       Tiwari BM, Kannan N, Vemu L, Raghunand TR. The Mycobacteri-um tuberculosis PE Proteins Rv0285 and Rv1386 modulate innate immunity and mediate bacillary survival in macrophages. PloS one. 2012;7(12):e51686. 13.       Gay P, Le Coq D, Steinmetz M, Berkelman T, Kado CI. Positive selec-tion procedure for entrapment of insertion sequence elements in gram-negative bacteria. J Bacteriol. 1985;164(2):918–21.14.       Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press; 2001.

Cloning and Expression of Mycobacterium Tuberculosis Rv0285 (Pe5) Gene

http://eprints.qums.ac.ir/784/1/Cloning%20and%20Expression%20of%20Mycobacterium%20Tuberculosis%20Rv0285%20%28Pe5%29%20Gene.pdf

Cloning and Expression of Mycobacterium Tuberculosis Rv0285 (Pe5) Gene

Abstract

Similar works

Full text

Available Versions

Qazvin University of Medical Sciences Repository