Gobiids constitute a major proportion of fish population in both tropical and temperate

freshwater as well as marine ecosystem. Due to their small size, cryptic ecology and ambiguous

morphological characters, gobiids diversity was not documented completely. In this study, DNA

barcodes were generated for 11 species of gobiids, collected from the Ashtamudi Lake, India.

The mitochondrial COI gene was amplified using universal primers and the resulted 650 bp

amplicon was sequenced. The COI barcodes clearly distinguished all the species with high interspecific

genetic distance values than intra-specific values based on K2P (Kimura 2 Parameter)

model. The average genetic distance (K2P model) within species, genus and family was 1.2%,

22.2% and 25.3%, respectively. In addition to barcode-based species identification system,

Nucleotide Diagnostic (ND) characters specific for species were identified. The Neighbor-Joining

tree revealed distinct clusters shared by the species of same genera

Chakraborty, S K

Jaiswar, A K

Lakra, W S

Nair, J Rajasekharan

Pavan-Kumar, A

Singh, Dhirendra P

Viswambharan, Divya

Pavan Kumar, Annam

CMFRI Digital Repository

http://informahealthcare.com/mdnISSN: 1940-1736 (print), 1940-1744 (electronic)Mitochondrial DNA, Early Online: 1–5! 2013 Informa UK Ltd. DOI: 10.3109/19401736.2013.834438SHORT COMMUNICATIONDNA barcoding of gobiid fishes (Perciformes, Gobioidei)Divya Viswambharan1, A. Pavan-Kumar1, Dhirendra P. Singh1, A. K. Jaiswar1, S. K. Chakraborty1,J. Rajashekharan Nair2, and W. S. Lakra11Division of Fish Genetics and Biotechnology, Central Institute of Fisheries Education, Mumbai, Maharashtra, India and 2Department of FisheryBiology, Kerala University of Fisheries and Ocean Studies, Kochi, Kerala, IndiaAbstractGobiids constitute a major proportion of fish population in both tropical and temperatefreshwater as well as marine ecosystem. Due to their small size, cryptic ecology and ambiguousmorphological characters, gobiids diversity was not documented completely. In this study, DNAbarcodes were generated for 11 species of gobiids, collected from the Ashtamudi Lake, India.The mitochondrial COI gene was amplified using universal primers and the resulted 650 bpamplicon was sequenced. The COI barcodes clearly distinguished all the species with high inter-specific genetic distance values than intra-specific values based on K2P (Kimura 2 Parameter)model. The average genetic distance (K2P model) within species, genus and family was 1.2%,22.2% and 25.3%, respectively. In addition to barcode-based species identification system,Nucleotide Diagnostic (ND) characters specific for species were identified. The Neighbor-Joiningtree revealed distinct clusters shared by the species of same genera.KeywordsCytochrome c oxidase subunit I, DNAbarcoding, gobiid fishes, nucleotidediagnostic charactersHistoryReceived 2 May 2013Revised 5 August 2013Accepted 10 August 2013Published online 17 September 2013IntroductionGobiids are estimated to constitute 35% of the total number offishes and 20% of the species diversity and they occupy bothtropical and temperate environment (Winterbottom et al., 2011).However, due to their small size and often cryptic ecologies, thegobiid diversity was not characterized completely and was oftenunnoticed. The traditional morphological tools for species iden-tification are constrained by phenotypic plasticity, life stage-specific identification cues and the occurrence of cryptic species.DNA-based approach exploiting sequence diversity among spe-cies can be used to identify fishes and to resolve taxonomicambiguities. Hebert et al. (2004) have demonstrated that theCytochrome c oxidase subunit I (COI) region is appropriate fordiscriminating closely related species across diverse animal phylaand this has been used for marine as well as freshwater fisheswidely (Hajibabaei et al., 2005; Hubert et al., 2008; Lakra et al.,2011; Steinke et al., 2005; Ward et al., 2008).This work was carried out with an objective of developingDNA barcodes for Gobiids from Ashtamudi Lake, the secondlargest wetland ecosystem in India. The aim of the study alsoincludes analyzing Nucleotide diagnostics (NDs) characters forthese fishes and supplementing the BOLD database with Indianhaplotypes as there is lack of species-specific information.Materials and methodsA total of 29 Gobiid specimens belonging to 11 species werecollected from the Ashtamudi Lake (Lat 8.95 N and Long76.6 E) in Kerala, India, for which the taxonomy and GenBankaccession numbers are provided (Table 1). The specimens wereidentified based on morphological characters using ‘‘Smiths’ seafishes’’ (1986) and preserved in absolute alcohol for furthermolecular study. Total genomic DNA was isolated from themuscle tissue according to the SDS-phenol/chloroform method ofSambrook et al. (2001) with some modifications. The cytochromec oxidase subunit I (COI) gene was amplified with primersFishF1-50 TCAACCAACCACAAAGACATTGGCAC 30 andFishR-1 50 TAGACTTCTGGG TGGCCAAAGAATCA 30 (Wardet al., 2005) in a 50-ml volume with 100 ng template DNA,10 pmol of each specific primer, 200mM of each dNTPs, 1.0 unitof Taq DNA polymerase and 1x Taq buffer containing1.5 mM MgCl2. The PCR conditions were initial denaturation at94 C for 3 min, followed by 35 cycles of 40 s at 94 C, 40 s at54 C, 60 s at 72 C and final extension at 72 C for 10 min.The PCR products were visualized on 1.5% agarose gel andthe amplicons were purified by Gel extraction kit (Fermentas,Waltham, MA) following the manufacture’s protocol. Thepurified products were sequenced commercially by Eurofins PvtLtd., Bangalore, India.Sequence analysisThe COI partial gene sequences obtained for each species weremanually assembled using Generunner software (New York,NY). Assembled sequences were end-trimmed to a homologousregion to avoid sequencing errors and aligned using Clustal W(Thompson et al., 1997). Only those sequences with more than550 bp in size were used for the analysis. Sequence divergencevalues within and between species were calculated using Kimuratwo Parameter (K2P) distance model implemented in MEGAV.5.0 (Tamura et al., 2011) software (Arizona). The pair-wisedeletion option was selected to account for missing sequenceinformation between each compared specimen. NucleotideDiagnostics (NDs) for each species of interest were identifiedin the context of the entire pool of available species by MEGACorrespondence: A. Pavan Kumar, Scientist, Division of Fish Geneticsand Biotechnology, Central Institute of Fisheries Education, Versova,Andheri West, Mumbai-61, Maharashtra, India. Tel: 022-26361447,Ext. 452. E-mail: pavankumar@cife.edu.inMitochondrial DNA Downloaded from informahealthcare.com by 14.139.124.98 on 09/19/13For personal use only.V.5.0 (Tamura et al., 2011) software. The COI gene sequencesubstitution saturation was tested by plotting the number oftransitions and transversions against genetic divergence [Kimura2-parameter (K2P)] using DAMBE version 4.2.13 (Xia & Xie,2001). The Neighbor-joining (NJ) tree of COI K2P distance wascreated to give a graphical representation of the divergencepattern between species (Saitou & Nei, 1987) with 1000bootstrap replications.Results and discussionA total of 29 COI sequences were generated from 11 gobiidfish species. Sequence alignment yielded 650 bp per taxonafter exclusion of the primer sequence. Simplicity and unambi-guity were observed among all the sequences. No insertions,deletions or stop codons were observed in any of the sequence andit proves the absence of NUMTS (Nuclear Mitochondrial DNA,i.e. nuclear DNA sequences originating from mitochondrialDNA). Richly & Leister (2004) reported occurrence of NUMTS(transfers of mtDNA COI sequences into the nuclear genome)after comparing Fugu rupripes mtDNA and nuclear DNAsequences. DNA barcoding can overestimate the number ofspecies, if nuclear mitochondrial pseudogenes are co-amplified(Song et al., 2008).The COI sequence analysis across species in this studyrevealed average nucleotide frequencies as 24.9% (A), 29.3% (T),27.1% (C) and 18.7% (G). Min & Hickey (2007) showed strongcorrelation between the GC composition of COI gene and theentire mitochondrial genome. The overall GC content (45.8%)across the species was slightly lower than the reported GC contentfor marine teleosts (Lakra et al., 2011; Ward et al., 2005).A higher overall GC content was observed in Eleotridaefamily (47.0 0.10) compared to Gobiidae family (45.0 0.12)(Table 2). This difference was attributable to the GC content ofthe codon 3rd base position (43.2% versus 38.3%). Amongspecies, variation in GC content for codon 3rd base position washigher than for position 1, with variation at position 2 being verylimited (Figure 1). This showed the absence of synonymousmutations at position 2.In this study, the average number of transitions (transitionalpairs Si¼ 61) for COI gene is more than the average number oftransversions (transversional pairs Sv¼ 50) with an average ratioof 1.22. It indicated that the COI sequence for gobiids is notsaturated and can discriminate species. The sequence substitutionsaturation analysis also showed that the sequences were notsaturated as the transitions and transversions were linear whenplotted against genetic distance (K80 model) (Figure 2).Table 1. List of species along with GenBank accession numbers.S.No Order Family Subfamily Genus Species No. of specimens Accession number1. Perciformes Eleotridae Eleotrinae Eleotris fusca 1 JX1937512. Butinae Butis butis 2 JX193740- 413. Gobiidae Amblyopinae Trypauchen vagina 1 JX1937424. Odontamblyopus rubicundus 3 JX193743- 455. Gobionellinae Oxyurichthys ophthalmonema 3 JX193748- 506. Oligolepis acutipennis 2 JX193738- 397. Gobiinae Acentrogobius chlorostigmatoides 3 JX193727- 298. Acentrogobius audax 4 JX193752- 559. Arcygobius baliurus 5 JX193733- 3710. Bathygobius fuscus 2 JX193746- 4711. Psammogobius biocellatus 3 JX193730- 32Table 2. Nucleotide composition of COI gene across gobiids.Sub families A G C T GC GC1 GC2 GC3Eleotridae 24.3 0.07 18.8 0.15 28.2 0.10 28.8 0.14 47.0 0.12 54.3 0.14 43.3 0.02 43.2 0.12Gobiidae 24.9 0.05 18.7 0.14 27.1 0.10 29.3 0.12 45.8 0.10 55.6 0.15 43.4 0.01 38.3 0.14Figure 1. Variation in GC content of COIgene among Eleotridae and Gobiidae family.2 D. Viswambharan et al. Mitochondrial DNA, Early Online: 1–5Mitochondrial DNA Downloaded from informahealthcare.com by 14.139.124.98 on 09/19/13For personal use only.The average K2P (Kimura 2 Parameter method) distancevalues for COI increased from lower taxa toward the highertaxonomic rank and also the average congeneric distance value(D¼ 22.2%) was 18 times more than the average conspecificdistance (D¼ 1.2%) in the present observation which was higherthan the previous reports (D¼ 20.87%) (Table 3). Whereas, themean divergence values among genera (25.3%) and amongfamilies (25.7%) were slightly lower than the previous reports(Hyung-Bae et al., 2012). The gradual increase of geneticvariation through increment of taxonomic level clearly indicatesthe efficacy of DNA barcodes to discriminate the species. Clusteranalysis indicated that the neighbor joining tree of COI for gobiidsclearly discriminated all the species and clustered the similarspecies under same nodes with significant bootstrap values(Figure 3).The nucleotide diagnostic (ND) approach was applied tostrengthen the utility of the DNA barcoding technique to identifyspecies. This approach is similar to the traditional morphology-based methods, where species identification would be based onthe presence or absence of a distinct morphological feature. InND analysis, a distinct DNA character will be assessed which isspecific to the species, thereby preventing the ambiguity foundin analogue measurement (Wong et al., 2009). All species ofeach genus were analyzed together to determine the NDs ofeach species. In this study, total of nine species showed 2 to 10exclusive ND (simple Nucleotide diagnostic character) in 57informative sites (Table 4). Most of the NDs were transversionsthan transitions. Wong et al. (2009) successfully demonstratedthe ND approach to discriminate closely related sharks.DNA barcodes could provide valuable information forconservation biology, like rapid and accurate identification ofspecies, evolutionary histories and phylogenetic diversity. Arduraet al. (2010) have generated DNA barcodes for commerciallyimportant fish species from Amazon River and found that sevenfish species were commercialized under the same name (Acara´).They showed that the DNA barcodes could be used formonitoring species exploitation rate and species-specific trendsin trade. Phylogenetic diversity, which measures taxonomicdivergence between species, is calculated as the sum of thelengths of all the branches that are members of the correspond-ing minimum spanning path (Faith, 1992). An index ofphylogenetic diversity can inform conservation strategies byusing evolutionary lineages (phylogenies) among taxa (Mitchell,2008). The DNA barcodes developed in this study could beuseful for assessing gobiids diversity and monitoring their tradein ornamental fishery. Further, COI sequences reported in thisstudy will supplement the previous reports for estimatingphylogenetic diversity values of gobiids.ConclusionDNA barcodes were developed for 11 species of gobiids fromwest coast of India (Astamudi Lake). Barcodes discriminated allthe analyzed species in congruence with morphological taxo-nomic analysis. This study also attempted to identify diagnosticnucleotide characters in COI region specific to species. Ourstudy makes an important contribution to BOLD database assome of these species are not represented in the database.Figure 2. Sequence saturation plots for COIgene of gobiids.Table 3. Summary of COI genetic divergences (K2P percentage) ofgobiids within various taxonomic levels.Comparison within Minimum Maximum Mean S.E.Species 0.00 5.4% 1.2% 0.02Genera 21.2 23.7 22.2% 0.03Family 21.2 30.3 25.3% 0.03Order 21.0 31.2 25.7% 0.10Table 4. NDs for each species, with sample sizes included in parenthesesafter the species name.S.No Species NDs (nucleotide diagnostics)1. Oligolepis letipennis (07) 3-G;18-G;93-A;195-A;201-T;255-G;303-G;534-A;594-T2. Oxyurichthysophthalmonema (06)186-G;558-C3. Psammogobiusbiocellautus (04)252-G;261-T;294-T;315-C;378-G;390-C;445-G;446-C;459-G;513-G; 554-A;570-T4. Bathygobius fuscus (04) 180-C;595-C5. Arcygobius baliurus (05) 57-A;186-A;291-A;480-A6. Acentrogobius audax (04) 111-C;150-T;249-A;318-T;321-T;345-G;450-G;465-G;504-G7. Acentrogobiuschlorostigmoides (03)15-A;63-C;183-A;309-T;579-C8. Odantamblyopusrubicundus (04)9-A;43-G;129-T;135-T;357-C;525-A;552-T9. Butis butis (03) 12-G;231-G;249-G;285-G;348-C;448-A;516-GFor species with at least one sND, all sNDs are listed. Nucleotidepositions and character states that differ from the species pool by atransversion are in bold.DOI: 10.3109/19401736.2013.834438 DNA barcoding of gobiid fishes 3Mitochondrial DNA Downloaded from informahealthcare.com by 14.139.124.98 on 09/19/13For personal use only.AcknowledgementsThe authors acknowledge Dr. Paul Hebert and Dr. Robert Hanner,University of Guelph, Canada, and Dr. R.D. Ward, CSIRO Marine andAtmospheric Research, Australia, for guidance and support and IndianCouncil of Agricultural Research, New Delhi, for the financial support.Declaration of interestThe authors report no conflicts of interest. The authors alone areresponsible for the content and writing of the paper.ReferencesArdura A, Linde AR, Moreira JC, Garcia-Vasquez E. (2010). DNAbarcoding for conservation and management of Amazonian commer-cial fish. Biol Conserv 143:1438–43.Faith DP. (1992). Conservation evaluation and phylogenetic diversity.Biol Conserv 61:1–10.Hajibabaei M, Smith AA, Janzen DH, Rodriguez JJ,Whitfield JB, Hebert PDN. (2005). A minimalist barcode canidentify a specimen whose DNA is degraded. Mol Ecol Notes 6:959–64.Hebert PDN, Stoeckle MY, Zemlak TS, Francis CM. (2004).Identification of birds through DNA barcodes. PLoS Biol 2:e312.doi:10.1371/journal.pbio.0020312.Hubert N, Hanner R, Hom E, Mandrak NE, Taylor E, Burridge M,Watkinson D, et al. (2008). Identifying Canadian freshwater fishesthrough DNA barcodes. PLoS ONE 3:e2490. doi:10.1371/journal.pone.0002490.Hyung-Bae J, Seung-Ho C, Ho YS. (2012). Exploring the utility of partialcytochrome c oxidase subunit 1 for DNA barcoding of gobies. AnimSyst Evol Divers 28:269–78.Figure 3. Neighbor joining tree of COI genesequences derived from gobiids.4 D. Viswambharan et al. Mitochondrial DNA, Early Online: 1–5Mitochondrial DNA Downloaded from informahealthcare.com by 14.139.124.98 on 09/19/13For personal use only.Lakra WS, Verma MS, Goswami M, Lal KK, Mohindra V, Punia P,Gopalakrishnan A, et al. (2011). DNA barcoding Indian marine fishes.Mol Ecol Res 11:60–71.Min XJ, Hickey DA. (2007). DNA barcodes provide a quick preview ofmitochondrial genome composition. PLoS ONE 2:e325. doi:10.1371/journal.pone.0000325.Mitchell A. (2008). DNA barcoding demystified. Aust J Entomol 47:169–73.Richly E, Leister D. (2004). NUMTs in sequenced eukaryotic genomes.Mol Biol Evol 21:1081–4.Saitou N, Nei M. (1987). The neighbour-joining method: A newmethod for reconstructing phylogenetic trees. Mol Biol Evol 4:406–25.Sambrook SJ, Russel DW, Janssen KA, Irwuin NJ. (2001). Molecularcloning, a laboratory manual (Third Edition). New York: Cold SpringHarbor Laboratory Press.Smith MM, Heemstra PC. (1986). Smiths’ sea fishes (First Edition).Johannesburg, South Africa: Macmillan.Song H, Buhay JE, Whiting MF, Crandall KA. (2008). Many species inone: DNA barcoding overestimates the number of species whennuclear mitochondrial pseudogenes are coamplified. PNAS 36:13486–91.Steinke D, Vences M, Salzburger W, Meyer A. (2005). Taxi – A softwaretool for DNA barcoding using distance methods. Philos Trans R SocLond B Biol Sci 360:1975–80.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. (2011).MEGA5: Molecular evolutionary genetics analysis using maximumlikelihood, evolutionary distance, and maximum parsimony methods.Mol Biol Evol 28:2731–9.Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG.(1997). The ClustalX windows interface: Flexible strategies formultiple sequence alignment aided by quality analysis tools. NuclAcids Res 25:4876–82.Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN. (2005). DNAbarcoding Australia’s fish species. Philos Trans R Soc Lond B Biol Sci360:1847–57.Ward RD, Holmes BH, White WT, Last P. (2008). DNA barcodingAustralasian chondrichthyans: Results and potential uses in conserva-tion. Mar Fresh Wat Res 59:57–71.Winterbottom R, Alofs KM, Marseu A. (2011). Life span,growth and mortality in the western Pacific gobyTrimmabenjamini, and comparisons with T. nasa. EnvironBiol Fish 91:295–301.Wong EHK, Shivji MS, Hanner RH. (2009). Identifying sharks with DNAbarcodes: Assessing the utility of a nucleotide diagnostic approach.Mol Ecol Resour 9:243–56.Xia X, Xie Z. (2001). DAMBE: Data analysis in molecular biology andevolution. J Hered 92:371–3.DOI: 10.3109/19401736.2013.834438 DNA barcoding of gobiid fishes 5Mitochondrial DNA Downloaded from informahealthcare.com by 14.139.124.98 on 09/19/13For personal use only.

DNA barcoding of gobiid fishes (Perciformes, Gobioidei)

http://eprints.cmfri.org.in/10866/1/DNA%20barcoding%20of%20gobiid%20fishes_Mitochondrial%20DNA_2015_26-1-15-19.pdf

DNA barcoding of gobiid fishes (Perciformes, Gobioidei)

Abstract

Similar works

Full text

Available Versions

CMFRI Digital Repository